Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Apr 10.
Published in final edited form as: Lasers Surg Med. 2012 Dec 4;44(10):796–804. doi: 10.1002/lsm.22101

Topical Rapamycin Suppresses the Angiogenesis Pathways Induced by Pulsed Dye Laser: Molecular Mechanisms of Inhibition of Regeneration and Revascularization of Photocoagulated Cutaneous Blood Vessels

Wenbin Tan 1,*, Wangcun Jia 1, Victor Sun 1,2, Martin C Mihm Jr 3, J Stuart Nelson 1,2
PMCID: PMC3982879  NIHMSID: NIHMS561432  PMID: 23213008

Abstract

Background and Objectives

Pulsed dye laser (PDL) is the most effective treatment for port wine stain (PWS) birthmarks. However, regeneration and revascularization of photocoagulated blood vessels may result in poor therapeutic outcome. We have recently shown that rapamycin (RPM), an angiogenesis inhibitor, can reduce the regeneration and revascularization of photocoagulated blood vessels. Herein, we attempt to further elucidate the molecular pathophysiology on the inhibition of the regeneration and revascularization of photocoagulated blood vessels by topical RPM in an animal model.

Materials and Methods

Two separate skin areas on each hamster were irradiated by PDL. After PDL exposure, topical RPM was applied daily to one of the randomly selected test sites. PDL, PDL + RPM and normal skin test sites were biopsied on day 3 after PDL exposure. The total ribonucleic acid (RNA) and protein were extracted from biopsied skin samples and quantified. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and immunoblot were subsequently performed to quantify the mRNA and protein levels of hypoxia-inducible factor-1alpha (HIF-1α), vascular endothelial growth factor (VEGF) and ribosomal protein S6 kinase (S6). The phosphorylation levels of S6 and AKT were also evaluated by immunoblot.

Results

The mRNA and protein levels of HIF-1α, VEGF, and S6 significantly increased after PDL exposure as compared to the normal hamster skin. Topical application of 1% RPM suppressed the PDL-induced increase in mRNA and protein levels of those genes on day 3 post-PDL exposure. The phosphorylation levels of S6 and AKT increased after PDL exposure but the increases were suppressed by the topical application of RPM.

Conclusion

The increase in expression of HIF-1α, VEGF, and S6 after PDL-exposure suggests that angiogenesis pathways play very active roles in the process of skin blood vessel regeneration and revascularization. Topical application of 1% RPM can suppress the angiogenesis pathways and, therefore, reduce the regeneration and revascularization of photocoagulated blood vessels.

Keywords: pulsed dye laser, port wine stain, rapamycin, angiogenesis, HIF-1α, VEGF

INTRODUCTION

Port wine stain (PWS) is a congenital, progressive vascular malformation of human skin involving post-capillary venules and occurs in an estimated 3–5 children per 1,000 live births [13]. Approximately 1,500,000 individuals in the United States and 32 million people worldwide have PWS birthmarks [46]. Since most malformations occur on the face, PWS is a clinically significant problem in the majority of patients. Personality development is adversely influenced in virtually all patients by the negative reaction of others to a “marked” person. Detailed studies have documented lower self-esteem in such patients and problems with interpersonal relationships [79]. Studies have indicated a high level of psychological morbidity in PWS patients resulting from feelings of stigmatization that are frequently concealed in casual social interactions.

In childhood, PWS are flat red macules, but lesions tend to darken progressively to purple and, by middle age, often become raised as a result of the development of vascular nodules [10,11]. The pulsed dye laser (PDL) is the current treatment of choice for PWS [1218]. Yellow light (585–595 nm) emitted by the PDL is preferentially absorbed by hemoglobin, an endogenous chromophore in blood. PDL exposure induces blood vessel wall necrosis after incoming photon energy is converted to heat [1921]. However, the degree of PWS blanching achieved following laser therapy can be variable and unpredictable with an average treatment success rate below 10%, if the ultimate standard required is complete blanching of the lesion, due to the recurrence of the blood vessels [2224].

The regeneration and revascularization of blood vessels post-PDL treatment is a critical barrier to an adequate PWS therapeutic outcome. Our recent data suggest that activation of angiogenesis pathways induced by PDL in PWS contributes to this process [25] but the mechanism(s) remain incompletely understood. Although the complexity of angiogenesis pathways have been studied in normal and tumor vasculature, PDL-induced angiogenesis in PWS skin has not been fully investigated.

PDL treatment of PWS causes intense, acute damage to blood vessels [25]. The skin’s normal wound healing response detects hypoxia and initiates appropriate defense mechanisms, such as angiogenesis. The PDL-induced local hypoxia leads to upregulation of hypoxia-inducible factor-1alpha (HIF-1α), a master modulator for hypoxic response [26,27]. During hypoxia, HIF-1α is stabilized and translocated which results in the transcription of numerous angiogenic genes, including vascular endothelial growth factor (VEGF) [26,27]. VEGF is the predominant growth factor that regulates angiogenesis pathways by signaling via VEGF receptor-2 (VEGFR-2) [28]. Activation of VEGFR-2 will lead to activation of many downstream pathways, including the phosphatidylinositol 3-kinases (PI3K)/AKT/mammalian target of rapamycin (mTOR) signaling [26,2931]. mTOR is a serine-threonine protein kinase that can phosphorylate the 4E-binding protein 1 (4E-BP1) [32] and ribosomal protein S6 kinase (S6) [33,34] which then mediate efficient cap-dependent translation initiation and finally result in regeneration and revascularization of PWS blood vessels.

