Abstract
Complex I NADH-oxidoreductase-ubiquinone transports reducing equivalents from the reduced form of NADH to ubiquinone (coenzyme Q-CoQ). The purpose of this study was to analyze mutations in MT-ND1, MT-ND2, MT-ND3 and MT-ND6 genes and their effect on the biochemical properties, structure and functioning of proteins in patients with breast tumours. In research materials, in 50 patients, 28 total polymorphisms and five mutations were detected. Most detected polymorphisms (50 %, 14/28) were observed in MT-ND2 gene. Most of them were silent mutations. Five polymorphisms (m.G3916A, m.C4888T, m.A4918G, m.C5363T, m.C10283T) do not exist in the database. A total of five mutations in 13 patients (13/50) were detected, including two not described in the literature: m.C4987G and m.T10173C. It cannot be excluded that, through the mutations and polymorphism impact on the protein structure, they may cause mitochondrial dysfunction and contribute to the appearance of other changes in mtDNA. The results of our study indicate the presence of homological changes in the sequence of mtDNA in both breast cancer and in some mitochondrial diseases. Mutations in the examined genes in breast cancer may affect the cell and cause its dysfunction, as is the case in mitochondrial diseases.
Keywords: Cancer, Carcinogenesis, Mitochondrial DNA mutation
Introduction
The participation of mitochondria in tumorigenesis was first suggested by Warburg in 1932. His explanation was prevalence of anaerobic glycolysis in cancer cells. Mitochondrial DNA is composed of base pairs 16569 (Andrews et al. 1999). Almost every nucleotide encodes genetic information. The mtDNA encodes genes for two types of rRNA, 22 types of tRNA and 13 proteins. Two chains of mtDNA, both light and heavy, are coding chains. Most of the genes are located in the heavy chain. The encoded light chain genes are merely the eight types of tRNA genes and one of the complex I of the respiratory chain (MT-ND6). The heavy chain of other genes encodes complex I (MT-ND1, MT-ND2, MT-ND3, MT-ND4, MT-ND4L and MT-ND5) and the rest of the 13 proteins are involved in the mitochondrial oxidative phosphorylation (OXPHOS). In mtDNA the first mutation associated with cancer was described in renal cell carcinoma (RCC). It concerned the MT-ND1 gene for oxidative phosphorylation (Welter et al. 1989). The importance of changes taking place in the mitochondria in the process of carcinogenesis suggests linking mev −1 mutations in a gene SDHC in Caenorhabditis elegans are connected with an increased production of reactive oxygen species (ROS), which are very important factors in the inactivation of proteins associated with apoptosis and neoplasia, such as p 16INK4a and p53 (Grzybowska - Szatkowska and Slaska 2012a). The purpose of this study was to analyze mutations in MT-ND1, MT-ND2, MT-ND3 and MT-ND6 genes and their effect on the biochemical properties, structure and functioning of proteins in patients with breast tumours.
Material and methods
The tested material was DNA isolated from specimens of ductal carcinoma (carcinoma ductale) Tp1-2 Np0-1Mp0 and blood sampled from 50 patients who had also undergone surgery for breast cancer. The patients had received no chemo- or hormonal therapy. They were all perimenopausal. The blood was taken from each patient and placed in sterile vacuum test tubes containing dipotassium ethylenediaminetetraacetic acid anti-coagulant. The DNA was isolated with the use of an automated nucleic acid extraction system-QIACube (Qiagen, Hilden, Germany). It was extracted from whole peripheral blood with the QIAamp DNA Blood Mini Kit (Qiagen), and the QIAamp DNA Blood Kit (Qiagen) was used for DNA extraction from the tissue. Sequences of MT-ND1, MT-ND2, MT-ND3, and MT-ND6 genes were analysed (Table 1). Based on the Homo sapiens mitochondrion, the complete genome (AC_000021) sequence, primers for the fragments of test genes (Table 1) were designed with the use of the Primer3 programme (http://frodo.wi.mit.edu/). The amplification products were visualised in 2 % agarose gel. Both strands of the particular genes were sequenced. Amplicons were sequenced using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystem, Foster City, CA, USA) in the GeneAmp PCR system 9700 (Applied Biosystem). The samples were subsequently purified on CentriSep columns according to the manufacturer’s protocol or precipitated with ethanol and sodium acetate according to the protocol of the BigDye Kit manufacturer. The extension products were separated on the ABI 377 automated sequencer (Applied Biosystem). After establishing the consensus sequence for each analysed sequence, the sequences of the genes were compared with the Cambridge reference sequence of the human mitochondrial DNA (AC_000021). The single nucleotide polymorphisms established for particular gene fragments were used to identify haplotypes. Polymorphisms were considered to be changes that occur in both blood/normal breast cell and tumour cells in the same patient. Mutation is a change characteristic only for cancer cells and not occurring in a patient’s blood/normal breast cell.
Table 1.
