Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Apr 15.
Published in final edited form as: J Immunol. 2014 Mar 14;192(8):3915–3924. doi: 10.4049/jimmunol.1302174

Gene expression in the Gitr locus is regulated by NF-κB and Foxp3 through an enhancer

Yukiko Tone *,§, Yoko Kidani †,§, Chihiro Ogawa *, Kouhei Yamamoto *, Masato Tsuda *, Christian Peter , Herman Waldmann , Masahide Tone *,
PMCID: PMC3988904  NIHMSID: NIHMS569771  PMID: 24634496

Abstract

Gitr and Ox40, two members of the TNFR superfamily, play important roles in regulating activities of effector (Teff) and regulatory (Treg) T cells. Their gene expression is induced by T cell activation, and further upregulated in Foxp3+ Treg. Although the role of Foxp3 as a transcriptional repressor in Treg is well established, the mechanisms underlying Foxp3-mediated transcriptional upregulation remain poorly understood. This transcription factor seems to upregulate expression not only of Gitr and Ox40, but also other genes including Ctla4, Il35, Cd25, all critical to Treg function. In order to investigate how Foxp3 achieves such upregulation, we analyzed its activity on Gitr and Ox40 genes located within a 15.1-kb region. We identified an enhancer located down stream of the Gitr gene, and both Gitr and Ox40 promoter activities were shown to be upregulated by the NF-κB-mediated enhancer activity. We also show, using the Gitr promoter, that the enhancer activity was further upregulated in conjunction with Foxp3. Foxp3 appears to stabilize NF-κB p50 binding by anchoring it to the enhancer, so enabling local accumulation of transcriptional complexes containing other member of the NF-κB and IκB families. These findings may explain how Foxp3 can activate expression of certain genes while suppressing others.

Introduction

Gitr (Glucocorticoid-induced tumor necrosis factor receptor, Tnfrsf 18) and Ox40 (CD134, Tnfrsf 4) are members of the TNF receptor superfamily (1), and expressed on T cells. Expression of both receptors is upregulated by activation, and in particular, kept constitutively high on CD4+CD25+Foxp3+ regulatory T cells (Treg) (24), cells essential to the prevention of autoimmune disease and other forms of immunopathology (57). The development and function of Treg are regulated by the transcription factor Foxp3, which represses many genes by associating with other transcription factors including NFAT (8), the p65 subunit of NF-κB (9) and Runx1 (10). However, a number of other genes such as Ctla4, Il35, Cd25, Ox40 and Gitr are upregulated in Foxp3+ Treg (2, 11), all these gene products playing essential roles in Treg function (12). Signaling through Gitr and Ox40 has been shown to neutralize the suppressive effects of Treg in vitro (3, 13). In addition, Ox40 signaling inhibits induced Treg (iTreg) development in periphery by blocking TGF-β/TCR signal-mediated induction of Foxp3 (14, 15). The Gitr and Ox40 genes are particularly interesting as models for Foxp3-mediated transcriptional upregulation, because they are located within a short 15.1-kb stretch of the mouse genome, suggesting control by a common regulatory region. We have previously shown a similar clustering of MS4A gene family members, also upregulated by Foxp3 (16), where we postulated the existence of a comparable Foxp3-associated regulatory region at that gene locus. We selected the Gitr/Ox40 rather than the MS4A gene locus for study because the latter is far larger, extending over 600-kb, and therefore more challenging for analysis.

Not only are Gitr and Ox40 influential in Treg, but they also act as co-stimulatory receptors for effector T cells (Teff) (1, 1719). Gitr and Ox40 are unique molecules playing seemingly different roles in Teff and Treg, with the distinct functions possibly determined by expression levels of these receptors on each T cell subset (low on Teff and high on Treg). In either case, the mechanisms underlying gene expression remain poorly understood, although we know that Ox40 expression is regulated by constitutively active transcription factors, and upregulated by NF-κB in activated Teff (20). In order to define the molecular mechanisms responsible for upregulation of Gitr and Ox40 in more detail, we here seek clues within the Gitr and Ox40 gene locus in both Teff and Treg.

We identify an enhancer located downstream of the Gitr gene. Histone H4 molecules in this region are highly acetylated both in activated T cells and Foxp3+ Treg. We show that enhancer activity is regulated by NF-κB in activated Teff, and by NF-κB in conjunction with Foxp3 in Treg. We propose that Foxp3 stabilizes binding of the p50 subunit of NF-κB to the enhancer. Although p50 does not contain a transactivation domain, the p50/Foxp3 complex on the enhancer interacts with other members of the NF-κB and IκB family (e.g., p65, c-Rel, Bcl-3) to supply transactivation domains to the complex. This may explain how Foxp3 can suppress expression of many genes, while also upregulating others.

Materials and Methods

Cell Culture

EL4 subclones LAF and BO2 cells were cultured in IMDM with L-glutamine & 25 mM HEPES (Cellgro) and 5% FBS. T cells were cultured in RPMI 1640 with L-glutamine (Cellgro) and 10% FBS. CD4+ T cells and T cells were isolated from mouse spleen using CD4+ T cell isolation kit (Miltenyl Biotec) and Pan T cell isolation kit (Miltenyl Biotec), respectively. CD4+CD25+ Treg cells were purified by a cell sorter using anti-CD4 (RM4-5, eBiosciences) and anti-CD25 (PC61.5, eBiosciences) from pre-isolated CD4+ T cells, isolated CD4+CD25+ T cells were analyzed by internal Foxp3 staining kit (eBiosciences), and Foxp3+ T cells were > 95%. If required, T cells were stimulated with plate-coated anti-CD3 (KT3, 5 μg/ml in PBS). To generate iTreg, CD4+CD25 T cells were isolated from wild type and Foxp3-GFP reporter mice (Jackson laboratory) and stimulated with TGF-β (5ng/ml) (PeproTech), anti-CD28 (1 μg/ml) and anti-CD3 (plate coated). To isolate Foxp3+ iTreg, the stimulated cells were sorted with GFP. Splenocytes and thymocytes were isolated from Nf-κb p50 deficient mice (Jackson laboratory) and wild type mice.

The preparation of bone marrow-derived dendritic cells (bmDCs) has been described previously (21). Briefly, bone marrow cells from Balb/c mice were cultured for 7 days with granulocyte/macrophage colony-stimulating factor (5 ng/ml). If required, bmDCs were stimulated with LPS (10 μg/ml).

EL4 and CD4+ T cells were cultured with NF-κB Activation inhibitor (EMD Biosciences) in DMSO. These cells were pre-treated with NAI for 30 min before stimulation, and then cultured with anti-CD3 coated plates. Ox40 and Gitr expression was analyzed by qRT-PCR (EL4), and by FACS (CD4+ T cells, gated by 7-ADD and CD4+) with anti-Ox40 (OX-86, eBiosciences) and anti-Gitr (DTA-1, eBiosciences).

RT-PCR

Total RNA was isolated from EL4 cells and T cells using RNeasy mini kit (Qiagen), and cDNA was prepared with iScript cDNA synthesis kit containing random and oligo dT primer mixture (Bio-Rad). qRT-PCR was performed by using SsoFast EvaGreen supermix (Bio-Rad). PCR primers used were as follows: Gitr forward, GACCCTCAGT GCAAGATCTGC; Gitr reverse, CCTCAGCTGACAACTGCACCTC; Ox40 forward, GTAGACCAGGCACCCAACC; Ox40 reverse, GGCCAGACTGTGGTGGATTGG; Gapdh forward, TGGTGAAGGTCGGTGTGAACGGATTT; Gapdh reverse, TGTGCC GTTGAATTTGCCGTGAG; 18S ribosomal RNA (rRNA) forward, CTTAGAGGG ACAAGTGGCG; 18S rRNA reverse, ACGCTGAGCCAGTCAGTGTA. Gitr, Ox40, and Gapdh expression levels were normalized to 18S rRNA levels.