In this study we hypothesize that PDL combined with administration of angiogenesis pathways’ inhibitors, such as RPM, can improve PWS lesion blanching and thus lead to a better therapeutic outcome as compared to PDL treatment alone. RPM is a FDA-approved anti-angiogenic agent with a relatively low side effect profile [35]. RPM can inhibit mTOR activity by forming a complex with FK-binding protein 12 (FKBP12) and then binding to mTOR directly [3639]. RPM has been used: (1) for immunosuppression in renal transplantation subjects [40]; (2) as anticancer therapy due to inhibition of tumor cell survival and angiogenesis [36,41,42]; and (3) for the treatment of hypervascular anomalies including angiomyolipomas [4346] and many skin diseases, including Kaposi’s sarcoma [4749], psoriasis [50], and angiofibromas [51]. In previous animal model studies, we demonstrated that regeneration and revascularization of blood vessels after PDL was dramatically reduced when the skin was subsequent treated with daily topical RPM application for 14 days as compared to PDL alone [25]. RPM administration abolished the upregulation of certain “stem cell” antigens, such as nestin, thereby interrupting the vascular repair process induced by PDL exposure [52]. Furthermore, we reported a case study from one PWS patient with an extensive lesion involving the left anterior chest and upper extremity. Our results showed that test sites treated with the combined PDL and oral RPM displayed an enhanced blanching response as compared to PDL alone [53]. These previous studies have demonstrated the feasibility and potential of a new therapeutic strategy for PWS. Herein, we attempt to further elucidate the molecular mechanism(s) of PDL combined with topical RPM to block the regeneration and revascularization of photocoagulated blood vessels after laser exposure.

MATERIALS AND METHODS

Animals

All experiments were conducted under a protocol approved by the Institutional Animal Care and Use Committee, University of California, Irvine. Adult male Golden Syrian hamsters with an initial bodyweight of 90–120 g were used.

Laser Irradiation

Laser exposure was performed on the abdominal side of the hamsters. Skin was irradiated with a 585 nm PDL (Candela, Wayland, MA), pulse duration was 0.45 mseconds, energy density was 6 J/cm2 delivered on a 10 mm spot diameter. Each animal had a pair of treatments in two designated areas (1.5 cm × 2 cm) side by side on the skin: PDL + vehicle and PDL + RPM. The vehicle contained the exact same ointment as the topical RPM formulation, but without RPM. The two areas were separated by at least 4 cm. Topical RPM was applied daily for 3 days post-PDL-exposure. The animals were euthanized on day 3 and four biopsy samples (4 mm diameter) were taken from each treated area. Biopsy samples collected from adjacent areas not exposed to PDL or combined PDL + RPM were designated as control.

Topical RPM

The topical RPM formulation used in this study contained 1% (w/w) RPM which was dissolved in benzyl alcohol and thoroughly mixed with a medical ointment and a skin penetration enhancer (Conrex Pharmaceutical, Newtown Square, PA). The mixture was stored at 4°C until use. Solvent, skin penetration enhancer, and ointment mixture were used as vehicle controls. Immediately after post-laser exposure on day 0, topical RPM was applied onto the treatment area and covered with Tegaderm (3M, St. Paul, MN). Every 24 hours after laser irradiation, the skin was cleaned gently with sterile swabs and water to remove any residual RPM and then the RPM ointment and Tegaderm were re-applied. The same procedure was followed for the application of vehicle controls.

RNA Extraction and Real-Time Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Analysis

Total RNA was extracted from skin biopsy samples using the RNeasy Mini kit (Qiagen, Carlsbad, CA) according to the manufacturer’s manual. To generate cDNA, 1.0 µg of total RNA was reverse-transcribed in a 20-µl reaction containing 1× RT buffer (Clontech, Mountain View, CA), 0.5 mm dNTPs, 0.5 µg of oligo (dT) 15-mer primer, 20 units of RNasin, and 5 units of SMART Moloney murine leukemia virus reverse transcriptase (Clontech). The RT reaction was carried out at 42°C for 2 hours. 0.5 µl of each sample (25 ng) was used directly for real-time PCR analysis which was performed using the LightCycler System (Roche, Pleasanton, CA). Table 1 listed the sequences and locations of the primers and the resulting amplicon sizes. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA or the input amount of the total RNA into each reaction was used for normalization. The reaction for the multiplex real-time PCRs contained 1× SYBR Green qPCR Master Mix (Clontech), 25 ng of each template, and 50 nM of each specific primer in a 20-µl total volume. Each reaction was performed in triplicate under identical conditions. The PCR conditions were one cycle at 95°C for 2 min followed by 45 cycles of 30 seconds at 95°C, 30 seconds at 55°C, and 40 seconds at 72°C. Relative quantification of the real-time PCR was based upon the amplification efficiency of the target and reference genes and the cycle number at which fluorescence crossed a prescribed background level, cycle threshold (Ct). A paired t-test was used to compare the expression significance of target genes between control and treatment groups. The results were presented as mean ± SD.

TABLE 1.

Primers for HIF-1α, VEGF-A, S6, and GAPDH

Gene name 5′ primer 3′ primer Location Genbank Amplicon size (bp)
HIF 1α 5′TGAGTTCTGAACGTCGAAAAGAAAAG 3′ 5′TTCTCTCATTTCCTCATGGTCAC 3′ Exon 2–4 gij226061947 200
VEGFA 5′ATCATGCGGATCAAACCTCACC 3′ 5′TGTTCTGTCTTTCTTTGGTCACAT 3′ Exon 4–5 NM_001025257 95
S6 alpha 5′CTTGGCATGGAACATTGTGAG 3′ 5′TCCCTCTCTTTCTAACTGCAT 3′ Exon 2–6 NM_001114334 364
GAPDH 5′ATGGTGAAGGTCGGTGTGAAC 3′ 5′GCCTTCTCCATGGTGGTGAAG 3′ Exon 2–3 NM_008084 316

Protein Extraction and Immunoblot

After the previously described exposure protocols, the biopsy samples were completely homogenized in lysis buffer (5.1 M guanidinium thiocyanate, 50 mM sodium citrate, 50 mM EDTA, 0.5% β-mercaptoethanol). Proteins were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and transferred to nitrocellulose, and the membranes were probed with the indicated primary antibodies. Immunoreactive bands were visualized using a horseradish peroxidase-conjugated secondary antibody and the Amersham Biosciences ECL reagents as described by the manufacturer. Antibodies against VEGF (SC-507), HIF-1α (SC-10790), β-actin (SC-81178), phospho-S6 (SC-8416), S6 (SC-8418), AKT (SC-8312), and phospho-AKT (SC-7985-R) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Relative quantification of protein levels were compared with the level of β-actin in each sample based on densitometry of each band. A paired t-test was used to compare the expression significance of target proteins between control and treatment groups. The results were presented as mean ± SD.