Primer sequences used in PCR amplification and sequencing
| Gene | Gene name | Gene position in mtDNA (bp) AC_000021 | Primer position (bp) | Primer sequence 5′-3′ |
|---|---|---|---|---|
| MT-ND1 | Mitochondrially encoded NADH dehydrogenase 1 | 3307..4262 | 3170..3190 | CCCGTAAATGATATCATCTCA |
| 3569..3488 | AGGGGCTCTTTGGTGAAGAG | |||
| 3868.. 3889 | TCCACACTAGCAGAGACCAAC | |||
| 3520..3539 | ATCACCGCCCCGACCTTAG | |||
| 4517..4539 | GCTTAGCGCTGTGATGAGTGTG | |||
| MT-ND2 | Mitochondrially encoded NADH dehydrogenase 2 | 4470..5511 | 5049.. 5074 | CTACCGTACAACCCTAACATAACCA |
| 5420..5439 | GGGTGGGTTTTGTATGTTCA | |||
| 4885..4911 | GGGAGAGATTTGGTATATGATTGAGA | |||
| 5531..5576 | AATTAAGTATTGCAACTTACTGAGG | |||
| 4394..4416 | CATCCTAAAGTAAGGTCAGCTA | |||
| MT-ND3 | Mitochondrially encoded NADH dehydrogenase 3 | 10059..10404 | 9917..9935 | CGCCGCCTGATACTGGCAT |
| 10511..10530 | CTAGTATTCCTAGAAGTGAG | |||
| MT-ND6 | Mitochondrially encoded NADH dehydrogenase 6 | complement (14149..14673) | 14051..14073 | CCACCTCCATCATCACCTCAAC |
| 14716..14743 | GTTCTTGTAGTTGAAATACAACGATGG |
The impact on the physical and biochemical peptide properties. The probability of deleterious mutations, i.e. the functional effect of the non-synonymous (amino acid-changing) protein coding SNP, was determined using the Panther Classification System (http://www.pantherdb.org/), which estimates the value of substitution position-specific evolutionary conservation (subPSEC) and the probability of a deleterious effect on protein function (Pdeleterious, Probability of Functional Impairment) on the basis of the alignment of evolutionarily determined proteins. PANTHER subPSEC scores are continuous values from 0 (neutral) to about −10 (most likely to be deleterious); -3 is the previously identified cutoff point for functional significance. A cutoff of −3 corresponds to a 50 % probability that a score is deleterious. From this, the probability that a given variant will cause a deleterious effect on protein function is estimated by Pdeleterious, such that a subPSEC score of −3 corresponds to a Pdeleterious of 0.5. The determination of helicity per residue for the peptides was performed using the AGADIR program (http://agadir.crg.es/). The GRAVY and the theoretical pI were obtained using the software program ProtParam tool (http://web.expasy.org/). The incidence of amino acid in each position of a protein sequence was assessed using position specific scoring matrix (PSSM). PSSM scores are generally shown as positive or negative integers. Positive scores indicate that a given amino acid substitution occurs more frequently in an alignment than expected by chance, while negative scores indicate that a substitution occurs less frequently than expected. Large positive scores often indicate critical functional residues, which may signify active site residues or residues required for other intermolecular interactions (http://www.ncbi.nlm.nih.gov/Class/Structure/pssm/pssm_viewer.cgi).
The Institutional Review Board at the Medical University of Lublin specifically approved this study. Approval Number KE-254/141/2009.
Results
The results are shown in Tables 2, 3, 4 and 5. In the study, 50 patients had a total number of 28 polymorphisms and five mutations (Table 2). Most polymorphisms (50 %, 14/28) occurred in the MT-ND2 gene sequence. Most of them were silent mutations. Five polymorphisms (m.G3916A, m.C4888T, m.A4918G, m.C5363T, m.C10283T) did not exist in the database. Polymorphisms m.G3916A, m.C4888T, m.A4918G, m.C10283T are of the missense type and in the case of two of them Pdt was above 0.5 which indicates that those changes are not indifferent to the function of the protein (Table 4). A total of five mutations were detected in 13 patients (13/50), including two not described in the literature (m.C4987G, m.T10173C). Only a change of p.C39R in MT-ND3 seems to have an impact on the functioning of the protein, Pdt subPSEC = 0.86366 -4.84604 (Table 4). The amino acid of cysteine containing sulfhydryl group, which is also very uncommon in proteins, was replaced here with arginine containing the guanidine group. This mutation converts a highly conserved cysteine (PSSM score = 11) to argnine (PSSM score = −5) (Table 5).
Table 2.
Differences in MT-ND1, MT-ND2, MT-ND3 and MT-ND6 genes sequences between reference Cambridge sequence and examined material
| Number of patients (patient’s no) | Frequency (mtDB) | Mitochondrial haplogroup: according to van Oven and Kayser (2009) | Cambridge reference sequences | Sequences in breast cancer cell | Sequences in patient’s blood | Sequences in normal breast cell | Aminoacid change | ||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| A | G | C | T | del | |||||||
| MT-ND1 polymorphism | |||||||||||
| 1(1) | 20 | 2684 | – | – | – |