Construction of Luciferase reporter plasmids and luciferase assay

1.22-kb DNA fragment of the Gitr promoter and its deletion mutants were amplified by PCR, cloned into the pGL4 basic vector (Promega), and DNA sequences of the all inserted fragments were determined to remove deformed fragments generated by PCR errors. To construct enhancer luciferase reporter plasmids, Pro8 Gitr promoter luciferase reporter plasmid was used. Potential enhancer DNA fragments [1.6-kb fragment (containing a HS1 site), 1.15-kb fragennt (containing HS2 site) and 0.28-kb fragment (containing HS3 site)] were PCR amplified, and inserted into Sal I site located downstream of the luciferase gene. To construct Ox40 promoter-enhancer plasmid, the enhancer core fragment were inserted into the Sal I site located downstream of the luciferase gene of the Ox40 promoter reporter plasmid (carrying 1.97-kb DNA fragment as Ox40 promoter) shown in the previous publication (20). The enhancer deletion mutant fragments were PCR amplified and integrated in to the Sal I site of the Gitr Pro8 reporter plasmid. The +39, +136, +183 and Wt core enhancer fragments contain the same 3′-end (+286), and +71, +108, +193 and Wt core enhancer fragments contain the same 5′-end (+1). These positions are shown in Supplemental Fig. 3A. Mutations in the enhancer sequence (Fig. 3A) were introduced into the enhancer fragment by PCR assemble procedure, and the mutated fragments were integrated in to the Sal I site in the Gitr Pro8 promoter reporter plasmid. DNA sequence of the all inserted fragments were determined to remove defective fragments generated by PCR errors.

FIGURE 3.

FIGURE 3

Three NF-κB binding sites in the enhancer core sequence. (A) DNA sequence of the enhancer core (286-bp) is shown. NF-κB binding sites (κB1, κB2 and κB3) are indicated in bold. Transcription factor binding to κB1, κB2 and κB3 probes (probe positions are underlined) with or without mutations (indicated by italic upper the κB sites) were used for EMSA in (B) and Fig. 4., and enhancer activity with mutations of the κB sites were analyzed in (C). (B) Transcription factor binding to the wild type (Wt) and mutant κB probes (shown in A) were analyzed using the indicated probes and a nuclear extract from CD3-activated EL4 cells with anti-CD3 for 1.5 h. (C) Enhancer activity was analyzed using the enhancer fragment with or without mutations shown in (A). Luciferase assays were performed in Non-activated (Non) and CD3-activated (CD3) EL4 cells using the indicated plasmids, and activities were compared with the negative control plasmid (no promoter and no enhancer) (Basic). Positions of the potential NF-κB binding sites (κB1, κB2 and κB3) are indicated by gray boxes. The mutated sites are indicated by X. Data are representative of more than three (B and C) independent experiments (error bars indicate the s.d. of triplicate samples).

For the luciferase assay, 5×106 EL4 LAF (Fig. 2 and Fig. 3) and EL4 BO2 (Fig. 8) cells were transfected by Gene Pulser Xcell (Bio-Rad) with 5 μg of the luciferase reporter plasmids and 2 μg of phRL-TK (Promega) as an internal control plasmid, and cultured for 24 h in six-well plates. If required, cells were activated with plate coated anti-CD3 (5 μg/ml in PBS). Cells were harvested, and promoter or enhancer activity was analyzed by Dual-Luciferase Reporter Assay System (Promega). Foxp3, NF-κB p50, p65 and c-Rel expression plasmids were constructed using pMF-neo vector (expression is regulated by EF1α promoter). To remove the IκB homologous from p50, p50 cDNA encoding 1 to 423 amino acids was PCR amplified and cloned into pMF-neo vector. For co-transfection experiments, 4 μg of Gitr promoter-enhancer plasmid was co-transfects with 4 μg of each expression plasmid indicated in Fig. 8. Total DNA amount was adjusted with the empty pMF-neo vector. EL4 BO2 subclone was used for this assay.

FIGURE 2.

FIGURE 2

Identification of an enhancer in CD3-activated T cells and Treg. Assays were performed with non-activated (Non) and CD3-activated (CD3) cells. (A) Structures of the promoter/enhancer reporter plasmids used in B, C, D and E are illustrated. DNA fragments containing HS1, HS2 or HS3 sites were inserted downstream of the luciferase gene in both orientations (sense; S and antisense; AS) and these plasmid were used in B. The reporter plasmid containing the enhancer in sense orientation was used in C, D and E. Luciferase assays were performed using EL4 cells under indicated conditions. (B) Luciferase assays were performed using EL4 cells under indicated conditions. Luciferase reporter plasmids were constructed using the Gitr promoter as shown in A. Luciferase activities were compared with that given by the negative control vector (Basic, no promoter and no enhancer). (C) The enhancer activity was detected with both the Ox40 and the Gitr promoter. The promoter in the Gitr promoter/enhancer with HS3 (sense) plasmid (shown in A) was swapped with the Ox40 promoter, and luciferase assay was performed using the Ox40 and Gitr promoter (Pro) and the Ox40 and Gitr promoter/enhancer (Pro+HS3) reporters. (D) and (E) Luciferase assays were performed using the wild type (Wt) enhancer and 5′-deletion mutants (D) and 3′-deletion mutants (E). These deletion mutants are illustrated with the possible NF-κB sites indicated by gray boxes (κB1, κB2 and κB3). (F) Acetylation of histone H4 molecules in the chromatin region containing the κB1+κB2 and κB3 sites in CD3-activated T cells (T cells were activated by anti-CD3 for indicated times) was analyzed by ChIP using anti-acetyl-histone H4 (AcH4) or control IgG (IgG). (G) Acetylation of histone H4 was also analyzed using CD4+CD25 T cells (CD25) and nTreg as described in (F). Data are representative of more than three (B to G) independent experiments (error bars indicate the s.d. of triplicate samples).

FIGURE 8.

FIGURE 8

NF-κB p50 and Foxp3 co-operate to upregulate enhancer activity. (A and B) The Gitr promoter-enhancer luciferase reporter plasmid (Pro8+Enhancer) was co-transfected with empty Vector, p50, and/or p65 (A) or c-Rel (B) expression plasmids with or without Foxp3 expression plasmid. Co-transfected expression plasmids are indicated under the graph. Total amount of DNA for transfection was adjusted by addition of DNA from the empty vector. Luciferase activity with negative control plasmid Basic (no promoter and no enhancer) and Pro8 (no enhancer) are also shown. *P<0.05, **P<0.005 (Student’s t-test). (C) Gitr promoter-enhancer luciferase reporter plasmid (Pro8+Enhancer) was co-transfected with 4 μg of p50 expression plasmid (p50) and different amounts of Foxp3 expression plasmid (0 to 8 μg). DNA amounts of the expression plasmids are shown under the graph. The total amount of DNA was adjusted with addition of DNA from the empty vector. (D) Model of NF-κB p50 and Foxp3 binding to the κB1 site. (E) Model of NF-κB p50, Foxp3 and NF-κB p65 or c-Rel binding to the κB site. Data are representative of more than three (A to C) independent experiments (error bars indicate the s.d. of triplicate samples).

DNase I hypersensitive assay

Isolated nuclei were treated with DNase I (0 to 25 units/ml) at 25 °C for 5 min in 60 mM KCl, 15mM NaCl, 5mM MgCl2, 0.1 mM EGTA, 15 mM Tris-HCl (pH7.4) 0.5 mM dithiothreitol, 5% glycerol, 10% sucrose, DNAs were isolated and digested with Kpn I, Sph I, EcoRI, Xba I, Xho I or Sal I. DNase I hypersensitive site were analyzed by Southern blot hybridization, and probe positions (for Kpn I digestion) are indicated in Supplemental Fig. 2.

Electrophoretic Mobility Shift Assay (EMSA)

EMSA was performed with 32P-labeld probes and 2 μg of nuclear extracts in 20 μl of EMSA reaction buffer [2 μg of poly(dI-dC)poly(dI-dC), 20 mM HEPES (pH7.9), 1 mM MgCl2, 40 mM KCl, 0.1 mM EDTA, 1 mM DTT and 12% glycerol]. Nuclear extracts were prepared from non-activated, CD3-activated (for 1.5 h and 24 h) EL4 cells as described previously (20). To perform competition assays, 100-fold excess of unlabeled competitor oligonucleotides was added to EMSA reaction mixture. To perform supershift assay, nuclear extracts in EMSA reaction buffer were incubated for 15 min with anti-Sp1 (Santa Cruz, PEP2), anti-Sp3 (Santa Cruz, D-20), anti-NF-κB p50 (Santa Cruz, D-17), and anti-NF-κB p65 (Santa Cruz, C-20), and probes were added into the reaction mixture.