RESULTS

Expression of HIF-1α was Suppressed by Topical Application of RPM

The mRNA level of HIF-1α was investigated using real-time RT-PCR. Typical real-time RT-PCR amplification curves of GAPDH and HIF-1α using SYBR green dye were shown in Figure 1A. The HIF-1α mRNA level in hamsters (n = 3) biopsied at day 3 post-PDL exposure significantly increased in the PDL (P = 0.0277) and PDL + RPM groups (P = 0.0370; Fig. 1B and Table 2) as compared to control. There was a statistically significant difference in the HIF-1α mRNA levels between the PDL and the PDL + RPM groups (P = 0.0487; Fig. 1B and Table 2).

Fig. 1.

Fig. 1

Topical application of RPM significantly suppressed PDL-induced mRNA levels of HIF-1α, VEGF, and S6 in hamsters. A: Real-time PCR amplification curves of HIF-1α and GAPDH with the RNA prepared from the hamster biopsy samples that received 1% topical RPM for 3 days post-laser exposure. B: mRNA levels of HIF-1α, VEGF, and S6 in hamsters biopsied at day 3 post-laser exposure. The data were presented as “mean ± SD” and showed the fold changes of mRNA levels of target genes to the controls. P values were from a paired t-test.

TABLE 2.

Topical Application of RPM Significantly Inhibited PDL-Induced mRNA and Protein Levels of HIF-1α, VEGF, and S6 in Hamsters

Molecules Type Ctl PDL PDL + RPM P* P#
HIF-1 α mRNA 1 4.02 ± 1.28 1.82 ± 0.41 0.0277 0.0487
Protein 1 2.67 ± 0.31 1.22 ± 0.58 0.0008 0.0351
VEGF mRNA 1 3.02 ± 1.98 1.84 ± 0.45 0.0426 0.1903
Protein 1 3.16 ± 1.38 1.19 ± 0.52 0.0203 0.0027
S6 mRNA 1 2.67 ± 0.68 1.20 ± 0.25 0.0255 0.0193
Protein 1 1.57 ± 0.29 1.05 ± 0.34 0.0275 0.0369
Phos-S6 Ser411 1 1.34 ± 0.25 0.98 ± 0.36 0.0153 0.0260
Phos-Akt Ser473 1 1.95 ± 0.19 1.13 ± 0.01 0.0204 0.0272

The data were presented as “mean ± SD” and showed the fold changes of mRNA, protein, and phosphorylation levels of each molecule as compared to the controls (Ctl).

*

P-value for the PDL group as compared to the control group (paired t-test).

#

P-value for the PDL group as comparison to the PDL + RPM group (paired t-test).

The HIF-1α protein level of hamsters (n = 3) biopsied at day 3 post-PDL exposure significantly increased by a factor of 2.67 in the PDL group as compared to the control group (P = 0.0008; Fig. 2 and Table 2). Application of topical 1% RPM significantly suppressed PDL-induced HIF-1α protein levels (P = 0.0351; Fig. 2 and Table 2).

Fig. 2.

Fig. 2

Topical application of RPM significantly suppressed PDL-induced protein levels of HIF-1α, VEGF and S6, and phosphorylation levels of S6 (Ser411) and AKT (Ser473). Biopsy samples were collected from hamster skin after 3 days post-laser exposure. Tissues were completely homogenized and total lysates were prepared. The protein levels of HIF-1α, VEGF and S6, and phosphorylation levels of S6 (Ser411) and AKT (Ser473) were determined by immunoblot analysis following SDS–PAGE.

Topical RPM Suppressed PDL-Induced Expression of VEGF

The mRNA level of VEGF in hamsters (n = 3) biopsied at day 3 post-PDL exposure showed a significant increase in both the PDL and PDL + RPM groups as compared to control (P = 0.0426 and 0.0069, respectively; Fig. 1B and Table 2). RPM decreased the PDL-induced VEGF mRNA level, but the reduction was not statistically significant (P = 0.1903; Fig. 1B and Table 2).

The VEGF protein levels in hamsters (n = 4) biopsied at day 3 PDL-laser exposure showed a significant increase in the PDL group as compared to control (P = 0.0203; Fig. 2 and Table 2). Topical RPM significantly decreased the PDL-induced VEGF protein level (P = 0.0027; Fig. 2 and Table 2).

PDL-Induced S6 Expression was Attenuated by Topical Application of RPM

The mRNA level of S6 in hamsters (n = 3) biopsied at day 3 post-PDL exposure showed a statistically significant increase in the PDL group (P = 0.0255) as compared to control (Fig. 1B and Table 2). There was a significant difference in the S6 mRNA levels between the PDL group and the PDL + RPM group (P = 0.0193; Fig. 1B and Table 2).

The protein levels of S6 in the hamsters (n = 3) biopsied at day 3 post-PDL exposure showed a significant increase in the PDL group (P = 0.0275) as compared to control (Fig. 2 and Table 2). There was a statistically significant decrease of the S6 protein level induced by PDL + RPM when compared to the PDL group alone (P = 0.0369; Fig. 2 and Table 2).

Topical RPM Suppressed Phosphorylation Levels of S6 and AKT Induced by PDL

The phosphorylation levels of both S6 (Ser411) and AKT (Ser473) showed a significant increase as compared to control (P = 0.0153 and 0.0204, respectively; Fig. 2 and Table 2). Topical application of 1% RPM significantly suppressed the PDL-induced phosphorylation levels of both S6 (Ser411) and AKT (Ser473; P = 0.0369 and 0.0260, respectively; Fig. 2 and Table 2).

DISCUSSION

In this study, we have determined that topical application of RPM can significantly suppress PDL-induced expression of HIF-1α, VEGF, and S6. We hypothesize that these three molecules play critical roles in the pathophysiological process of regeneration and revascularization of PWS blood vessels after PDL exposure. Thus, inhibition of VEGF-activated mTOR signaling by its specific inhibitor, RPM [36,41], may potentially lead to better PWS therapeutic outcomes. Inhibition of mTOR by RPM results in suppression of the translation initiation process and, ultimately, inhibition of new blood vessel formation [54]. In this study, we demonstrate that topical RPM can suppress PDL-induced angiogenesis pathways via inhibition of the expression of HIF-1α, VEGF, and S6 (Fig. 3).

Fig. 3.