U6a1h,U1a1,U6a5,H9a,I2e, M27b,M38b,C5a,G2b2c |
m.G3591 | m.G3591A | m.G3591A | m.G3591A | synonim |
| 1(213) | – | – | 2698 | 6 | – | L0a2c,P10,U8a1 | m.C3738 | m.C3738T | m.C3738T | m.C3738T | synonim |
| 1(5) | 11 | 2692 | – | – | – |
K1b1a2,U9,HV4c,H2a1c, T2c1c1,T2g1, T2g2,N-Y1, D4a3b2, L0a2a1b |
m.G3834 | m.G3834A | m.G3834A | m.G3834A | synonim |
| 3(19,20,21) | – | – | – | – | – | – | m.G3916 | m.G3916Aa | m.G3916Aa | m.G3916Aa | p.E204K |
| 1(20) | 2680 | 24 | H3g1,H4,T2b4c,L3k | m.C3992 | m.C3992T | m.C3992T | m.C3992T | p.T229M | |||
| 4(15,32,82,213) | – | – | 244 | 2460 | – | L1b1a3b,L4b1,M2a1b,M2c, | m.T4216 | m.T4216C | m.T4216C | m.T4216C | p.Y304H |
| M14,D5c,X2b7,R2′JT,P4a, | |||||||||||
| K1a2c,H1bm,H10a | |||||||||||
| 1(217) | – | – | 2703 | 1 | – | L0,L3c,V15,H1n6,H73 | m.C4221 | m.C4221A | m.C4221A | m.C4221A | synonim |
| MT-ND1 mutation | |||||||||||
| 1(31) | 2677 | 10 | – | 17 | – | L1c1,M21a,B2f,H1b1 | m.A3796 | m.A3796G | m.A3796A | m.A3796A | p.T164A |
| MT-ND2 polymorphism | |||||||||||
| 1(3,212) | 2669 | 2 | 33 | – | N1ab1 | m.A4529 | m.A4529T | m.A4529T | m.A4529T | synonim | |
| 3(4,26) | 77 | 2627 | – | – | – | M3a,V | m.G4580 | m.G4580A | m.G4580A | m.G4580A | synonym |
| 1(4) | – | – | 22 | 2682 | – | M22 V1a,H1a1,H13a2b1 | m.T4639 | m.T4639C | m.T4639C | m.T4639C | p.I57T |
| 47(1–19,22-40, 202,203,212,213,217,82,83,84,81 | 2695 | 96 | – | – | – | H6a1,H13a1b | m.A4727 | m.A4727G | m.A4727G | m.A4727G | synonym |
| 27(1–2,4,6-11,15-16,18,20-23,27-35,203, 212, 213, 217,219) | 30 | 2674 | – | – | – |
R2,J2b1d,,F2e, B4a1a1a3, H2a,H2a1d, |
m.A4769 | m.A4769G | m.A4769G | m.AG4769G | synonim |
| 1(32) | – | – | 12 | 2692 | – |
L2a5,L3e2a,T2c1c,,B4a2a, U5a1d2a1,K1a1b1f |
m.T4823 | m.T4823 C | m.T4823 C | m.T4823C | synonym |
| 1(6) | 1 | 2703 | – | – | – | Z7 | m.G4841 | m.G4841A | m.G4841A | m.G4841A | synonym |
| 1(26) | – | – | – | – | – | – | m.C4888 | m.C4888Ta | m.C4888Ta | m.C4888Ta | p.S140L |
| 4(13,15,87,32) | – | – | – | – | – | – | m.A4918 | m.A4918Ga | m.A4918Ga | m.A4918Ga | p.N150S |
| 1(1) | 15 | 2689 | – | – | – | M63,D2a2,J1b6a,T1a,U1a | m.G4991 | m.G4991A | m.G4991A | m.G4991A | synonim |
| 3(27,32,213,) | 2569 | 135 | – | – | – | L2a4,L0a2,L5a,L2a1,L3d, M30b,M5b1,M5c2,M75, N9b,Y2,T2b,F1b1,HV2a,H3b1,U1c,U2d2,U5b3g,U6d1a | m.G5147 | m.G5147A | m.G5147A | m.G5147A | synonim |
| 1(35) | 2698 | 6 | – | – | – | U8a1 | m.A5240 | m.A5240G | m.A5240G | m.A5240G | synonim |
| 1(4) | – | – | – | – | – | m.C5363 | m.C5363Ta | m.C5363Ta | m.C5363Ta | synonim | |
| 1(23) | 176 | 2528 | – | – | – | K1a12, U2d2, H1e,H2a2b4, H6a1a1, H41a,J1b1,J2b2, B2k, B4e,P4,P4b1,W, A2af, A2a1b2,O1a,M7b′d, M52′58,M7f,C4a1e,G4, Q4,Q1′2, Q2b,Q3b,,L3e1c, L3h2,L0a,L0d3,L1c1d, L4,L4b2 | m.G5460 | m.G5460A | m.G5460A | m.G5460A | p.A331T |
| MT-ND2 mutation | |||||||||||
| 1(30) | – | – | – | – | – | m.G4580 | m.G4580Aa | m.G4580G | m.G4580G | synonim | |
| 10(6,7,20,26,27, 34,82,203,217, 219) | – | – | – | – | – | m.C4987 | m.C4987Ga | m.CC4987 | m.CC4987 | p.T173S | |
| MT-ND3 polymorphism | |||||||||||
| 1(203) |
– 1461 |
– 1242 |
82 – |
2621 – |
– – |
N1,B4a1, R0a2k1,R12′21,P4,J,J1c8, R11, K1, B4c1,B5 N, N1a1, N8, Y,S3, L3e1a, L1c1a1 |
m.T10238 m.A10398 |
m.T10238C m.A10398G |
m.T10238C m.A10398G |
m.T10238C m.A10398G |
synonim p.T114A |
| 1(32) | m.C10281 | m.C10281T | m.C10281T | m.C10281T | p.L75V | ||||||
| 1(17) | 2699 | 5 | – | – | – | Q2b,F1a1c1, HV11a,H59a, U5b1e | m.A10283 | m.A10283Ga | m.A10283Ga | m.A10283Ga | synonim |
| 2(23,212) | 1461 | 1242 | – | – | – | R0a2k1,R12′21,P4,J,J1c8, R11, K1, B4c1,B5 N, N1a1, N8, Y,S3, L3e1a, L1c1a1 | m.A10398 | m.A10398G | m.A10398G | m.A10398G | p.T114A |
| MT-ND3 mutation | |||||||||||
| 1(213) | – | – | – | – | – | m.T10173 | m.T10173Ca | m.T10173 | m.T10173 | p.C39R | |
| MT-ND6 polymorphism | |||||||||||
| 1(35) |
– 2700 |
– – |
2698 – |
6 4 |
– – |
B5a2a,,H44a M7a1a4,R2c,H6c1 |
m.C14149 m.A14185 |
m.C14149Aa m.A4185C |
m.C14149A m.A14185C |
m.C14149A m.A14185C |
synonim synonim |
| 1(27) |
2700 2613 |
– 91 |
– – |
4 – |
– – |
M7a1a4,R2c,H6c1 I5,T2,T5,M72, |
m.A14185 m.A14233 |
m.A14185C m.A14233G |
m.A14185C m.A14233G |
m.A14185C m.A14233G |
synonim synonim |
| 2(26,32,213) | 2613 | 91 | – | – | – | I5,T2,T5,M72 | m.A14233 | m.A14233G | m.A14233G | m.A14233G | synonim |
| 1(1) | 58 | 2646 | – | – | – | L012,M7a1,D1b,N3Ab,A2c, H18,U1a′c,U6a3a1 | m.G14364 | m.G14364A | m.G14364A | m.G14364A | synonim |
| 1(2) | 2700 | 4 | – | – | – | M3c1b,M18b,N22a,X1,B4b1c, HV1a2a,H11a2, L3c, L3h1a2a | m.A14587 | m.A14587G | m.A14587G | m.A14587G | synonim |
| MT-ND6 mutation | |||||||||||
| 1(35) | – | – | – | – | – | – | m.T14166 | m.T14166C | m.T14166 | m.T14166 | p.I170V |
aPositions in which mutations or polymorphisms were described in literature for the first time
Table 3.