Chromatin Immuno-precipitation (ChIP)

ChIP assay was performed using Pan T cells, CD4+CD25 T cells, TGF-β induced iTreg (93% purity) and CD4+CD25+Foxp3+ nTreg cells (purity more than 95%) as described previously (20). These cells were fixed (for 10 min at room temperature in 1% formaldehyde, 4.5 mM HEPES pH8.0, 9 mM NaCl, 0.09 mM EDTA, and 0.045 mM EGTA) and sonicated (Bioruptor) in lysis buffer (1% SDS, 10 mM EDTA, and 50 mM Tris-HCl pH 8.0) with proteinase inhibitor (Sigma-Aldrich P8340). Pre-cleared lysates were incubated overnight at 4 °C with polyclonal anti-acetyl histone H4 (Millipore), anti-NF-κB p50 (Abcam, anti-p105/p50-ChIP grade) or control rabbit IgG (Santa Cruz). DNA fragments were isolated from the immuno-precipitated chromatin, and analyzed by real-time PCR with SsoFast EvaGreen supermix (Bio-Rad). PCR primers for ChIP used were as follows: κB1/κB2 forward, TTACACTGGAAACACCACAGGTGG; κB1/κB2 reverse, TGCTGGCTTCAAGGCAAGGATACA; kB3 forward, TGCATTCCACTCACGTCCAC; κB3 reverse, GGGCACTGTCCCTCAGCTAC.

Pull-down assay

A 101-bp DNA fragment containing the κB1 and κB2 sites was amplified by PCR using biotinylated primers and purified using QIAEX II Gel Extraction System (QIAGEN). Purified probes (500 ng) were mixed with nuclear extract (50 μg) in 400 μl of binding buffer [60 mM KCl, 12 mM HEPES (pH 7.9), 4 mM Tris-HCl (pH 8.0), 1 mM EDTA, 1mM EGTA and 12% glycerol] containing 1.66 mM DTT, 0.06% BSA and 20 μg of poly(dI-dC) at 4°C for 2 h. If required, 100 pmol Sp1 binding oligo from CD40 promoter(22) and 500 pmol indicated competitor oligos were added. Then, pre-cleared streptavidin-agarose beads (life Technologies) were mixed with the DNA–nuclear extract mixture for 2 h. The streptavidin-agarose beads were then washed five times with 1 ml of binding buffer, and then 2x SDS sample buffer was added. The samples were analyzed by Immunoblotting. PCR primers used were as follows: κB forward: biotin-GAAACACC ACAGGTGGGACA; κB reverse, CACACCCATCAGCCGCCCACA; Gitr promoter forward, biotin-TGGGAGAGGCATGTAGGGGTTAGA; Gitr promoter reverse, TTTCCGGCAGACATCTGAGGT

Immunoprecipitation and Immunoblotting

A Nuclear extract was prepared from a p50 (1 – 423 amino acid) - Foxp3 (FLAG-tagged) transfectant. 10μg nuclear extract were pre-cleared with protein G (Invitrogen) for 3 h in 5% glycerol, 12mM Hepes (pH7.9), 4mM Tris (pH8.0) 60mM KCl, 0.1mM EDTA, 1mM DTT, poly(dI-dC)Poly(dI-dC) 20 μg, 4 μl of proteinase inhibitor (Sigma-Aldrich P8340) with or without 92 bp DNA (16 to 108, Fig. 3). 2 μg of anti-p50 (Santa Cruz, C-19) or control goat IgG was added and incubate at 4 °C for overnight, protein G was added, and incubated for 2h at 4°C. Protein G was washed with the binding buffer, and analyzed by immunobloting.

Immunoblotting was performed with anti-p50 (Santa Cruz, C-19), anti-p65 (Santa Cruz, C-20), anti-c-Rel (Santa Cruz, C), anti-Bcl-3 (Acris, SP7024P), anti-Foxp3 (Cell Signaling D608R) and anti-FLAG (Sigma). Antibody binding was detected by using Luminata Forte Western HRP Substrate (Millipore).

Statistics

Significance was determined with Student’s t-test.

Results

A scheme for identifying regulatory regions in the Gitr/Ox40 gene locus in Teff and Treg

Because CD4+CD25+Foxp3+ Treg are normally present in relatively low abundance, and because primary T cells are not ideal for transfection-based procedures such as luciferase-reporter assays, we adopted the following strategy to identify regulatory regions in the Gitr/Ox40 locus in activated Teff and Treg. First, we identified regulatory regions such as promoters and enhancers in both activated T cells (using TCR cross-linking by anti-CD3) and the EL4 T cell line (which is known to retain many features of T cells), and characterized the regulatory region in activated T cells. We then determined whether that regulatory region was functional in both TGF-β induced Treg (iTreg) (23, 24) and natural Treg (nTreg), and thereafter, proceeded to investigate the molecular basis for the upregulation in Foxp3+ Treg. Since Foxp3 gene expression is maintained by transcription factors induced by TCR-CD3 signaling, these factors should translocate into the nuclei of Foxp3+ Treg. Knowing that Foxp3 can associate with these activated factors in Treg (810, 25), it was then conceivable that the Foxp3-responsive regulatory region coincides with those regions involved in CD3 activation.

Ox40 gene expression can be upregulated by CD3-activation in both T cells and EL4 cells (20), and as shown in Fig. 1A, Gitr gene expression is also upregulated in both cell types, suggesting that expression of these genes in primary T cells and the EL4 cell line is regulated by the same regulatory mechanisms. Regulation of Foxp3 gene expression in T cells and our EL4 sub-clone was also comparable (26). These data suggest that the EL4 T cell line can be used to probe Gitr and Ox40 gene expression and that this information is relevant to primary Teff and induced Treg.

FIGURE 1.

FIGURE 1

Regulation of Gitr gene expression in non-activated (Non) and CD3-activated (CD3) T cells. (A) Gitr RNA expression levels were analyzed by qRT-PCR using RNA from non-activated and CD3-activated (activated with anti-CD3) EL4 cells and T cells. Expression levels of Gitr RNA were normalized relative to 18S ribosomal RNA levels. (B) Gitr promoter activity was analyzed by luciferase reporter assay using Gitr promoter deletion mutants. All promoter fragments contain the same 3′-ends (+46) and positions of the 5′-ends are indicated in the right hand side of the graph. The promoter activity was analyzed using EL4 under indicated conditions. (C) DNase I hypersensitive assay was performed. Nuclei from indicated cells were treated by DNase I under different concentrations [low (left) to high (right), indicated by the triangle]. DNA isolated from the nuclei was digested with Kpn I and analyzed by Southern blot hybridization using the probe shown in (D). CD3-activated T cell specific DNA fragments are indicated by an arrow (HS3). (D) The activated T cell (including EL4) specific DNase I hypersensitive sites are indicated by solid arrows (HS1, HS2 and HS3) upper the map of the Ox40 and Gitr gene locus, and common DNase I hypersensitive sites in non-activated and CD3-activated cells are indicated by arrows with dotted lines below the map. Exons are indicated by gray boxes, and position of the probe for the Southern blot hybridization is indicated by a solid line. Data are representative of three (A) or four (B) independent experiments (error bars indicate the s.d. of triplicate samples), three to four independent experiments with different restriction enzymes (C and D).

Identification of an enhancer containing CD3-activation response elements

Using this scheme, we analyzed promoter activity in activated cells. We had previously identified a NF-κB binding site in the Ox40 promoter (20) that was involved in the response to CD3. We used the same approach here to investigate the Gitr promoter, using a luciferase reporter assay, a series of deletion mutants (Pro1 to Pro8 in Fig. 1B). Gitr promoter activity was detected in both non-activated and CD3-activated EL4 cells, but no CD3-activation response element was identified within the 1.22-kb Gitr promoter. Regardless of activation, promoter activity was reduced to basal levels by deleting 39 bp from −90 (Pro3) to −51 (Pro2). Binding of the transcription factor NFI – which is known to be constitutively and ubiquitously expressed (27) – to this region was detected using the electrophoretic mobility shift assay (EMSA) (Supplemental Fig. 1). Gitr basal promoter activity seems, therefore, to be constitutively regulated through this region, suggesting that this gene expression is upregulated by other regulatory regions containing CD3-activation response elements in activated T cells.

To identify the regulatory regions involved, DNase I hypersensitive assays were performed. Since DNase I hypersensitive sites (HSs) were generated by disruption of nucleosome chromatin structure by additional factor bindings, some of HSs are observed in promoters and enhancers. Regulatory regions containing CD3 response elements might be located near CD3-activated T cell specific HSs. We therefore compared positions of DNase I HSs in non-activated and CD3-activated CD4+ T cells, EL4 and bone marrow derived dendritic cells (Fig. 1C and Supplemental Fig. 2). Many common HSs were detected in the Gitr/Ox40 gene locus (Fig. 1D). However, three additional sites were observed only in CD3-activated cells (Fig. 1C, Fig. 1D and Supplemental Fig. 2) which we term HS1, HS2, and HS3 (HS1 was detected only in CD3-activated CD4+ T cells).