Fig. 3

Schematic diagram of RPM mediated-inhibition of PDL-induced angiogenesis pathways. The PDL-induced local hypoxia leads to upregulation of HIF-1α, which results in an increase in the transcription of numerous angiogenic genes, including VEGF. Secretion of VEGF will activate VEGFR-2 in the adjacent cells and lead to activation of many pathways, including the PI3K/AKT/mTOR signaling, which ultimately results in regeneration and revascularization of blood vessels. RPM can form a complex with FKBP12 and then bind to mTOR directly to block its activity, resulting in suppression of the phosphorylation of S6 kinase and leading to inhibition of angiogenesis pathways.

Our study has shown that RPM can suppress the PDL-induced increase in HIF-1α expression. HIF-1α is known to control the expression of hundreds of genes involved in angiogenesis, inflammation, bioenergetics, proliferation, motility, and apoptosis [55,56]. As the key molecule acting as a function of oxygen concentration, HIF-1α is regulated at multiple levels in response to hypoxia. First, HIF-1α mRNA expression increases under hypoxia or ischemia. Many studies have shown that HIF-1α mRNA increases in response to hypoxia in rodents [5760] and humans [48,61]. These results are consistent with our findings. Furthermore, the stabilization of HIF-1α mRNA may also contribute to the sustained increase of its mRNA [57]. Second, HIF-1α protein is synthesized and accumulated as a result of hypoxia stimulation. The hypoxia activated mTOR signaling pathway plays a very important role in stimulation of the synthesis of HIF-1α protein and its transcriptional activities [56,62]. HIF-1α has been shown as the downstream target of mTOR with a mTOR signaling motif located at its N terminus which can interact with the regulatory associated protein of mTOR (Raptor) [62]. This pathway affects the translational levels of HIF-1α and serves as amplifiers for maximal expression of HIF-1α rather than the essential triggers for its activation [62]. We also have found that protein levels of HIF-1α, VEGF, and VEGFR-2 [63] increase in PDL-exposed hamster biopsy tissues as compared to control. In our hamster model, the blood vessels are destroyed by PDL. The hypoxia induced by laser exposure is very severe and persistent for days until the vessels are fully regenerated. The increase of HIF-1α protein levels after PDL treatment may be the result from both the increase in its mRNA level and translation rate. We also suspect the increase in HIF-1α protein and mRNA may be the consequences from not only activation of angiogenesis pathways, but also other intermingled biological processes, such as wound healing, defense, and inflammatory responses. Consistent with our findings, RPM has been demonstrated to downregulate hypoxia-induced HIF-1α protein and mRNA levels by many other studies [62,6467]. Inhibition of mTOR signaling by RPM can directly suppress the translation process of HIF-1α and its transcriptional activities [62,68]. The mechanism underlying inhibition of HIF-1α mRNA level by RPM remains incompletely understood but may be an indirect result of inactivation of the mTOR pathway.

VEGF is the growth factor that plays a predominant role in angiogenesis pathways. VEGF can activate VEGFR-2 which can render the full range of VEGF responses in endothelial cells, such as endothelial proliferation, migration and formation of vascular tubulin [28,69]. VEGF and HIF-1α can be upregulated reciprocally through angiogenesis pathways. VEGF is one of the downstream targets of HIF-1α. Hypoxia-activated-HIF-1α can translocate into the nucleus and directly bind to the hypoxia response element of the VEGF promoter and activate its transcription, thus leading to an increase in VEGF mRNA levels [62,65,70,71]. Alternatively, VEGF can increase HIF-1α mRNA translation into protein via PI3K/AKT signaling [70,72]. Many studies have shown that application of RPM can effectively suppress hypoxia-induced expression of VEGF in animal models and cancer patients [36,64,65,67,73]. One mechanism is that inhibition of mTOR by RPM downregulates HIF-1α levels and thus suppresses its transcriptional activity to the VEGF promoter. However, the expression of VEGF can be also be regulated through HIF-1α independent pathways. For example, in primary mesothelial cell culture, RPM has no effect on TGFβ-induced VEGF but suppresses hypoxia-induced VEGF [65]. In colon cancer, hypoxia-induced VEGF does not require HIF-1α but, rather, depends on activation of the PI3K/Rho/ROCK pathway and c-Myc [74]. In our study, topical RPM does not show a complete blockage of hypoxia-induced VEGF for two possible reasons: (1) Topical RPM at the site of action does not achieve a concentration high enough to completely block all mTOR signaling pathways. Thus, increasing the concentration of topical RPM may be one option to improve PWS outcomes; and (2) VEGF is also induced by HIF-1α independent pathways which cannot be completely blocked by topical RPM. In this case, RPM in combination with other drugs to suppress HIF-1α independent pathways should be considered for PWS treatment post-PDL exposure.

In this study, we chose RPM to inhibit regeneration and revascularization of blood vessels post-PDL. Indeed, the current study and our previous findings have showed that topical application of RPM can inhibit angiogenesis pathways in animals. RPM can inhibit the activities of kinases such as S6 and AKT [75,76]. In our animal model, RPM indeed suppresses PDL-induced both phosphorylation levels of S6 and AKT which further confirms the RPM-mediated inhibitory effects on angiogenesis. We did not observe any obvious acute and long-term side effects resulting from topical RPM application in the animals. Thus, topical RPM may be a safe anti-angiogenic agent with potential efficacy which can be used as a novel therapeutic strategy for PWS patients. One potential critical barrier for topical RPM is whether or not the drug can penetrate the stratum corneum in concentrations sufficiently high enough to prevent blood vessel regeneration and revascularization. Based on the expression profiles of some key angiogenic molecules evaluated in our study, we can cautiously conclude that topical RPM does effectively penetrate into hamster skin and induce an inhibitory effect on angiogenesis pathways. However, to date the intradermal concentration of RPM after topical application has not been determined. Therefore, determination of the intradermal concentration of RPM after topical application at the drug action sites in animals and human PWS subjects will be the focus of a future study. Another future study will investigate the expression profiles of these genes during a time course post-PDL with continuous RPM application. We hope to be able to determine the critical window period of RPM application and eliminate possible bounce back expressions of these genes after topical RPM cessation. In one of our clinical reports, we showed that RPM taken by a patient orally and daily for 1 week before PDL and 4 weeks post-PDL resulted in a long-term enhanced blanching response in comparison to PDL treatment alone [53]. This result suggests that proper dosage and duration of RPM can maintain a long-term suppression of regrowth of PWS blood vessels. Collectively, the topical formulation of RPM developed in this study is effective in the hamster model and can be used as a prototype that can be enhanced and adapted for human use in PWS patients.