Comparison of protein properties in non-synonymous protein-coding SNP in females with breast cancer
| Amino acid change | Theoretical pI (Isoelectric point) | Aliphatic index | Instability index | Grand average of hydrophobicity (GRAVY) | Percentage helix (H) (start and end of helix) |
|---|---|---|---|---|---|
| MT-ND1 | |||||
| p.T164A | 6.11 | 123.40 | 41.94 | 0.690 | H4 = 0.49 (146–166) |
| p.E204K | 7.85 | 123.08 | 41.31 | 0.681 | Mitochondrial matrix |
| p.T229M | 6.11 | 123.08 | 44.06 | 0.690 | Mitochondrial matrix |
| p.Y304K | 6.29 | 123.08 | 42.69 | 0.676 | H8 = 3.71 (294–314) |
| Normal | 6.11 | 123.08 | 41.94 | 0.682 | H4 = 0.48 |
| H8 = 6.59 | |||||
| MT-ND2 | |||||
| p.I57T | 9.84 | 118.10 | 34.59 | 0.621 | H2 = 2.91 |
| p.S140L | 9.84 | 120.06 | 34.10 | 0.651 | H4 = 0.97 (123–143) |
| p.N150S | 9.84 | 119.22 | 34.35 | 0.644 | H5 = 3.74 (149–169) |
| p.T173S | 9.84 | 119.22 | 36.38 | 0.636 | Mitochondrial matrix |
| p.A331T | 9.84 | 118.93 | 34.35 | 0.629 | H10 = 0.37 (326–345) |
| Normal | 9.84 | 119.22 | 34.35 | 0.636 | H2 = 12.89 |
| H4 = 0.95 | |||||
| H5 = 3.92 | |||||
| H10 = 0.30 | |||||
| MT-ND3 | |||||
| p.C39R | 4.56 | 46.06 | 140.00 | 0.931 | Mitochondrial matrix |
| p.L75V | 4.33 | 52.30 | 139.13 | 0.996 | H2 = 4.19 (55–75) |
| p.T114A | 4.33 | 48.95 | 140.87 | 1.014 | Mitochondrial matrix |
| Normal | 4.33 | 50.62 | 140.00 | 0.992 | H2 = 4.20 |
| MT-ND6 | |||||
| p.I170V | 4.18 | 28.38 | 125.17 | 1.069 | H6 = 0.23 (151–171) |
| Normal | 4.18 | 29.48 | 125.75 | 1.071 | N6 = 0.23 |
Table 4.
Probability of a functional effect on the non-synonymous protein-coding SNP
| subPSEC | Pdeleterious | Substitution | MSA position | Pwt | Psubstituted | NIC |
|---|---|---|---|---|---|---|
| MT-ND1 | ||||||
| −1.55746 | 0.19115 | p.T164A | 136 | 0.11421 | 0.06006 | 2.788 |
| −2.97215 | 0.49304 | p.E204K | 176 | 0.46202 | 0.04771 | 2.729 |
| −1.76426 | 0.22518 | p.T229M | 201 | 0.0994 | 0.04119 | 2.768 |
| −0.92687 | 0.11174 | p.Y304H | 276 | 0.10488 | 0.06968 | 1.777 |
| MT-ND2 | ||||||
| −2.29998 | 0.33181 | p.I57T | 52 | 0.26164 | 0.1134 | 5.16 |
| −3.70833 | 0.67003 | p.S140L | 129 | 0.11788 | 0.02633 | 12.218 |
| −3.06754 | 0.51688 | p.N150S | 140 | 0.11018 | 0.04529 | 11.003 |
| −2.82675 | 0.4568 | p.T173S | 0.81226 | 0.00678 | 1.863 | 0.81226 |
| −2.46689 | 0.36979 | p.A331T | 344 | 0.11939 | 0.14735 | 11.076 |
| MT-ND3 | ||||||
| −4.84604 | 0.86366 | p.C39R | 0.81226 | 0.00678 | 1.863 | 0.81226 |
| −2.64329 | 0.41176 | p.L75V | 71 | 0.59287 | 0.05843 | 1.845 |
| −0.64843 | 0.08694 | p.T114A | 110 | 0.24587 | 0.29884 | 1.636 |
| MT-ND6 | ||||||
| −0.88247 | 0.1074 | p.I170V | 0.36272 | 0.27109 | 1.92 | 0.36272 |
Table 5.
Residue frequencies and PSSM score determined by using PSSM viewer program
| Residue | Raw frequency | Weighted frequency | PSSM score |
|---|---|---|---|
| MT-ND1-MTH00104 | |||
| p.T164A | |||
| T | 0.77 | 0.63 | 5 |
| A | 0.05 | 0.08 | 0 |
| p.E204K | |||
| E | 1.00 | 1.00 | 7 |
| K | – | – | 0 |
| p.T229M | |||
| T | 0.25 | 0.27 | 4 |
| M | 0.11 | 0.17 | 4 |
| p.H304Y | |||
| H | 0.69 | 0.54 | 8 |
| Y | 0.24 | 0.32 | 6 |
| MT-ND2-MTH00105 | |||
| p.I57T | |||
| T | 0.79 | 0.73 | 7 |
| I | 0.17 | 0.23 | 3 |
| p.S140L | |||
| S | 0.92 | 0.87 | 6 |
| L | 0.01 | 0.01 | −3 |
| p.N150S | |||
| N | 0.94 | 0.90 | 8 |
| S | 0.00 | 0.01 | −1 |
| p.T173S | |||
| T | 0.98 | 0.95 | 7 |
| S | 0.00 | 0.01 | 0 |
| p.A331T | |||
| T | 0.10 | 0.13 | 2 |
| A | 0.01 | 0.01 | −3 |
| MT-ND3-MTH00106 | |||
| p.C39R | |||
| C | 1.00 | 0.99 | 11 |
| R | −5 | ||
| p.L75V | |||
| L | 0.99 | 0.93 | 6 |
| V | −1 | ||
| p.T114A | |||
| T | 0.60 | 0.55 | 5 |
| A | 0.18 | 0.15 | 1 |
| MT-ND1-MTH00109 | |||
| p.I170V | |||
| V | 0.71 | 0.52 | 5 |
| I | 0.27 | 0.44 | 6 |
Discussion
Mitochondrial electron transport chain consists of four large complexes of respiratory enzymes. Mutations in the OXPHOS genes in mtDNA cause disturbances in the transport of electrons through the respiratory chain. Complex I is called oxidoreductases-NADH-ubiquinone. It consists of several flavine mononucelotide polypeptides and iron-sulfur proteins. The purpose of the complex is to transport reducing equivalents from the reduced form of NADH to ubiquinone (coenzyme Q-CoQ). Mutations in the genes in mtDNA OXPHOS cause disturbances in the transport of electrons through the respiratory chain leading to optic nerve death and complete blindness (Brown et al. 1992). The severity of the symptoms depend on the scope and location of the mutation (Komaki et al. 2003; Mitchell et al. 2006; Grzybowska-Szatkowska and Slaska 2012a).