We next examined enhancer activities in regions containing HS1, HS2, or HS3 using a luciferase reporter assay. As shown in Fig. 2A, DNA fragments containing these HSs were integrated downstream of the luciferase gene in the Gitr promoter reporter plasmid (Fig. 1B, Pro8). Promoter activity was enhanced with the fragment containing HS3 in both orientations (Fig. 2A and Fig. 2B) in CD3-activated cells but not in non-activated cells. The enhancer activity was also analyzed using the Ox40 promoter (1.97-kb). Unlike the Gitr promoter, Ox40 promoter activity is itself increased 2-fold in CD3-activated cells (Fig. 2C, Pro) by NF-κB as previously described (20), but this promoter activity was upregulated far more by this enhancer (Fig. 2C), suggesting strong enhancer activity. Enhancer activity was further analyzed by luciferase assays (Fig. 2A, 2D and 2E). Searching the transcription factor database, we found three potential NF-κB binding sequences in this enhancer region (referred to henceforth as κB1, κB2 and κB3) (Fig. 2D and 2E, gray boxes). Since the enhancer activity was only detected in CD3-activated cells but not resting T cells, we hypothesized that enhancer activity might be regulated by activated NF-κB through these sites. This possibility was investigated by using the 5′-(Fig. 2D) and 3′- (Fig. 2E) deletion mutants of the enhancer. Luciferase activity using the Wt enhancer was reduced by deletions from +1 to +39 and from +39 to +136 (Fig. 2D). The deleted regions +1/+39 and +39/+136 contain κB1 and κB2 sites, respectively (Fig. 2D). Although the 5′-deletion mutant (+183) contained one potential NF-κB site (κB3), the enhancer activity was similar to that of the negative control (Fig. 2D, +183 and no enhancer). To investigate whether the κB3 site is simply not functional, or whether the κB sites co-operate to regulate enhancer activity, we performed luciferase assays using the 3′-deletion mutants (Fig. 2E). Luciferase activity was reduced by the deletion containing the κB3 site (Fig. 2E +193), suggesting that this 3′-region containing κB3 cooperatively regulates enhancer activity as well. Such co-operative regulation was also deduced from the 3′-deletion mutant +71 containing κB1 but not κB2 and κB3 (Fig. 2E), as the enhancer activity of this deletion mutant was similar to the negative control. These results strongly suggest that the three NF-κB binding sequences, identified using the transcription factor database, are strong candidates as regulatory elements within this enhancer. We then analyzed histone H4 acetylation by chromatin immunoprecipitation (ChIP) as marker for open chromatin in the κB1+κB2 (κB1 and κB2 cannot be analyzed separately by this assay because these two sites are too close to each other) and κB3 regions (Fig. 2F). H4 molecules in T cells became highly acetylated within 24 h of activation, suggesting that the chromatin of these regions opens up after CD3-activation. Histone H4 in these regions was also highly acetylated in nTreg but not in naïve CD4+CD25 T cells (Fig. 2G), suggesting this regulatory region also functions in nTreg.

NF-κB regulates enhancer activity

As shown in Fig. 2, the 286-bp enhancer sequence (Fig. 3A) encodes three potential NF-κB binding sequences. Transcription factor binding to these sites was analyzed by EMSA in Fig. 3B and Fig. 4. To assess the contribution of these potential NF-κB sites and to investigate the existence of other regulatory elements in the enhancer, luciferase reporter assays were performed using mutations in the potential NF-κB binding sequences in the Gitr promoter/enhancer reporter plasmid (Fig. 3A and 3C). No factor binding to the mutated sequences could be detected by EMSA using a nuclear extract from CD3-activated cells (Fig. 3B). Mutation of any of the potential NF-κB binding sites reduced enhancer activity, and mutating all three sites eliminated it (Fig. 3C), suggesting that all three sites regulate enhancer activity. The κB1 site was identified as the strongest regulatory element in this enhancer because the enhancer activity was resulted to less than 20% by mutation of the κB1 sequence. However, similar reductions were observed with double mutations at the κB2 and κB3 sites. These results indicate that enhancer activity is cooperatively regulated by the transcription factors binding to κB1, κB2 and κB3 sites.

FIGURE 4.

FIGURE 4

NF-κB binding to the enhancer. Binding of transcription factors to the enhancer region was analyzed by EMSA performed using 32P-labeled indicated probes (Fig. 3A). (A) EMSA using nuclear extracts from non-stimulated (Non) and CD3-activated (CD3) (24 h activation) EL4 cells. (B) Competition EMSA using the κB3 probe with a nuclear extract prepared from CD3-activated (1.5 h) EL4 cells. Added cold competitors (100-fold excess) are indicated by +. (C) Super-shift EMSA using a nuclear extract prepared from CD3-activated (1.5 h) EL4 cells, indicated probes, and anti-NF-κB p50 (anti-p50) and anti-NF-κB p65 (anti-p65). To block Sp1 and Sp3 binding to the κB1 and κB2 probes, cold Sp1 competitor (100 fold) was added to the reaction mixture. Added antibodies are indicated by +. Data are representative of more than three independent experiments (A to C).

Transcription factor binding to each κB site was detected by a simple EMSA using a nuclear extract from CD3-activated cells (Fig. 3B). Although all probes encode potential NF-κB binding sequences, binding patterns were not exactly same. We therefore investigated transcription factor binding in more detail. (Fig. 4). First, we performed EMSA using nuclear extracts from non-activated and CD3-activated cells (Fig. 4A). We detected both constitutive and induced binding to the κB1 and κB2 probes, but only induced binding to the κB3 probe (Fig. 4A). As shown in Supplemental Fig. 3, the constitutively-active transcription factors binding to κB1 and κB2 were Sp1 and Sp3, that bind to sequences overlapping the NF-κB binding sites. Binding of the same induced factors to all probes was suggested by inhibition of binding to the 32P-labeled κB3 probe with excess of the ‘cold’ κB1 and κB2 competitors (Fig. 4B). Since histone H4 acetylation in this enhancer region was induced by CD3-activation (Fig. 2F), binding of the induced transcription factors is likely to be the key to regulation. To identify binding of NF-κB to the κB1 and κB2 sites, excess cold competitor encoding an Sp1-binding sequence in the CD40 promoter (22) was added to block Sp1 and Sp3 binding to the labeled probe. We confirmed NF-κB p50 binding to these sites by super-shift EMSA using anti-NF-κB p50. All complexes of transcription factors and the probes were super-shifted with an anti-NF-κB p50, and some of complexes were super-shifted with an anti-NF-κB p65 but unmoving complexes were still detected with this anti-p65 (Fig. 4C). This suggests that all complexes contain p50; in other words, all κB sites were bound by p50 homodimers, p50/p65 heterodimers and/or p50 heterodimers with other transcription factors including other NF-κB members (as shown later, binding of c-Rel and Bcl-3 was detected by a DNA pull-down assay).

Any contribution of Sp1 and Sp3 to this enhancer activity is likely to be minimal, as they are present constitutively. However, it could be that they are bound in non-activated cells but then replaced by NF-κB on activation, as described for Foxo1 and Foxp3 binding to Foxp3 gene (28).