In conclusion, we have shown that the expression of three key angiogenic molecules, HIF-1α, VEGF, and S6, increased significantly after PDL-exposure. Topical application of RPM can suppress PDL-induced expression of HIF-1α, VEGF, and S6, and the phosphorylation levels of S6 and AKT in our animal model. Our results have provided essential information about the molecular basis of a potentially novel therapeutic strategy for the clinical management of PWS patients using combined PDL + RPM.

ACKNOWLEDGMENTS

This work was supported in part by grants from the National Institutes of Health (AR47551 and AR59244) to J.S.N., Laser Microbeam and Medical Program (P41-RR001192), Sturge Weber Foundation (W.J.), and a research grant from the American Society for Laser Medicine and Surgery (W.T.). Institutional support was provided by the Arnold and Mabel Beckman Foundation and the David and Lucile Packard Foundation.

Footnotes

Conflict of Interest Disclosures: All authors have completed and submitted the ICMJE Form for Disclosure of Potential Conflicts of Interest and none were reported.

This work was presented at the 32nd Annual Conference of the American Society for Laser Medicine and Surgery on April 22, 2012, Kissimmee, FL.

REFERENCES

  • 1.Mulliken JB, Young AR. Vascular birthmarks—Hemangiomas and malformations. Philadelphia, PA: W.B. Saunders Co.; 1988. [Google Scholar]
  • 2.Jacobs AH, Walton RG. The incidence of birthmarks in the neonate. Pediatrics. 1976;58:218–222. [PubMed] [Google Scholar]
  • 3.Pratt AG. Birthmarks in infants. Arch Dermatol Syphilol. 1953;67:302–305. doi: 10.1001/archderm.1953.01540030065006. [DOI] [PubMed] [Google Scholar]
  • 4.Milliken JB, Young AR. Vascular birthmarks: Hemangiomas and malformations. Philadelphia, PA: W.B. Saunders Co.; 1988. [Google Scholar]
  • 5.Jacobs AH, Walton RG. The incidence of birthmarks in the neonate. Pediatrics. 1976;58(2):218–222. [PubMed] [Google Scholar]
  • 6.Pratt AG. Birthmarks in infants. Arch Derm. 1967;67:302–311. doi: 10.1001/archderm.1953.01540030065006. [DOI] [PubMed] [Google Scholar]
  • 7.Heller A, Rafman S, Zvagulis I, Pless IB. Birth-defects and psychosocial adjustment. Am J Dis Child. 1985;139(3):257–263. doi: 10.1001/archpedi.1985.02140050051021. [DOI] [PubMed] [Google Scholar]
  • 8.Malm M, Carlberg M. Port-wine stain—A surgical and psychological problem. Ann Plast Surg. 1988;20(6):512–516. doi: 10.1097/00000637-198806000-00002. [DOI] [PubMed] [Google Scholar]
  • 9.Kalick SM. Toward an interdisciplinary psychology of appearances. Psychiatry. 1978;41(3):243–253. [PubMed] [Google Scholar]
  • 10.Lever WF, Schaumburg-Lever G. Histopathology of the skin. Philadelphia, PA: J.B. Lippincott Co.; 1990. [Google Scholar]
  • 11.Geronemus RG, Ashinoff R. The medical necessity of evaluation and treatment of port-wine stains. J Dermatol Surg Oncol. 1991;17(1):76–79. doi: 10.1111/j.1524-4725.1991.tb01597.x. [DOI] [PubMed] [Google Scholar]
  • 12.Nelson JS, Milner TE, Anvari B, Tanenbaum BS, Kimel S, Svaasand LO, Jacques SL. Dynamic epidermal cooling during pulsed laser treatment of port-wine stain: A new methodology with preliminary clinical evaluation. Arch Dermatol. 1995;131(6):695–700. [PubMed] [Google Scholar]
  • 13.Nelson JS, Milner TE, Anvari B, Tanenbaum BS, Svaasand LO, Kimel S. Dynamic epidermal cooling in conjunction with laser-induced photothermolysis of port wine stain blood vessels. Laser Surg Med. 1996;19(2):224–229. doi: 10.1002/(SICI)1096-9101(1996)19:2<224::AID-LSM15>3.0.CO;2-6. [DOI] [PubMed] [Google Scholar]
  • 14.Chang CJ, Nelson JS. Cryogen spray cooling and higher fluence pulsed dye laser treatment improve port-wine stain clearance while minimizing epidermal damage. Dermatol Surg. 1999;25(10):767–772. doi: 10.1046/j.1524-4725.1999.99100.x. [DOI] [PubMed] [Google Scholar]
  • 15.Chang CJ, Kelly KM, van Gemert MJC, Nelson JS. Comparing the effectiveness of 585-nm vs. 595-nm wavelength pulsed dye laser treatment of port wine stains in conjunction with cryogen spray cooling. Laser Surg Med. 2002;31(5):352–358. doi: 10.1002/lsm.10102. [DOI] [PubMed] [Google Scholar]
  • 16.Chiu CH, Chan HHL, Ho WS, Yeung CK, Nelson JS. Prospective study of pulsed dye laser in conjunction with cryogen spray cooling for treatment of port wine stains in Chinese patients. Dermatol Surg. 2003;29(9):909–915. doi: 10.1046/j.1524-4725.2003.29255.x. [DOI] [PubMed] [Google Scholar]
  • 17.Waldorf HA, Alster TS, McMillan K, Kauvar ANB, Geronemus RG, Nelson JS. Effect of dynamic cooling on 585-nm pulsed dye laser treatment of port-wine stain birthmarks. Dermatol Surg. 1997;23(8):657–662. doi: 10.1111/j.1524-4725.1997.tb00385.x. [DOI] [PubMed] [Google Scholar]
  • 18.Fiskerstrand EJ, Ryggen K, Norvang LT, Svaasand LO. Clinical effects of dynamic cooling during pulsed laser treatment of port-wine stains. Laser Med Sci. 1997;12(4):320–327. doi: 10.1007/BF02767154. [DOI] [PubMed] [Google Scholar]