Although most of the pathogenic mutations in mitochondrial diseases are described as homoplasmic, some are also heteroplasmic. Most occur in LHON (Leber ’s hereditary optic neuropathy), Kearns - Sayre syndrome (Moraes et al. 1989; Brown et al. 1992) and in non-insulin dependent diabetes (Perucca - Lostanlen et al. 2002). They are also described in canine tumours (Slaska et al. 2013a, b). Tan et al. (2002) reported in breast cancer four somatic changes in the OXPHOS system. In three cases they were related to MT-ND2 (silent mutations). The change in the position m.T3398C of MT-ND1 described in breast cancer is also observed in patients with progressive external ophtalmoplegy and cardiomyopathy (Jaksch et al. 1996; Carelli et al. 2004). On the other hand, Bai et al. (2000) have found a reduced expression of mRNA for this complex in the case of mutations in MT-ND5 complex I in murine lung cancer cells. The authors believe that it might be caused by disturbances of the regulation of transcription (up- regulation), mRNA stability or impairment of selective degradation of the mutant mRNA.
In breast cancer carcinoma, sequence analysis of all genes encoding mt-tRNA revealed eight polymorphisms and two mutations detected in 34 % of the patients (Grzybowska-Szatkowska and Slaska 2012b). Transitions m.A15924G and m.A12308G took place only in neoplastic cells, but not in the blood, so the mutations can be attributed strictly to a neoplastic process. The authors suggest that it may be a result of the secondary and tertiary tRNA structure and that the polymorphisms may lead to mitochondrial dysfunction and contribute to revealing other changes in mtDNA (Grzybowska-Szatkowska and Slaska 2012b). Two other polymorphisms m.G10398A and m.T10400C are also connected with a high risk of breast cancer (Mims et al. 2005; Czarnecka et al. 2010; Sultana et al. 2011).
The m.G10398A polymorphism is a marker of haplogroup IJK. Setiawan et al. (2008) deny the link between the m.G10398A polymorphism and breast cancer. Also, the polymorphism of MT-ND2: m.A4769G and m.G5460A are found in breast cancer (Czarnecka et al. 2010). In this paper, the m.G10398A polymorphism was observed in three patients in the material while m.A4769G was present in 27 cases, and m.G5460A only in one patient (Table 2). The polymorphism m.A4769G in contrast to the other two is synonymous, and does not change the amino acid into the protein. Both the transition m.G10398A (resulting in the amino acid change p.T114A) and m.G5460A (resulting in the amino acid change p.A331T) are not present in a high conservation region and, by Panther Pdt, it is less than 0.5 (Table 4).
Replacement of polar threonine with alanine causes a reduction in the non-polar aliphatic index of the protein and the amino acid alanine is less preferred in that position than the threonine (Table 5). The m.G5460A polymorphism is described in Alzheimer’s disease (AD), although the relationship between AD and the polymorphism is being discussed (Mitchell et al. 2006). The test material (Table 2) also detected two polymorphisms described in LHON (Johns et al. 1991; Fauser et al. 2002) and adult onset dystonia. Mitochondrial haplogroup J/T (Herrnstadt et al. 2002) is defined by the transition at position m.T4216C. This polymorphism has been described as a secondary mutation in LHON (Carelli et al. 2004) and also to be associated with insulin resistance and type 2 diabetes (Crispim et al. 2006).
This polymorphism relates to helix 8 and changes its percentage of 6.59 to 3.71 (Table 3). In insulin resistance and type 2 diabetes it often occurs together with transitions in MT-ND2 at position 4917 (Johns et al. 1991). In the material studied by us, there was no transition at position 4917, but at position m.A4918G (Table 2), which resulted in an amino acid change in the same codon (p.N150S) (Johns et al. 1991; Crispim et al. 2006). This transition was accompanied by a polymorphism in m.T4216C in two patients (Table 2).
Transition m.A4918T is described in the literature as a natural variant of mtDNA (Marzuki et al. 1991) and it converts a highly conserved arginine containing an amide group to the serine with a hydroxyl group. Also, the evolutionary analysis of coding SNPs subPSEC was below −3, indicating that the polymorphism has an impact on the functioning of the protein (Table 4). The polymorphism m.T4639C refers to a highly conserved region and occurs in haplogrup M22 (Table 2), and also relates to the codon described in LHON.
In LHON, polymorphism in that codon concerns mtDNA position 4640 and there is a replacement of isoleucine with methionine there (p.I57M) (Volod’ko et al. 2006; Pereira et al. 2011). It should be noted that the substitution of isoleucine for thereonine will change the percentage of the second helix down to 2.91 from 12.89 (Table 3). Transition at mtDNA position 4888 on the MT-ND2 occurred in both tumour cells and blood so it should be taken as a polymorphism (Table 2). The polymorphism has not been described so far in the literature and is not present in the database. It causes a conversion of polar leucine to nonpolar serine and the evolutionary analysis of coding SNPs subPSEC was less than −3 (Table 4), which indicates that the polymorphism is not indifferent to the functioning of the protein.