NF-κB regulates gene expression in the Gitr-Ox40 locus

As shown above, enhancer activity is regulated by NF-κB. Since the EMSA result (Fig. 4C) suggests that NF-κB p50 is a main component of the binding factors (p50 homodimer and heterodimer with other transcription factors), we further analyzed p50 binding in T cells by ChIP. p50 binding to κB1+κB2 and κB3 regions was increased in T cells 24 h after CD3 activation (Fig. 5A). This information together with previous evidence that NF-κB p50 and p65 bind to the Ox40 promoter (20), indicates that gene expression in the Gitr/Ox40 locus is predominantly regulated by NF-κB p50. To test this, we analyzed Gitr and Ox40 expression in CD3-activated CD4+ T cells isolated from the spleens of mice lacking the Nf-κb p50 gene (Fig. 5B). Gitr and Ox40 expression was upregulated by CD3-activation on CD4+ T cells from both mice, but the Gitr high (36.8%) and Ox40 high (39.3%) cell populations from wild type mice were less than half (Gitr high; 15.2%, Ox40 high; 18.7%) of values observed from p50 deficient mice. This result suggests that both Gitr and Ox40 expression are regulated by NF-κB p50. This conclusion was not matched by the observation that a significant number of Gitr high and Ox40 high cells could be detected in p50 deficient mice, despite NF-κB p50 preferably binding to these NF-κB sites in the enhancer (Fig. 4C) and in the Ox40 promoter (20). We propose that the lack of NF-κB p50 is compensated by binding of a very similar family member, NF-κB p52 as previously suggested using NF-κB p50, p52, and p50/p52 deficient mice (29, 30). Unfortunately, the p50/p52 double deficient mice would not be suitable to test this hypothesis, as these mice have a major problem in bone development and exhibit a profound immunodeficiency (29, 30). To overcome this problem, we analyzed Gitr and Ox40 expression by using the NF-κB activation inhibitor (NAI). Expression of Gitr and Ox40 RNAs was strongly inhibited by NAI in CD3-activated EL4 cells in a dose-dependent manner (Fig. 5C and Fig. 5D), in contrast to the house keeping gene control (Gapdh) (Fig. 5E). Gitr and Ox40 cell surface expression on CD3-activated T cells was also inhibited by NAI (Fig. 5F). These results indeed suggest that Gitr/Ox40 expression depends on NF-κB.

FIGURE 5.

FIGURE 5

NF-κB regulates Gitr and Ox40 gene expression. (A) p50 binding to κB1+κB2 and κB3 regions in CD3-activated T cells (activated by anti-CD3 for indicated times) were analyzed by ChIP using anti-p50 (p50) and control IgG (IgG). (B) Gitr and Ox40 expression on CD4+ T cells from p50 deficient (p50 KO) and wild type (Wt) mice. Non-stimulated (Non) and CD3-activated (CD3) CD4+ T cells from indicated mice were analyzed by FACS using anti-Gitr and anti-Ox40. The percentages of CD4+ Gitr high or CD4+ Ox40 high population are indicated. (C, D and E) EL4 cells were activated with anti-CD3 and cultured with or without NF-κB activation inhibitor (NAI) concentrations (nM) are indicated. (C) Gitr, (D) Ox40 or (E) Gapdh expression were analyzed by qRT-PCR (expression levels normalized relative to 18S ribosomal RNA levels). (F) Gitr and Ox40 expression in non-activated (gray) and CD3-activated (solid line) T cells with or without NAI (100 nM) analyzed by FACS. Data are representative of more than three (A to F) independent experiments (error bars indicate the s.d. of triplicate samples).

NF-κB p50 regulates enhancer activity in Treg

Upregulation of Gitr and Ox40 expression in Foxp3+ Treg has been previously demonstrated (24). The enhancer we have here identified, might be involved in this process. To assess whether this enhancer functions in iTreg and nTreg, we examined NF-κB p50 binding to this region by ChIP assay in these cells. p50 binding to the enhancer (κB1+κB2 and κB3 regions) was detected in nTreg, but not in naïve CD4+CD25 T cells (Fig. 6A). iTreg were generated using CD4+CD25 T cells from Foxp3-GFP reporter mice by stimulation with TGF-β+anti-CD3+anti-CD28; 37% cells were Foxp3+ iTreg after 48h, and these were isolated (93% purity) using a cell sorting and GFP fluorescence (Fig. 6B). p50 was bound to the enhancer in these Foxp3+ iTreg, but not in CD4+CD25 T cells (Fig. 6B).

FIGURE 6.

FIGURE 6

NF-κB p50 regulates Gitr expression in Treg. (A) p50 binding to the κB1+κB2 and κB3 regions in nTreg and CD4+CD25 T cells were analyzed by ChIP using anti-p50 (p50) and control IgG (IgG). (B) CD4+CD25 T cells from Foxp3-GFP reporter mice were cultured with TGF-β+anti-CD3+anti-CD28 for 48 h, and Foxp3+ iTreg cells were isolated by sorting with GFP (93% were Foxp3+ T cells). p50 binding to the κB1+κB2 and κB3 regions in iTreg and CD4+CD25 T cells was analyzed by ChIP using anti-p50 (p50) and control IgG (IgG). (C) Splenocytes and thymocytes were isolated from p50 deficient (p50 KO) and wild type (Wt) mice. These cells were stained with anti-CD4, anti-Foxp3, and anti-Gitr. Gitr expression in CD4+Foxp3+ population was analyzed. Data are representative of more than three (A to C) independent experiments (error bars indicate the s.d. of triplicate samples).

We also examined Gitr expression in CD4+Foxp3+ Treg isolated from p50-deficient mice. Since Ox40 promoter activity is regulated by NF-κB and NF-κB p50 binding to the promoter is detectable by ChIP assay (20), we investigated only Gitr expression, so as to avoid any confusion. Splenocytes and thymocytes from these mice had a larger proportion of CD4+Foxp3+ T cells with low Gitr expression than did those from control wild-type mice (Fig. 6C). This supports the argument that p50 is involved in upregulating Gitr expression in Treg. We speculate therefore, that those Gitr high CD4+Foxp3+ T cells in p50-deficient mice are generated by compensatory NF-κB p52. Taken together, we conclude that Gitr expression is upregulated by the enhancer in conjunction with p50 molecules in both nTreg and iTreg.

Foxp3 binds both to p50 and to the enhancer DNA

Since the enhancer seems to be the key regulatory region in the locus, it is likely that Gitr and Ox40 expression is further upregulated in Treg by Foxp3-mediated mechanisms operating through the enhancer. We noticed that within the enhancer the κB1-binding sequence is followed by a potential Foxp3-binding sequence, analogous to the NFAT-Foxp3 binding site in the IL-2 promoter (8) (Fig. 7A and Supplemental Fig. 3D). p50 binding to the κB2 site was weak, yet this site also possesses a similar arrangement (Supplemental Fig 3A). We therefore analyzed Foxp3 binding to the κB1+κB2 region using a ‘DNA pull-down’ assay and nuclear extracts from CD4+CD25 T cells stimulated for 72 h with TGF-β+anti-CD3+anti-CD28. Foxp3 was coprecipitated with the biotinylated κB probe but not a control probe of the same length from the Gitr promoter (Fig. 7B). To confirm Foxp3 binding to the potential site (3′-side of the p50-binding site) (Fig. 7A), we performed a competition assay with κB1 and Foxp3 competitors (i.e., non-biotinylated double stranded oligonucleotides shown in Fig. 7A). Stimulation specific NF-κB p50 and Foxp3 binding to the κB probe was detected (Fig. 7C), and both binding to the enhancer probe was completely inhibited by the κB1 competitor (containing the κB1 binding site and the potential Foxp3 binding site, Fig. 7A) (Fig. 7C, κB1), suggesting that p50 and Foxp3 bind to the competitor. Foxp3 binding was also inhibited by a Foxp3 competitor (lacking the κB1 binding site but containing the potential Foxp3-binding site, Fig. 7A) (Fig. 7C, Foxp3); this indicates that Foxp3 binds to the overlapping region containing the potential Foxp3 binding site (Fig. 7A). As Foxp3 binds to both NFAT and the IL-2 promoter (Supplemental Fig. 3D), we examined whether Foxp3 binds directly to enhancer DNA and/or in association with p50. To examine this, p50 binding to the enhancer was inhibited in the presence of a competitor containing only a p50-binding sequence from the CD40 promoter (CD40-NF-κB competitor) (22) (Fig. 7A and Fig. 7D), but Foxp3 binding was minimally affected (Fig. 7D); this suggests that Foxp3 binds to DNA in the enhancer. However, p50 binding to the enhancer was not completely inhibited by a 500-fold excess of the CD40-NF-κB competitor (containing only NF-κB site) (Fig. 7D); but was completely inhibited by the κB1 competitor (containing NF-κB+Foxp3 binding sites) (Fig. 7C). This suggests that a p50/CD40-NF-κB competitor complex binds to Foxp3 on the probe (i.e. a protein-protein interaction) – as shown in Supplemental Fig. 3E. This possibility was supported by a co-immunoprecipitation experiment where FLAG-tagged Foxp3 was co-precipitated with anti-p50 without DNA (Fig. 7E). Foxp3 seems therefore to bind to both p50 and DNA in the enhancer (Fig. 8D).

FIGURE 7.