  • 19.Ashinoff R, Geronemus RG. Flashlamp-pumped pulsed dye laser for port wine stains in infancy; Earlier versus later treatment. J Am Acad Dermatol. 1991;24(3):467–472. doi: 10.1016/0190-9622(91)70075-d. [DOI] [PubMed] [Google Scholar]
  • 20.Nelson JS, Appelbaum J. Clinical management of port-wine stain in infants and young children using the flashlamp-pulsed dye laser. Clin Pediatr. 1990;29(9):503–508. doi: 10.1177/000992289002900902. [DOI] [PubMed] [Google Scholar]
  • 21.Nelson JS. Selective photothermolysis and removal of cutaneous vasculopathies and tattoos by pulsed laser. Plast Reconstr Surg. 1991;88(4):723–731. doi: 10.1097/00006534-199110000-00028. [DOI] [PubMed] [Google Scholar]
  • 22.van der Horst CMAM, Koster PHL, de Borgie CAJM, Bossuyt PMM, van Gemert MJC. Effect of the timing of treatment of port-wine stains with the flash-lamp-pumped pulsed dye-laser. New Engl J Med. 1998;338(15):1028–1033. doi: 10.1056/NEJM199804093381504. [DOI] [PubMed] [Google Scholar]
  • 23.Yohn JJ, Huff JC, Aeling JL, Walsh P, Morelli JG. Lesion size is a factor for determining the rate of port-wine stain clearing following pulsed dye laser treatment in adults. Cutis. 1997;59(5):267–270. [PubMed] [Google Scholar]
  • 24.Katugampola GA, Lanigan SW. Five years’ experience of treating port wine stains with the flashlamp-pumped pulsed dye laser. Brit J Dermatol. 1997;137(5):750–754. [PubMed] [Google Scholar]
  • 25.Jia W, Sun V, Tran N, Choi B, Liu SW, Mihm MC, Jr, Phung TL, Nelson JS. Long-term blood vessel removal with combined laser and topical rapamycin antiangiogenic therapy: Implications for effective port wine stain treatment. Laser Surg Med. 2010;42(2):105–112. doi: 10.1002/lsm.20890. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Coulon C, Georgiadou M, Roncal C, De Bock K, Langenberg T, Carmeliet P. From vessel sprouting to normalization: Role of the prolyl hydroxylase domain protein/hypoxia-inducible factor oxygen-sensing machinery. Arterioscler Thromb Vasc Biol. 2010;30(12):2331–2336. doi: 10.1161/ATVBAHA.110.214106. [DOI] [PubMed] [Google Scholar]
  • 27.Fong GH. Regulation of angiogenesis by oxygen sensing mechanisms. J Mol Med. 2009;87(6):549–560. doi: 10.1007/s00109-009-0458-z. [DOI] [PubMed] [Google Scholar]
  • 28.Carmeliet P, Jain RK. Molecular mechanisms and clinical applications of angiogenesis. Nature. 2011;473(7347):298–307. doi: 10.1038/nature10144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Ferrara N. VEGF-A: A critical regulator of blood vessel growth. Eur Cytokine Netw. 2009;20(4):158–163. doi: 10.1684/ecn.2009.0170. [DOI] [PubMed] [Google Scholar]
  • 30.Nagy JA, Dvorak AM, Dvorak HF. VEGF-A and the induction of pathological angiogenesis. Annu Rev Pathol. 2007;2:251–275. doi: 10.1146/annurev.pathol.2.010506.134925. [DOI] [PubMed] [Google Scholar]
  • 31.Karar J, Maity A. PI3K/AKT/mTOR pathway in angiogenesis. Front Mol Neurosci. 2011;4:51. doi: 10.3389/fnmol.2011.00051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Hay N, Sonenberg N. Upstream and downstream of mTOR. Genes Dev. 2004;18(16):1926–1945. doi: 10.1101/gad.1212704. [DOI] [PubMed] [Google Scholar]
  • 33.Pullen N, Thomas G. The modular phosphorylation and activation of p70s6k. FEBS Lett. 1997;410(1):78–82. doi: 10.1016/s0014-5793(97)00323-2. [DOI] [PubMed] [Google Scholar]
  • 34.Saitoh M, Pullen N, Brennan P, Cantrell D, Dennis PB, Thomas G. Regulation of an activated S6 kinase 1 variant reveals a novel mammalian target of rapamycin phosphorylation site. J Biol Chem. 2002;277(22):20104–20112. doi: 10.1074/jbc.M201745200. [DOI] [PubMed] [Google Scholar]
  • 35.Phung TL, Oble DA, Jia W, Benjamin LE, Mihm MC, Jr, Nelson JS. Can the wound healing response of human skin be modulated after laser treatment and the effects of exposure extended? Implications on the combined use of the pulsed dye laser and a topical angiogenesis inhibitor for treatment of port wine stain birthmarks. Lasers Surg Med. 2008;40(1):1–5. doi: 10.1002/lsm.20599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Guba M, von Breitenbuch P, Steinbauer M, Koehl G, Flegel S, Hornung M, Bruns CJ, Zuelke C, Farkas S, Anthuber M, Jauch KW, Geissler EK. Rapamycin inhibits primary and metastatic tumor growth by antiangiogenesis: Involvement of vascular endothelial growth factor. Nat Med. 2002;8(2):128–135. doi: 10.1038/nm0202-128. [DOI] [PubMed] [Google Scholar]
  • 37.Kwon YS, Hong HS, Kim JC, Shin JS, Son Y. Inhibitory effect of rapamycin on corneal neovascularization in vitro and in vivo. Invest Ophthalmol Vis Sci. 2005;46(2):454–460. doi: 10.1167/iovs.04-0753. [DOI] [PubMed] [Google Scholar]
  • 38.Huang S, Bjornsti MA, Houghton PJ. Rapamycins: Mechanism of action and cellular resistance. Cancer Biol Ther. 2003;2(3):222–232. doi: 10.4161/cbt.2.3.360. [DOI] [PubMed] [Google Scholar]
  • 39.Huang S, Houghton PJ. Mechanisms of resistance to rapamycins. Drug Resist Updat. 2001;4(6):378–391. doi: 10.1054/drup.2002.0227. [DOI] [PubMed] [Google Scholar]