The polymorphism m.C3992T is relatively rare in the general population and when associated with the mitochondrial haplogrups of H, T, L (Table 2) it appeared as a mutation in thyroid cancer (Maximo et al. 2002; Brandon et al. 2006). We currently know mtDNA genes and regions in which polymorphisms and mutations are associated with similar types of cancer in the corresponding tissues of humans and dogs (Ślaska et al. 2013). In the different types of tumours in dogs, including breastcancer, there are a number of polymorphisms described in the D-loop region, MT-CYTB, MT-COI and MT-ND1 gene, and a missense mutation in epithelioma glandulae sebacei resulting in the amino acid change p.T193N leading to a change in MT-ND1 (Slaska et al. 2013a, b). Heteroplasmic changes were found in MT-ND1 and MT-CYTB in epithelioma glandulae sebacei and in MT-CYTB in lymphoma centroblasticum (Slaska et al. 2013).
Out of the five detected, two mutations were not reported in the literature. The m.A3796G mutation (resulting in the amino acid change p.T164A), which is present in the literature, was described in adult onset dystonia (Simon et al. 2003; Mitchell et al. 2006). The m.G4580A silent mutation was described in pancreatic cancer cells (Jones et al. 2001). Both the mutation m.C4987G (resulting in the amino acid change p.T173S) and the m.T10173C (resulting in the amino acid change p.C39R) concern highly conserved aminoacids. The m.C4987G mutation occurred in up to ten patients (Table 2). The literature describes the mutation in the codon 173. Those were related to position 4986. That mutation caused replacement of threonine with alanine. In the cells of intestinal crypts (Taylor et al. 2003) and in the case of oral cancer – by proline (Tan et al. 2004).
The mutation m.T14166C (resulting in the amino acid change p.I70V) was described in neurogastrointestinal mitochondrial encephalomyopathy (MNGIE) (Nishigaki et al. 2003). MNGIE is an autosomal recessive disorder caused by loss-of-function mutations in the gene encoding thymidine phosphorylase. All changes detected in our study were homplasmic (Table 2). In case of changes in tumours we often have to deal with homoplasia. As a result of intramitochondial selection, the dominance of one type of mtDNA occurs in a mitochondrion, a so-called functional advantage (Augenlicht and Heerdt 2001; Jones et al. 2001; Grzybowska-Szatkowska and Slaska 2012a). During cell division the cell strives to obtain a prevalence of one type of mRNA (a homoplasmy - a replicative segregation) (Augenlicht and Heerdt 2001; Jones et al. 2001; Grzybowska-Szatkowska and Slaska 2012a).
The period required for the replication of segregation to occur would correspond with the phase of neoplastic transformation. The homoplasmy can also occur as a result of a random segregation of mitochondria during cell division (Coller et al. 2001). In subsequent generations of progenitor cells heteroplasmy may persist, or by a genetic drift a homoplasmy may occur (Coller et al. 2001; Jones et al. 2001).
As a result of genetic drift either elimination or stabilisation of rare variants of mtDNA occurs. It seems that this may be the cause of carcinogenesis. The occurrence and severity of symptoms in mitochondrial diseases depends on the ratio between the normal and mutated DNA. The dominance of mutant mtDNA in a cell leads to disturbances in the production of energy in the process of oxidative phosphorylation, which may lead to cell and tissue damage. The clinical manifestations of those disorders depends on the type of defects in the mitochondrial DNA and on the degree of sensitivity of the heteroplasmic tissue disorders related to cellular respiration. When there is an advantage of mutant mtDNA, symptoms arise that are progressive in character.
Mutations in the genes for mitochondrial proteins cause a wide range of symptoms. Changes in mtDNA accumulate with age due to long-term exposure to free radicals generated in the mitochondria (Liu et al. 1998; Czarnecka and Bartnik 2011). The delayed onset and progressive nature of mitochondrial diseases indicate a progressive deterioration with age in the mitochondrial function (Liu et al. 1998). This is why some mitochondrial diseases occur in middle or old age (Brown et al. 1992; Lyamzaev et al. 2004).
In the studied material we detected polymorphisms occurring in patients with LHON syndrome and in adult onset dystonia. In the phase of clinical detection cancer has about 1 cm3 volume and contains 109 cells. The average time of the preclinical phase lasts from 15 to 20 years, or much longer, even 50 years. This raises the question of whether the mutations present in the mitochondrial DNA are primary in relation to cancer or are the result of changes produced and processes occurring during carcinogenesis. Their original character is indicated by their disclosure in the form of clinical signs after a long period of occurrence (upon reaching the prevalence of the mutant mtDNA) and the slow progressive nature of the symptoms as is the case with the mitochondrial diseases.