FIGURE 7

Binding of NF-κB p50 and Foxp3 to κB sites. (A) DNA sequences of the κB1, the Foxp3 and the CD40 NF-κB (from CD40 promoter) (CD40) competitors. NF-κB binding sequences are indicated by bold, and a potential Foxp3 binding sequence is indicated by bold italic. (B) DNA pull-down assays were performed using a biotinylated the enhancer probe containing the κB1+κB2 sites (enhancer) or the same length of the Gitr promoter probe and a nuclear extract prepared from stimulated CD4+CD25 T cells with TGF-β+anti-CD3+anti-CD28 for 72 h. The co-precipitated proteins were analyzed by immunoblotting with anti-p50 and anti-Foxp3. (C) DNA pull down assays were performed using the κB probe and nuclear extracts prepared from non-stimulated (Non) and TGF-β+anti-CD3+anti-CD28 stimulated (72 h) CD4+CD25 T cells (left panel). Competition DNA pull down assay was performed using the same probe and nuclear extract (from stimulated cells) and using non-biotinylated the κB1 or Foxp3 competitor (shown in A) (right panel). Co-precipitated proteins were analyzed by immunoblotting with anti-p50, anti-Foxp3, anti-p65, anti-c-Rel and anti-Bcl-3. (D) DNA pull down assays were performed with a biotinylated κB probe and the non-biotinylated CD40 NF-κB competitor (shown in A). Co-precipitated proteins were analyzed by immunoblotting with anti-p50, anti-Foxp3. (E) p50 was precipitated by anti-p50 or control IgG (without DNA), and co-precipitated FLAG-tagged Foxp3 was detected using an anti-FLAG. Data are representative of more than three (B to E) independent experiments.

Foxp3 upregulates gene expression in conjunction with p50

We confirmed that p50/Foxp3 binds to the enhancer in a manner analogous to NFAT/Foxp3 binding to the IL-2 promoter (but note that Foxp3 represses IL-2 expression). We investigated the functional relevance of this binding using a luciferase reporter assay. Hori et al. (31) have demonstrated that Gitr expression is upregulated by ectopically expressed Foxp3 in CD3-activated CD4+CD25 T cells. We therefore co-expressed Foxp3 in CD3-activated EL4 cells and performed the luciferase assay with the Gitr promoter/enhancer reporter plasmid. Since NF-κB p50 and p65 bind to the enhancer (Fig. 4C) and NF-κB c-Rel regulates Treg development (3236), we additionally co-expressed p50 and/or p65 (Fig. 8A) and p50 and/or c-Rel (Fig. 8B). Enhancer activity was increased by co-expressed p50, p65, or p50+p65 (Fig. 8A) and by co-expressed p50, c-Rel, or p50+c-Rel (Fig. 8B). Importantly, any p50-mediated upregulation was further increased by Foxp3 co-expression. In contrast, p65- (Fig. 8A) and c-Rel-mediated (Fig. 8B) upregulation was reduced by Foxp3, and indeed repression of p65 and c-Rel by Foxp3 was previously described (9, 37). This inhibitory effect of Foxp3 was neutralized by p50 co-expression (p50+p65 and p50+c-Rel expression). Taken together, these findings suggest that p50 and Foxp3 co-operate to upregulate the Gitr promoter by binding to the enhancer. To confirm this, the Gitr promoter/enhancer reporter was co-transfected with a fixed amount of the p50 expression plasmid, but with different amounts of the Foxp3 expression plasmid. Enhancer activity was increased by Foxp3 co-expression in a dose-dependent manner (Fig. 8C). A cooperative effect of p50 and Foxp3 on the enhancer was also observed using the Ox40 promoter/enhancer reporter plasmid (Supplemental Fig. 3G) operating through the enhancer only, or through both the promoter and enhancer.

How might Foxp3 upregulate gene expression using a p50 that possesses no transactivation domain? Usually, NF-κB p50 positively regulates gene expression by associating with other NF-κB and IκB family members that contain transactivation domains (e.g. through a p50/p65 heterodimer, p50/c-Rel heterodimer or p50 homodimer/Bcl3). In support of this, we detected p65, c-Rel and Bcl-3 binding to the κB probe (Fig. 7C). We then asked what additional necessary part Foxp3 might play? We analyzed p50 binding to the κB probe with or without Foxp3. We considered using a nuclear extract from CD3-activated T cells (no Foxp3), but the amount of p50 in this nuclear extract is different from that in Foxp3+ T cells (stimulated with TGF-β). We therefore trapped Foxp3 protein in the same nuclear extract by adding a Foxp3 competitor (Fig. 7C), and performed a DNA pull down assay using the κB probe. p50 binding to the enhancer probe was reduced as a result of inhibition of Foxp3 binding to the probe (Fig. 7C), suggesting that Foxp3 stabilizes p50 binding by itself binding to both p50 and DNA (Fig. 8D), so enabling accumulation of p50/p65 and p50/cRel heterodimer (Fig. 8E) and/or p50–p50 homodimer-Blc-3 (Supplemental Fig. 3F) to the enhancer. To be able to understand the whole picture of the Foxp3-mediated transcriptional upregulation, further investigation is obviously required. However, it is clear that the activation function of the transactivation domains of p65 and c-Rel do not seem to be inhibited by such indirect binding of Foxp3 mediated via p50. This would be consistent with the enhanced luciferase activity seen when all components (Fig. 8A, p50, p65 and Foxp3) (Fig. 8B, p50, c-Rel and Foxp3) were co-expressed.

Discussion

We have identified a strong enhancer within the Gitr/Ox40 locus that is regulated by NF-κB and Foxp3. Gitr gene expression is upregulated by NF-κB through this enhancer in activated Teff, and further upregulated by NF-κB in conjunction with Foxp3 in Treg. It is well established that Foxp3 can bind to other transcription factors and inhibit activities of these factors (as shown in Fig. 8A and 8B, the activity of the p65 and c-Rel subunits of NF-κB was inhibited by co-expression of Foxp3). However, the enhancer activity was upregulated by co-expression of the p50 subunit of NF-κB with Foxp3. Foxp3 seems to stabilize binding of the NF-κB p50 to this enhancer. In order to explain how Foxp3 might stimulate p50-mediated transcription while lacking a transactivation domain (38), we suggest that p50 associates with other family members (e.g., p65 and c-Rel) to exploit their activation domains (38). Indeed, we have also shown that p65 and c-Rel bind to κB sites with p50 in the enhancer (Fig. 4C and Fig. 7C). Foxp3 could bind to the p50 molecule and DNA without altering the p50/p65 and p50/c-Rel complex formation (Fig. 8E), nor inhibiting the transactivation domain of p65 and c-Rel. Although nuclear NF-κB levels are tightly regulated by negative feedback in activated T cells, we detected NF-κB p50, p65 and c-Rel in 72 h stimulated T cells with TGF-β+anti-CD3+anti-CD28. Nuclear translocation of these transcription factors sustained in Treg through TGF-β signaling and/or a Foxp3-mediated pathway. In CD3-activated T cells, nuclear p65 levels peak 2–6 h after activation (39, 40). Although we detected p65 binding to the κB probe using a nuclear extract from 72 h stimulated T cells, p65 levels may have diminished from those found earlier after activation. c-Rel levels seem to remain high even after p65 decreased (40). The Foxp3 promoter activity is regulated by c-Rel (34) and nTreg development is also regulated by c-Rel through CNS3 in the Foxp3 gene (36). Taken together, p50/c-Rel heterodimers may be a key component in upregulating Gitr gene expression. Alternatively, transactivation domains might also be supplied by an IκB family member Bcl-3, that can bind to the p50 homodimer (41, 42) (Supplemental Fig. 3F). Gene expression upregulated by the p50 homodimer/Bcl-3 complex seems to depend on NF-κB sites (the p50 homodimer without Bcl-3 inhibits transcription through some NF-κB sites). Since Bcl-3 does not bind to DNA, it is not clear how Bcl-3 selects a p50 homodimer to be bound. We imagine that the p50 homodimer and Bcl-3 complex may be stabilized in conjunction with other factors that can bind close to the p50 homodimer binding site, in the way Foxp3 appears to do so here. In our case, Bcl-3 and p65 binding to the κB site was not detected and c-Rel binding was reduced unless Foxp3 was also bound to the enhancer (Fig. 7C). This may be because less p50 can bind to the κB site in the absence of Foxp3, or that NF-κB p50/p65, p50/c-Rel and/or p50 homodimer/Bcl-3 formation is stabilized by Foxp3.