  • 40.Saunders RN, Metcalfe MS, Nicholson ML. Rapamycin in transplantation: A review of the evidence. Kidney Int. 2001;59(1):3–16. doi: 10.1046/j.1523-1755.2001.00460.x. [DOI] [PubMed] [Google Scholar]
  • 41.Guertin DA, Sabatini DM. Defining the role of mTOR in cancer. Cancer Cell. 2007;12(1):9–22. doi: 10.1016/j.ccr.2007.05.008. [DOI] [PubMed] [Google Scholar]
  • 42.Law BK. Rapamycin: An anti-cancer immunosuppressant? Crit Rev Oncol Hemat. 2005;56(1):47–60. doi: 10.1016/j.critrevonc.2004.09.009. [DOI] [PubMed] [Google Scholar]
  • 43.Wienecke R, Fackler I, Linsenmaier U, Mayer K, Licht T, Kretzler M. Antitumoral activity of rapamycin in renal angiomyolipoma associated with tuberous sclerosis complex. Am J Kidney Dis. 2006;48(3):E27–E29. doi: 10.1053/j.ajkd.2006.05.018. [DOI] [PubMed] [Google Scholar]
  • 44.Herry I, Neukirch C, Debray MP, Mignon F, Crestani B. Dramatic effect of sirolimus on renal angiomyolipomas in a patient with tuberous sclerosis complex. Eur J Intern Med. 2007;18(1):76–77. doi: 10.1016/j.ejim.2006.07.017. [DOI] [PubMed] [Google Scholar]
  • 45.Morton JM, McLean C, Booth SS, Snell GI, Whitford HM. Regression of pulmonary lymphangioleiomyomatosis (PLAM)-associated retroperitoneal angiomyolipoma post-lung transplantation with rapamycin treatment. J Heart Lung Transpl. 2008;27(4):462–465. doi: 10.1016/j.healun.2008.01.005. [DOI] [PubMed] [Google Scholar]
  • 46.Bissler JJ, McCormack FX, Young LR, Elwing JM, Chuck G, Leonard JM, Schmithorst VJ, Laor T, Brody AS, Bean J, Salisbury S, Franz DN. Sirolimus for angiomyolipoma in tuberous sclerosis complex or lymphangioleiomyomatosis. New Engl J Med. 2008;358(2):140–151. doi: 10.1056/NEJMoa063564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Yilmaz R, Akoglu H, Yirkpantur A, Kilickap S, Arici M, Altun B, Aki T, Erdem Y, Yasavul U, Turgan C. A novel immunosuppressive agent, sirolimus, in the treatment of Kaposi’s sarcoma in a renal transplant recipient. Ren Fail. 2007;29(1):103–105. doi: 10.1080/08860220601039528. [DOI] [PubMed] [Google Scholar]
  • 48.Zmonarski SC, Boratynska M, Rabczynski J, Kazimierczak K, Klinger M. Regression of Kaposi’s sarcoma in renal graft recipients after conversion to sirolimus treatment. Transpl Proc. 2005;37(2):964–966. doi: 10.1016/j.transproceed.2004.12.172. [DOI] [PubMed] [Google Scholar]
  • 49.Stallone G, Schena A, Infante B, Di Paolo S, Loverre A, Maggio G, Ranieri E, Gesualdo L, Schena FP, Grandaliano G. Sirolimus for Kaposi’s sarcoma in renal-transplant recipients. New Engl J Med. 2005;352(13):1317–1323. doi: 10.1056/NEJMoa042831. [DOI] [PubMed] [Google Scholar]
  • 50.Ormerod AD, Shah SAA, Copeland P, Omar G, Winfield A. Treatment of psoriasis with topical sirolimus: Preclinical development and a randomized, double-blind trial. Br J Dermatol. 2005;152(4):758–764. doi: 10.1111/j.1365-2133.2005.06438.x. [DOI] [PubMed] [Google Scholar]
  • 51.Haemel AK, O’Brian AL, Teng JM. Topical rapamycin a novel approach to facial angiofibromas in tuberous sclerosis. Arch Dermatol. 2010;146(7):715–718. doi: 10.1001/archdermatol.2010.125. [DOI] [PubMed] [Google Scholar]
  • 52.Loewe R, Oble DA, Valero T, Zukerberg L, Mihm MC, Jr, Nelson JS. Stem cell marker upregulation in normal cutaneous vessels following pulsed-dye laser exposure and its abrogation by concurrent rapamycin administration: Implications for treatment of port-wine stain birthmarks. J Cutan Pathol. 2010;37(Supp. 1):76–82. doi: 10.1111/j.1600-0560.2010.01520.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Nelson JS, Jia W, Phung TL, Mihm MC., Jr Observations on enhanced port wine stain blanching induced by combined pulsed dye laser and rapamycin administration. Laser Surg Med. 2011;43(10):939–942. doi: 10.1002/lsm.21141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Humar R, Kiefer FN, Berns H, Resink TJ, Battegay EJ. Hypoxia enhances vascular cell proliferation and angiogenesis in vitro via rapamycin (mTOR) -dependent signaling. FASEB J. 2002;16(8):771–780. doi: 10.1096/fj.01-0658com. [DOI] [PubMed] [Google Scholar]
  • 55.Pugh CW, Ratcliffe PJ. Regulation of angiogenesis by hypoxia: Role of the HIF system. Nat Med. 2003;9(6):677–684. doi: 10.1038/nm0603-677. [DOI] [PubMed] [Google Scholar]
  • 56.Semenza GL. Hypoxia-inducible factors in physiology and medicine. Cell. 2012;148(3):399–408. doi: 10.1016/j.cell.2012.01.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Wang GL, Jiang BH, Rue EA, Semenza GL. Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension. Proc Natl Acad Sci USA. 1995;92(12):5510–5514. doi: 10.1073/pnas.92.12.5510. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Wiener CM, Booth G, Semenza GL. In vivo expression of mRNAs encoding hypoxia-inducible factor 1. Biochem Biophys Res Commun. 1996;225(2):485–488. doi: 10.1006/bbrc.1996.1199. [DOI] [PubMed] [Google Scholar]
  • 59.Palmer LA, Semenza GL, Stoler MH, Johns RA. Hypoxia induces type II NOS gene expression in pulmonary artery endothelial cells via HIF-1. Am J Physiol. 1998;274(2 Pt 1):L212–L219. doi: 10.1152/ajplung.1998.274.2.L212. [DOI] [PubMed] [Google Scholar]