References
- Andrews RM, Kubacka I, Chinnery PF, Lightowlers RN, Turnbull DM, Howell N. Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA. Nat Genet. 1999;23:147. doi: 10.1038/13779. [DOI] [PubMed] [Google Scholar]
- Augenlicht LH, Heerdt BG. Mitochondria: integrators in tumorigenesis? Nat Genet. 2001;28:104–105. doi: 10.1038/88800. [DOI] [PubMed] [Google Scholar]
- Bai Y, Shakeley RM, Attardi G. Tight control of respiration by NADH dehydrogenase ND5 subunit gene expression in mouse mitochondria. Mol Cell Biol. 2000;20:805–815. doi: 10.1128/MCB.20.3.805-815.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brandon M, Baldi P, Wallach DC. Mitochondrial mutations in cancer. Onncogene. 2006;34:4647–4662. doi: 10.1038/sj.onc.1209607. [DOI] [PubMed] [Google Scholar]
- Brown MD, Voljavec AS, Lott MT, MacDonald I, Wallace DC. Leber’s hereditary optic neuropathy: a model for mitochondrial neurodegenerative diseases. FASEB J. 1992;6:2791–2799. doi: 10.1096/fasebj.6.10.1634041. [DOI] [PubMed] [Google Scholar]
- Carelli V, Ross-Cisneros FN, Sadun AA. Mitochondrial dysfunction as a cause of optic neuropathies. Prog Retin Eye Res. 2004;23:53–89. doi: 10.1016/j.preteyeres.2003.10.003. [DOI] [PubMed] [Google Scholar]
- Coller HA, Khrapko K, Bodyak ND, Nekhaeva E, Herrero-Jimenez P, Thilly WG. High frequency of homoplasmic mitochondrial DNA mutations in human tumors can be explained without selection. Nat Genet. 2001;28:147–150. doi: 10.1038/88859. [DOI] [PubMed] [Google Scholar]
- Crispim D, Canani LH, Gross JL, Tschiedel B, Souto KE, Roisenberg I. The European-specific mitochondrial cluster J/T could confer an increased risk of insulin-resistance and type 2 diabetes: an analysis of the m.4216 T > C and m.4917A > G variants. Ann Hum Genet. 2006;70:488–495. doi: 10.1111/j.1469-1809.2005.00249.x. [DOI] [PubMed] [Google Scholar]
- Czarnecka A, Bartnik E. The role of the mitochondrial genome in ageing and carcinogenesis. J Aging Res. 2011;2011:136435. doi: 10.4061/2011/136435. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Czarnecka AM, Krawczyk T, Zdrożny M, Lubiński J, Arnold RS, Kukwa W, Ścińska A, Golik P, Bartnik E, Petros JA. Mitochondrial NADH-dehydrogenase subunit 3 (ND3) polymorphism (A10398G) and sporadic breast cancer in Poland. Breast Cancer Res Treat. 2010;121:511–518. doi: 10.1007/s10549-009-0358-5. [DOI] [PubMed] [Google Scholar]
- Fauser S, Luberichs J, Besch D, Leo-Kottler B. Sequence analysis of the complete mitochondrial genome in patients with Leber’s hereditary optic neuropathy lacking the three most common pathogenic DNA mutations. Biochem Biophys Res Commun. 2002;295:342–347. doi: 10.1016/S0006-291X(02)00672-1. [DOI] [PubMed] [Google Scholar]
- Grzybowska-Szatkowska L, Slaska B. Mitochondrial DNA and carcinogenesis (review) Mol Med Rep. 2012;6:923–930. doi: 10.3892/mmr.2012.1027. [DOI] [PubMed] [Google Scholar]
- Grzybowska-Szatkowska L, Slaska B. Polymorphisms in genes encoding mt-tRNA in female breast cancer in Poland. Mitochondrial DNA. 2012;23:106–111. doi: 10.3109/19401736.2012.660925. [DOI] [PubMed] [Google Scholar]
- Herrnstadt C, Elson JL, Fahy E, Preston G, Turnbull DM, Anderson C, Ghosh SS, Olefsky JM, Beal MF, Davis RE, Howell N. Reduced-median-network analysis of complete mitochondrial DNA coding-region sequences from the major African, Asian, and European haplogroups. Am J Hum Genet. 2002;70:1152–1171. doi: 10.1086/339933. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jaksch M, Hofmann S, Kaufhold P, Obermaier-Kusser B, Zierz S, Gerbitz KD. A novel combination of mitochondrial tRNA and ND1 gene mutations in a syndrome with MELAS, cardiomyopathy, and diabetes mellitus. Hum Mutat. 1996;7:358–360. doi: 10.1002/(SICI)1098-1004(1996)7:4<358::AID-HUMU11>3.0.CO;2-1. [DOI] [PubMed] [Google Scholar]
- Johns DR, Berman J. Alternative, simultaneous complex I mitochondrial DNA mutations in Leber’s hereditary optic neuropathy. Biochem Biophys Res Commun. 1991;174:1324–1330. doi: 10.1016/0006-291X(91)91567-V. [DOI] [PubMed] [Google Scholar]
- Jones JB, Song JJ, Hempen PM, Parmigiani G, Hruban RH, Kern SE. Detection of Mitochondrial DNA Mutations in Pancreatic Cancer Offers a “Mass”-ive Advantage over Detection of Nuclear DNA Mutations. Cancer Res. 2001;61:1299–1304. [PubMed] [Google Scholar]
- Komaki H, Akanuma J, Iwata H, Takahashi T, Mashima Y, Nonaka I, Goto YI. A novel mtDNA C11777A mutation in Leigh syndrome. Mitochondrion. 2003;2:293–304. doi: 10.1016/S1567-7249(03)00003-5. [DOI] [PubMed] [Google Scholar]
- Liu VWS, Zhang C, Nagley P. Mutation in mitochondrial DNA accumulate differentially in three different human tissue during aging. Nucleic Acids Res. 1998;26:1268–1275. doi: 10.1093/nar/26.5.1268. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lyamzaev KG, Izyumov DS, Avetisyan AV, Yang F, Pletjushkina OY, Chernyak BV. Inhibition of mitochondrial bioenergetics: the effects on structure of mitochondria in the cell and on apoptosis. Acta Biochim Pol. 2004;51:553–562. [PubMed] [Google Scholar]
- Marzuki S, Noer AS, Lertrit P, Thyagarajan D, Kapsa R, Utthanaphol P, Byrne E. Normal variants of human mitochondrial DNA and translation products: the building of a reference data base. Hum Genet. 1991;88:139–145. doi: 10.1007/BF00206061. [DOI] [PubMed] [Google Scholar]
- Maximo V, Soares P, Lima J, Cameselle-Teijeiro J, Sobrinho-Simoes M. Mitochondrial DNA somatic mutations (point mutations and large deletions) and mitochondrial DNA variants in human thyroid pathology: a study with emphasis on Hurthle cell tumors. Am J Pathol. 2002;160:1857–1865. doi: 10.1016/S0002-9440(10)61132-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mims MP, Hayes TG, Zheng S, Leal SM, Frolov A, Ittmann MM, Wheeler TM, Prchal JT. Mitochondrial DNA G10398A Polymorphism and Invasive Breast Cancer in African-American Women. Cancer Res. 2005;65:8028–8033. doi: 10.1158/0008-5472.CAN-05-3774. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mitchell AL, Elson JL, Howell N, Taylor RW, Turnbull DM. Sequence variation in mitochondrial complex I genes: mutation or polymorphism? J Med Genet. 2006;43:175–179. doi: 10.1136/jmg.2005.032474. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Moraes CT, Schon EA, DiMauro S, Miranda AF. Heteroplasmy of mitochondrial genomes in clonal cultures from patients with Kearns-Sayre syndrome. Biochem Biochem Biophys Res Commun. 1989;160:765–771. doi: 10.1016/0006-291X(89)92499-6. [DOI] [PubMed] [Google Scholar]
- Nishigaki Y, Marti R, Copeland WC, Hirano M. Site-specific somatic mitochondrial DNA point mutations in patients with thymidine phosphorylase deficiency. J Clin Invest. 2003;111:1913–1921. doi: 10.1172/JCI17828. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pereira L, Soares P, Radivojac P, Li B, Samuels DC. Comparing phylogeny and the predicted pathogenicity of protein variations reveals equal purifying selection across the global human mtDNA diversity. Am J Hum Genet. 2011;88:433–439. doi: 10.1016/j.ajhg.2011.03.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Perucca-Lostanlen D, Taylor RW, Narbonne H, Mousson de Camaret B, Hayes CM, Saunieres A, Paquis-Flucklinger V, Turnbull DM, Vialettes B, Desnuelle C. Molecular and functional effects of the T14709C point mutation in the mitochondrial DNA of a patient with maternally inherited diabetes and deafness. Biochim Biophys Acta. 2002;1588:210–216. doi: 10.1016/S0925-4439(02)00167-9. [DOI] [PubMed] [Google Scholar]
- Setiawan VW, Chu LH, John EM, Ding YC, Ingles SA, Bernstein L, Press MF, Ursin G, Haiman CA, Neuhausen SL. Mitochondrial DNA G10398A variant is not associated with breast cancer in African-American women. Cancer Genet Cytogenet. 2008;181:16–19. doi: 10.1016/j.cancergencyto.2007.10.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Simon DK, Friedman J, Breakefield XO, Jankovic J, Brin MF, Provias J, Bressman SB, Charness ME, Tarsy D, Johns DR, Tarnopolsky MA. A heteroplasmic mitochondrial complex I gene mutation in adult-onset dystonia. Neurogenetics. 2003;4:199–205. doi: 10.1007/s10048-003-0150-3. [DOI] [PubMed] [Google Scholar]
- Slaska B, Grzybowska-Szatkowska L, Nisztuk S, Surdyka M, Rozanska D. Mitochondrial DNA polymorphism in genes encoding ND1. COI and CYTB in canine malignant cancers. Mitochondrial DNA. 2013 doi: 10.3109/19401736.2013.840594. [DOI] [PubMed] [Google Scholar]
- Slaska B, Grzybowska-Szatkowska L, Surdyka M, Nisztuk S, Rozanska D, Rozanski P, Smiech A, Orzelski M. Mitochondrial D-loop mutations and polymorphisms are connected with canine malignant cancers. Mitochondrial DNA. 2013 doi: 10.3109/19401736.2013.792054. [DOI] [PubMed] [Google Scholar]
- Ślaska B, Grzybowska-Szatkowska L, Bugno-Poniewierska M, Surdyka M, Śmiech A. Nuclear and mitochondrial DNA mutation in human and canine tumors. Med Weter. 2013;4:195–202. [Google Scholar]
- Sultana GNN, Rahman A, Karim MM, Shahinuzzaman ADA, Begum R, Begum RA. Breast cancer risk associated mitochondrial NADH-dehydrogenase subunit-3 (ND3) polymorphisms (G10398A and T10400C) in Bangladeshi women. J Med Genet. 2011;3:131–135. [Google Scholar]
- Tan DJ, Bai RK, Wong LJC. Comprehensive Scanning of Somatic Mitochondrial DNA Mutations in Breast Cancer. Cancer Res. 2002;62:972–976. [PubMed] [Google Scholar]
- Tan DJ, Chang J, Chen WL, Agress LJ, Yeh KT, Wang B, Wong LJ. Somatic mitochondrial DNA mutations in oral cancer of betel quid chewers. Ann N Y Acad Sci. 2004;1011:310–316. doi: 10.1196/annals.1293.030. [DOI] [PubMed] [Google Scholar]
- Taylor RW, Barron MJ, Borthwick GM, Gospel A, Chinnery PF, Samuels DC, Taylor GA, Plusa SM, Needham SJ, Greaves LC, Kirkwood TB, Turnbull DM. Mitochondrial DNA mutations in human colonic crypt stem cells. J Clin Invest. 2003;112:1351–1360. doi: 10.1172/JCI19435. [DOI] [PMC free article] [PubMed] [Google Scholar]
- van Oven M, Kayser M. Updated comprehensive phylogenetic tree of global human mitochondrial DNA variation. Hum Mutat. 2009;30:E386–E394. doi: 10.1002/humu.20921. [DOI] [PubMed] [Google Scholar]
- Volod’ko NV, L’Vova MA, Starikovskaya EB, Derbeneva OA, Bychkov IY, Mikhailovskaya IE, Pogozheva IV, Fedotov FF, Soyan GV, Procaccio V, Wallace DC, Sukernik RI. Spectrum of pathogenic mtDNA mutations in Leber’s hereditary optic neuropathy families from Siberia. Russ J Genet. 2006;42:76–83. doi: 10.1134/S102279540601011X. [DOI] [PubMed] [Google Scholar]
- Welter C, Kovacs G, Seitz G, Blin N. Alteration of mitochondrial DNA in human oncocytomas. Gene Chromosome Canc. 1989;1:79–82. doi: 10.1002/gcc.2870010112. [DOI] [PubMed] [Google Scholar]