It is generally considered that promoters are upregulated by communication between the promoter and an enhancer via loop formation (43). The identified enhancer in this paper is located ~5 and 20 kb downstream of the Gitr and Ox40 promoters, respectively. These distances are within the range found with other well-characterized enhancers and promoters. For example, the IgH (44) and Bcl-2 (45) promoter interacts with the 3′ enhancer over ~100 kb. These findings suggest that Ox40 expression in Treg is also upregulated by Foxp3 through this NF-κB p50-mediated enhancer, but we cannot rule out a role for NF-κB p50 acting through the Ox40 promoter. Even so, the strong enhancer activity driven by the combination of p50 and Foxp3 seems to regulate Treg specific upregulation within Gitr/Ox40 gene locus, by analogy with the Il4, Il5 and Il13 genes that are located over 140 kb within the Th2 cytokine specific gene locus (46).

Recent analyses of DNaseI HS sequencing and Foxp3 ChIP sequencing in Foxp3+ Treg and CD4+Foxp3 T cells (28) have shown that Foxp3 predominantly utilizes functional enhancers that are present in Foxp3 T cells during Treg development. Taken with our own findings, we now propose the following sequence of events during the activation of Gitr and Ox40 in Teff and Treg:

  1. NF-κB p50/p65 and/or p50/c-Rel bind to the enhancer in activated Teff at an early stage of Treg development, leading to chromatin remodeling and Gitr and Ox40 gene expression.

  2. Induced Foxp3 in Treg stabilizes binding of the p50/p65 and/or p50/c-Rel heterodimers and p50-homodimer/Bcl-3 to the enhancer.

  3. These complexes then further upregulate Girt and Ox40 expression in Treg.

We suggest that other important Treg genes such as Ctla4, Il35, Cd25 and MS4A members, may be regulated by Foxp3 by similar mechanisms. We therefore offer this scheme as a solution to how Foxp3 may upregulate certain genes enforcing regulation, while simultaneously being able to damp so many others promoting inflammation.

Supplementary Material

1

Acknowledgments

We thank Drs J. Kaye, W. Sabbagh, C. Norbury and P. Cook for review of the manuscript.

This work was supported by NHI grant R01 A1078987 (M. Tone), Cedars-Sinai Medical Center and European Research Council Advanced Investigator grant (H.W.).

Abbreviations used in this article

Treg

regulatory T cell

iTreg

induced regulatory T cell

nTreg

natural regulatory T cell

TCR

T cell receptor

Bcl-3

B-Cell Lymphoma 3

Foxp3

forkhead box P3

Wt

wild type

References

  • 1.Watts TH. TNF/TNFR family members in costimulation of T cell responses. Annu Rev Immunol. 2005;23:23–68. doi: 10.1146/annurev.immunol.23.021704.115839. [DOI] [PubMed] [Google Scholar]
  • 2.McHugh RS, Whitters MJ, Piccirillo CA, Young DA, Shevach EM, Collins M, Byrne MC. CD4(+)CD25(+) immunoregulatory T cells: gene expression analysis reveals a functional role for the glucocorticoid-induced TNF receptor. Immunity. 2002;16:311–323. doi: 10.1016/s1074-7613(02)00280-7. [DOI] [PubMed] [Google Scholar]
  • 3.Shimizu J, Yamazaki S, Takahashi T, Ishida Y, Sakaguchi S. Stimulation of CD25(+)CD4(+) regulatory T cells through GITR breaks immunological self-tolerance. Nat Immunol. 2002;3:135–142. doi: 10.1038/ni759. [DOI] [PubMed] [Google Scholar]
  • 4.Takeda I, Ine S, Killeen N, Ndhlovu LC, Murata K, Satomi S, Sugamura K, Ishii N. Distinct roles for the OX40-OX40 ligand interaction in regulatory and nonregulatory T cells. J Immunol. 2004;172:3580–3589. doi: 10.4049/jimmunol.172.6.3580. [DOI] [PubMed] [Google Scholar]
  • 5.Josefowicz SZ, Lu LF, Rudensky AY. Regulatory T cells: mechanisms of differentiation and function. Annu Rev Immunol. 2012;30:531–564. doi: 10.1146/annurev.immunol.25.022106.141623. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Sakaguchi S. Naturally arising CD4+ regulatory t cells for immunologic self-tolerance and negative control of immune responses. Annu Rev Immunol. 2004;22:531–562. doi: 10.1146/annurev.immunol.21.120601.141122. [DOI] [PubMed] [Google Scholar]
  • 7.Shevach EM. Regulatory T cells in autoimmmunity*. Annu Rev Immunol. 2000;18:423–449. doi: 10.1146/annurev.immunol.18.1.423. [DOI] [PubMed] [Google Scholar]
  • 8.Wu Y, Borde M, Heissmeyer V, Feuerer M, Lapan AD, Stroud JC, Bates DL, Guo L, Han A, Ziegler SF, Mathis D, Benoist C, Chen L, Rao A. FOXP3 controls regulatory T cell function through cooperation with NFAT. Cell. 2006;126:375–387. doi: 10.1016/j.cell.2006.05.042. [DOI] [PubMed] [Google Scholar]
  • 9.Bettelli E, Dastrange M, Oukka M. Foxp3 interacts with nuclear factor of activated T cells and NF-kappa B to repress cytokine gene expression and effector functions of T helper cells. Proc Natl Acad Sci U S A. 2005;102:5138–5143. doi: 10.1073/pnas.0501675102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Ono M, Yaguchi H, Ohkura N, Kitabayashi I, Nagamura Y, Nomura T, Miyachi Y, Tsukada T, Sakaguchi S. Foxp3 controls regulatory T-cell function by interacting with AML1/Runx1. Nature. 2007;446:685–689. doi: 10.1038/nature05673. [DOI] [PubMed] [Google Scholar]
  • 11.Collison LW, Workman CJ, Kuo TT, Boyd K, Wang Y, Vignali KM, Cross R, Sehy D, Blumberg RS, Vignali DA. The inhibitory cytokine IL-35 contributes to regulatory T-cell function. Nature. 2007;450:566–569. doi: 10.1038/nature06306. [DOI] [PubMed] [Google Scholar]
  • 12.Vignali DA, Collison LW, Workman CJ. How regulatory T cells work. Nat Rev Immunol. 2008;8:523–532. doi: 10.1038/nri2343. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Valzasina B, Guiducci C, Dislich H, Killeen N, Weinberg AD, Colombo MP. Triggering of OX40 (CD134) on CD4(+)CD25+ T cells blocks their inhibitory activity: a novel regulatory role for OX40 and its comparison with GITR. Blood. 2005;105:2845–2851. doi: 10.1182/blood-2004-07-2959. [DOI] [PubMed] [Google Scholar]
  • 14.So T, Croft M. Cutting edge: OX40 inhibits TGF-beta- and antigen-driven conversion of naive CD4 T cells into CD25+Foxp3+ T cells. J Immunol. 2007;179:1427–1430. doi: 10.4049/jimmunol.179.3.1427. [DOI] [PubMed] [Google Scholar]
  • 15.Vu MD, Xiao X, Gao W, Degauque N, Chen M, Kroemer A, Killeen N, Ishii N, Li XC. OX40 costimulation turns off Foxp3+ Tregs. Blood. 2007;110:2501–2510. doi: 10.1182/blood-2007-01-070748. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Howie D, Nolan KF, Daley S, Butterfield E, Adams E, Garcia-Rueda H, Thompson C, Saunders NJ, Cobbold SP, Tone Y, Tone M, Waldmann H. MS4A4B is a GITR-associated membrane adapter, expressed by regulatory T cells, which modulates T cell activation. J Immunol. 2009;183:4197–4204. doi: 10.4049/jimmunol.0901070. [DOI] [PubMed] [Google Scholar]
  • 17.Rogers PR, Song J, Gramaglia I, Killeen N, Croft M. OX40 promotes Bcl-xL and Bcl-2 expression and is essential for long-term survival of CD4 T cells. Immunity. 2001;15:445–455. doi: 10.1016/s1074-7613(01)00191-1. [DOI] [PubMed] [Google Scholar]
  • 18.Song J, Salek-Ardakani S, Rogers PR, Cheng M, Van Parijs L, Croft M. The costimulation-regulated duration of PKB activation controls T cell longevity. Nat Immunol. 2004;5:150–158. doi: 10.1038/ni1030. [DOI] [PubMed] [Google Scholar]
  • 19.Tone M, Tone Y, Adams E, Yates SF, Frewin MR, Cobbold SP, Waldmann H. Mouse glucocorticoid-induced tumor necrosis factor receptor ligand is costimulatory for T cells. Proc Natl Acad Sci U S A. 2003;100:15059–15064. doi: 10.1073/pnas.2334901100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Tone Y, Kojima Y, Furuuchi K, Brady M, Yashiro-Ohtani Y, Tykocinski ML, Tone M. OX40 gene expression is up-regulated by chromatin remodeling in its promoter region containing Sp1/Sp3, YY1, and NF-kappa B binding sites. J Immunol. 2007;179:1760–1767. doi: 10.4049/jimmunol.179.3.1760. [DOI] [PubMed] [Google Scholar]
  • 21.Tone M, Tone Y, Fairchild PJ, Wykes M, Waldmann H. Regulation of CD40 function by its isoforms generated through alternative splicing. Proc Natl Acad Sci U S A. 2001;98:1751–1756. doi: 10.1073/pnas.98.4.1751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Tone M, Tone Y, Babik JM, Lin CY, Waldmann H. The role of Sp1 and NF-kappa B in regulating CD40 gene expression. J Biol Chem. 2002;277:8890–8897. doi: 10.1074/jbc.M109889200. [DOI] [PubMed] [Google Scholar]
  • 23.Chen W, Jin W, Hardegen N, Lei KJ, Li L, Marinos N, McGrady G, Wahl SM. Conversion of peripheral CD4+CD25− naive T cells to CD4+CD25+ regulatory T cells by TGF-beta induction of transcription factor Foxp3. J Exp Med. 2003;198:1875–1886. doi: 10.1084/jem.20030152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Fantini MC, Becker C, Monteleone G, Pallone F, Galle PR, Neurath MF. Cutting edge: TGF-beta induces a regulatory phenotype in CD4+CD25− T cells through Foxp3 induction and down-regulation of Smad7. J Immunol. 2004;172:5149–5153. doi: 10.4049/jimmunol.172.9.5149. [DOI] [PubMed] [Google Scholar]
  • 25.Rudra D, deRoos P, Chaudhry A, Niec RE, Arvey A, Samstein RM, Leslie C, Shaffer SA, Goodlett DR, Rudensky AY. Transcription factor Foxp3 and its protein partners form a complex regulatory network. Nat Immunol. 2012;13:1010–1019. doi: 10.1038/ni.2402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Tone Y, Furuuchi K, Kojima Y, Tykocinski ML, Greene MI, Tone M. Smad3 and NFAT cooperate to induce Foxp3 expression through its enhancer. Nat Immunol. 2008;9:194–202. doi: 10.1038/ni1549. [DOI] [PubMed] [Google Scholar]
  • 27.Gronostajski RM. Roles of the NFI/CTF gene family in transcription and development. Gene. 2000;249:31–45. doi: 10.1016/s0378-1119(00)00140-2. [DOI] [PubMed] [Google Scholar]
  • 28.Samstein RM, Arvey A, Josefowicz SZ, Peng X, Reynolds A, Sandstrom R, Neph S, Sabo P, Kim JM, Liao W, Li MO, Leslie C, Stamatoyannopoulos JA, Rudensky AY. Foxp3 exploits a pre-existent enhancer landscape for regulatory T cell lineage specification. Cell. 2012;151:153–166. doi: 10.1016/j.cell.2012.06.053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Franzoso G, Carlson L, Xing L, Poljak L, Shores EW, Brown KD, Leonardi A, Tran T, Boyce BF, Siebenlist U. Requirement for NF-kappaB in osteoclast and B-cell development. Genes Dev. 1997;11:3482–3496. doi: 10.1101/gad.11.24.3482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Iotsova V, Caamano J, Loy J, Yang Y, Lewin A, Bravo R. Osteopetrosis in mice lacking NF-kappaB1 and NF-kappaB2. Nat Med. 1997;3:1285–1289. doi: 10.1038/nm1197-1285. [DOI] [PubMed] [Google Scholar]
  • 31.Hori S, Nomura T, Sakaguchi S. Control of regulatory T cell development by the transcription factor Foxp3. Science. 2003;299:1057–1061. doi: 10.1126/science.1079490. [DOI] [PubMed] [Google Scholar]
  • 32.Deenick EK, Elford AR, Pellegrini M, Hall H, Mak TW, Ohashi PS. c-Rel but not NF-kappaB1 is important for T regulatory cell development. Eur J Immunol. 2010;40:677–681. doi: 10.1002/eji.201040298. [DOI] [PubMed] [Google Scholar]
  • 33.Long M, Park SG, Strickland I, Hayden MS, Ghosh S. Nuclear factor-kappaB modulates regulatory T cell development by directly regulating expression of Foxp3 transcription factor. Immunity. 2009;31:921–931. doi: 10.1016/j.immuni.2009.09.022. [DOI] [PubMed] [Google Scholar]
  • 34.Ruan Q, Kameswaran V, Tone Y, Li L, Liou HC, Greene MI, Tone M, Chen YH. Development of Foxp3(+) regulatory t cells is driven by the c-Rel enhanceosome. Immunity. 2009;31:932–940. doi: 10.1016/j.immuni.2009.10.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Vang KB, Yang J, Pagan AJ, Li LX, Wang J, Green JM, Beg AA, Farrar MA. Cutting edge: CD28 and c-Rel-dependent pathways initiate regulatory T cell development. J Immunol. 2010;184:4074–4077. doi: 10.4049/jimmunol.0903933. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Zheng Y, Josefowicz S, Chaudhry A, Peng XP, Forbush K, Rudensky AY. Role of conserved non-coding DNA elements in the Foxp3 gene in regulatory T-cell fate. Nature. 2010;463:808–812. doi: 10.1038/nature08750. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Loizou L, Andersen KG, Betz AG. Foxp3 interacts with c-Rel to mediate NF-kappaB repression. PLoS One. 2011;6:e18670. doi: 10.1371/journal.pone.0018670. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Li Q, I, Verma M. NF-kappaB regulation in the immune system. Nat Rev Immunol. 2002;2:725–734. doi: 10.1038/nri910. [DOI] [PubMed] [Google Scholar]
  • 39.Kingeter LM, Paul S, Maynard SK, Cartwright NG, Schaefer BC. Cutting edge: TCR ligation triggers digital activation of NF-kappaB. J Immunol. 2010;185:4520–4524. doi: 10.4049/jimmunol.1001051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Mittal A, Papa S, Franzoso G, Sen R. NF-kappaB-dependent regulation of the timing of activation-induced cell death of T lymphocytes. J Immunol. 2006;176:2183–2189. doi: 10.4049/jimmunol.176.4.2183. [DOI] [PubMed] [Google Scholar]
  • 41.Franzoso G, Bours V, Azarenko V, Park S, Tomita-Yamaguchi M, Kanno T, Brown K, Siebenlist U. The oncoprotein Bcl-3 can facilitate NF-kappa B-mediated transactivation by removing inhibiting p50 homodimers from select kappa B sites. EMBO J. 1993;12:3893–3901. doi: 10.1002/j.1460-2075.1993.tb06067.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Fujita T, Nolan GP, Liou HC, Scott ML, Baltimore D. The candidate proto-oncogene bcl-3 encodes a transcriptional coactivator that activates through NF-kappa B p50 homodimers. Genes Dev. 1993;7:1354–1363. doi: 10.1101/gad.7.7b.1354. [DOI] [PubMed] [Google Scholar]
  • 43.Bulger M, Groudine M. Looping versus linking: toward a model for long-distance gene activation. Genes Dev. 1999;13:2465–2477. doi: 10.1101/gad.13.19.2465. [DOI] [PubMed] [Google Scholar]
  • 44.Ren X, Siegel R, Kim U, Roeder RG. Direct interactions of OCA-B and TFII-I regulate immunoglobulin heavy-chain gene transcription by facilitating enhancer-promoter communication. Mol Cell. 2011;42:342–355. doi: 10.1016/j.molcel.2011.04.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Gong F, Sun L, Wang Z, Shi J, Li W, Wang S, Han X, Sun Y. The BCL2 gene is regulated by a special AT-rich sequence binding protein 1-mediated long range chromosomal interaction between the promoter and the distal element located within the 3′-UTR. Nucleic Acids Res. 2011;39:4640–4652. doi: 10.1093/nar/gkr023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Spilianakis CG, Flavell RA. Long-range intrachromosomal interactions in the T helper type 2 cytokine locus. Nat Immunol. 2004;5:1017–1027. doi: 10.1038/ni1115. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

RESOURCES