  • 60.Bergeron M, Yu AY, Solway KE, Semenza GL, Sharp FR. Induction of hypoxia-inducible factor-1 (HIF-1) and its target genes following focal ischaemia in rat brain. Eur J Neurosci. 1999;11(12):4159–4170. doi: 10.1046/j.1460-9568.1999.00845.x. [DOI] [PubMed] [Google Scholar]
  • 61.Pialoux V, Mounier R, Brown AD, Steinback CD, Rawling JM, Poulin MJ. Relationship between oxidative stress and HIF-1 alpha mRNA during sustained hypoxia in humans. Free Radic Biol Med. 2009;46(2):321–326. doi: 10.1016/j.freeradbiomed.2008.10.047. [DOI] [PubMed] [Google Scholar]
  • 62.Land SC, Tee AR. Hypoxia-inducible factor 1alpha is regulated by the mammalian target of rapamycin (mTOR) via an mTOR signaling motif. J Biol Chem. 2007;282(28):20534–20543. doi: 10.1074/jbc.M611782200. [DOI] [PubMed] [Google Scholar]
  • 63.Tan W, Jia W, Sun V, Nelson JS. American Society for Laser Medicine and Surgery Annual Conference. Volume 44. Kissimmee, FL, USA: Wiley; 2012. Rapamycin reverses the process of regeneration and revascularization of photocoagulated blood vessels in an animal model; p. 39. [Google Scholar]
  • 64.Chen H, Xiong T, Qu Y, Zhao F, Ferriero D, Mu D. mTOR activates hypoxia-inducible factor-1alpha and inhibits neuronal apoptosis in the developing rat brain during the early phase after hypoxia-ischemia. Neurosci Lett. 2012;507(2):118–123. doi: 10.1016/j.neulet.2011.11.058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Sekiguchi Y, Zhang J, Patterson S, Liu L, Hamada C, Tomino Y, Margetts PJ. Rapamycin inhibits transforming growth factor beta induced peritoneal angiogenesis by blocking the secondary hypoxic response. J Cell Mol Med. 2012;16(8):1934–1945. doi: 10.1111/j.1582-4934.2011.01493.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Hudson CC, Liu M, Chiang GG, Otterness DM, Loomis DC, Kaper F, Giaccia AJ, Abraham RT. Regulation of hypoxia-inducible factor 1alpha expression and function by the mammalian target of rapamycin. Mol Cell Biol. 2002;22(20):7004–7014. doi: 10.1128/MCB.22.20.7004-7014.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Wang W, Jia WD, Xu GL, Wang ZH, Li JS, Ma JL, Ge YS, Xie SX, Yu JH. Antitumoral activity of rapamycin mediated through inhibition of HIF-1alpha and VEGF in hepatocellular carcinoma. Dig Dis Sci. 2009;54(10):2128–2136. doi: 10.1007/s10620-008-0605-3. [DOI] [PubMed] [Google Scholar]
  • 68.Zhong H, Chiles K, Feldser D, Laughner E, Hanrahan C, Georgescu MM, Simons JW, Semenza GL. Modulation of hypoxia-inducible factor 1alpha expression by the epidermal growth factor/phosphatidylinositol 3-kinase/PTEN/AKT/FRAP pathway in human prostate cancer cells: Implications for tumor angiogenesis and therapeutics. Cancer Res. 2000;60(6):1541–1545. [PubMed] [Google Scholar]
  • 69.Koch S, Tugues S, Li X, Gualandi L, Claesson-Welsh L. Signal transduction by vascular endothelial growth factor receptors. Biochem J. 2011;437(2):169–183. doi: 10.1042/BJ20110301. [DOI] [PubMed] [Google Scholar]
  • 70.Semenza GL. HIF-1: Using two hands to flip the angiogenic switch. Cancer Metastasis Rev. 2000;19(1–2):59–65. doi: 10.1023/a:1026544214667. [DOI] [PubMed] [Google Scholar]
  • 71.Semenza GL. Vascular responses to hypoxia and ischemia. Arterioscler Thromb Vasc Biol. 2010;30(4):648–652. doi: 10.1161/ATVBAHA.108.181644. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Kilic E, Kilic U, Wang Y, Bassetti CL, Marti HH, Hermann DM. The phosphatidylinositol-3 kinase/Akt pathway mediates VEGF’s neuroprotective activity and induces blood brain barrier permeability after focal cerebral ischemia. FASEB J. 2006;20(8):1185–1187. doi: 10.1096/fj.05-4829fje. [DOI] [PubMed] [Google Scholar]
  • 73.Vuiblet V, Birembaut P, Francois A, Cordonnier C, Noel LH, Goujon JM, Paraf F, Machet MC, Girardot-Seguin S, Lebranchu Y, Rieu P. Sirolimus-based regimen is associated with decreased expression of glomerular vascular endothelial growth factor. Nephrol Dial Transplant. 2012;27(1):411–416. doi: 10.1093/ndt/gfr261. [DOI] [PubMed] [Google Scholar]
  • 74.Mizukami Y, Fujiki K, Duerr EM, Gala M, Jo WS, Zhang X, Chung DC. Hypoxic regulation of vascular endothelial growth factor through the induction of phosphatidylinositol 3-kinase/Rho/ROCK and c-Myc. J Biol Chem. 2006;281(20):13957–13963. doi: 10.1074/jbc.M511763200. [DOI] [PubMed] [Google Scholar]
  • 75.Medici D, Olsen BR. Rapamycin inhibits proliferation of hemangioma endothelial cells by reducing HIF-1-dependent expression of VEGF. PLoS ONE. 2012;7(8):e42913. doi: 10.1371/journal.pone.0042913. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 76.Phung TL, Ziv K, Dabydeen D, Eyiah-Mensah G, Riveros M, Perruzzi C, Sun J, Monahan-Earley RA, Shiojima I, Nagy JA, Lin MI, Walsh K, Dvorak AM, Briscoe DM, Neeman M, Sessa WC, Dvorak HF, Benjamin LE. Pathological angiogenesis is induced by sustained Akt signaling and inhibited by rapamycin. Cancer Cell. 2006;10(2):159–170. doi: 10.1016/j.ccr.2006.07.003. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES