Abstract
Sixty extended-spectrum β-lactamase (ESBL)-producing Escherichia coli isolated from rivers and lakes in Switzerland were screened for individual strains additionally exhibiting a reduced quinolone susceptibility phenotype. Totally, 42 such isolates were found and further characterized for their molecular (fluoro)quinolone resistance mechanisms. PCR and sequence analysis were performed to identify chromosomal mutations in the quinolone resistance-determining regions (QRDR) of gyrA, gyrB, parC and parE and to describe the occurrence of the following plasmid-mediated quinolone resistance genes: qepA, aac-6′-Ib-cr, qnrA, qnrB, qnrC, qnrD and qnrS. The contribution of efflux pumps to the resistance phenotype of selected strains was further determined by the broth microdilution method in the presence and absence of the efflux pump inhibitor phe-arg-β-naphthylamide (PAβN). Almost all strains, except two isolates, showed at least one mutation in the QRDR of gyrA. Ten strains showed only one mutation in gyrA, whereas thirty isolates exhibited up to four mutations in the QRDR of gyrA, parC and/or parE. No mutations were detected in gyrB. Most frequently the amino-acid substitution Ser83→Leu was detected in GyrA followed by Asp87→Asn in GyrA, Ser80→Ile in ParC, Glu84→Val in ParC and Ser458→Ala in ParE. Plasmid-mediated quinolone resistance mechanisms were found in twenty isolates bearing QnrS1 (4/20), AAC-6′-Ib-cr (15/20) and QepA (1/20) determinants, respectively. No qnrA, qnrB, qnrC and qnrD were found. In the presence of PAβN, the MICs of nalidixic acid were decreased 4- to 32-fold. (Fluoro) quinolone resistance is due to various mechanisms frequently associated with ESBL-production in E. coli from surface waters in Switzerland.
Introduction
Quinolones and fluoroquinolones (FQ) are broad-spectrum antimicrobial compounds and of critical importance in clinical use. They are the antimicrobials of choice in the treatment of acute gastrointestinal infections, urinary tract infections and respiratory tract infection. Resistance to FQ drugs increased in past years following the extensive and widespread use.
The mechanisms of action of (F)Qs is due to inhibition of DNA replication and resistance to (F)Qs is either based on (i) mutational alterations in the FQ target enzymes: DNA topoisomerase II (DNA gyrase) and topoisomerase IV, or (ii) plasmid-mediated quinolone resistance (PMQR) mechanisms or simply (iii) the decreased uptake of the drug due to the loss of a membrane-bound porin and/or drug extrusion via efflux pumps [1], [2]. PMQR mechanisms include target protection proteins of the qnr gene family, enzymatic modification gene aac-(6′)-Ib-cr and the efflux pump gene qepA. So far, five different qnr genes with a number of variations have been described: qnrA, qnrB, qnrC, qnrD and qnrS [3]–[7]. The Qnr proteins belong to the pentapeptide family of proteins and share common structural properties. AAC(6′)-Ib-cr differs from the aminoglycoside acetyltransferase, AAC(6′)-Ib, by two specific codon exchanges Trp102→Arg and Asp179→Tyr, which have been found to be necessary and sufficient for the ciprofloxacin (CIP) resistance phenotype [8]. The PMQR mechanisms confer only low level resistance to quinolones and thus, they were thought to enable the occurrence of chromosomal mutation which then lead to clinically relevant resistance levels [9].
In a previous study [10], 42 of 60 extended-spectrum β-lactamase-producing Escherichia coli strains isolated from rivers and lakes additionally displayed increased levels of nalidixic acid (NA) and/or CIP resistance.
The spread of E. coli co-expressing (fluoro)quinolone resistance along with extended-spectrum β-lactamases into the environment, especially into water bodies such as rivers, streams, wastewater effluents and lakes is worrisome. Rivers are considered to be of special importance as a reservoir of resistance genes since they are recipients of bacteria from different sources, e.g., wastewater plants, water of urban or industrial effluents, or agricultural activities [11].
The aim of this study was to identify and characterize quinolone and fluoroquinolone resistance mechanisms in higher generation cephalosporin resistant E. coli isolated from rivers and lakes in Switzerland.
Materials and Methods
Bacterial Isolates
Forty-two of 60 extended-spectrum β-lactamase-producing Escherichia coli strains isolated from rivers and lakes during a previous study and additionally displaying increased levels of nalidixic acid (NA) and/or CIP resistance were selected for this study. The protocol for collecting the water samples and isolating the strains as well as the species identification, antibiotic sensitivity testing and the characterization of the ESBL-types were described in the previous study [10].
MIC Determination of Nalidixic Acid and Ciprofloxacin
MICs for NA and CIP of all 42 strains were determined using Etest strips (bioMérieux, Marcy l’Etoile, France). Of selected strains, MICs for NA (Sigma-Aldrich, Switzerland) were determined by the broth microdilution method according the Clinical and Laboratory Standards Institute (CLSI) [12], in the absence and presence of 40 µg/ml phe-arg-β-naphthylamide (PAβN) (Sigma-Aldrich, Switzerland). As recommended by the CLSI, the E. coli ATCC25922 was included as quality control strain.
Identification of Quinolone Resistance Determinants and DNA Sequencing
DNA was extracted by a standard heat lysis protocol. Amplification of the quinolone resistance-determining regions (QRDRs) of the gyrA, gyrB, parC and parE genes and PCR based detection of the plasmid-mediated quinolone resistance (PMQR) markers (qnrA, qnrB, qnrC, qnrD, qnrS, aac(6′)-Ib-cr and qepA) was performed using primers listed in Table 1. Custom-sequencing was performed by Microsynth (Balgach, Switzerland) and the nucleotide and translated protein sequences were analyzed with CLC Main Workbench 6.6.1. For database searches the BLASTN and BLASTP programs of NCBI (http://www.ncbi.nlm.nih.gov/blast/) were used.
Table 1. Target genes, primers and PCR reaction conditions used for strain characterization.
| Target | Primer | Sequence (5′-3′) | Annealing temperature (°C) | Product size (bp) | Reference |
| Detection primers | |||||
| qnrA | QnrAm-F | AGAGGATTTCTCACGCCAGG | 54 | 516 | [39] |
| qnrA_R | GCCATACCTACGGCGATACC | [40] | |||
| qnrB | qnrB_F | GATCGTGAAAGCCAGAAAGG | 54 | 476 | [41] |
| qnrB_R | ATGAGCAACGATGCCTGGTA | [41] | |||
| qnrC | qnrC-F | GGGTTGTACATTTATTGAATC | 47 | 447 | [6] |
| qnrC-R | TCCACTTTACGAGGTTCT | [6] | |||
| qnrD | qnrD fw | CGAGATCAATTTACGGGGAATA | 54 | 582 | [7] |
| qnrD rev | AACAAGCTGAAGCGCCTG | [7] | |||
| qnrS | QnrSm-F | GCAAGTTCATTGAACAGGGT | 54 | 428 | [39] |
| QnrSm-R | TCTAAACCGTCGAGTTCGGCG | [39] | |||
| aac(6′)-Ib-cr | aac(6′)-Ib_For | TTGCGATGCTCTATGAGTGGCTA | 55 | 482 | [42] |
| aac(6′)-Ib_Rev | CTCGAATGCCTGGCGTGTTT | [42] | |||
| qepA | QEPfor | TGGTCTACGCCATGGACCTCA | 56 | 1137 | [43] |
| QEPrev | TGAATTCGGACACCGTCTCCG | [43] | |||
| Sequencing primers | |||||
| gyrA | gyrA WF | AAATCTGCCCGTGTCGTTGGT | 55 | 344 | [41] |
| gyrA WR | GCCATACCTACGGCGATACC | [41] | |||
| gyrB | gyrB-F | GAAATGACC CGCCGTAAA | 55 | 272 | [44] |
| gyrB-R | ACGACCGATACCACAGCC | [44] | |||
| parC | parC WF | CTGAATGCCAGCGCCAAATT | 55 | 168 | [41] |
| parC WR | GCGAACGATTTCGGATCGTC | [41] | |||
| parE | parE-F | CTGAACTGCTGGCGGAGATG | 60 | 483 | [44] |
| parE-R | GCGGTGGCAGTGCGACGTAA | [44] | |||
| qnrS | qnrS1_orf_f | GTTGTAATGTGTTGATGTAACAGG | 52 | 825 | This study |
| qnrS1_orf_r | CCCTATGTCTATTATTGCAAGG | This study | |||
Transferability of the PMQR Determinants
Conjugation experiments were performed with the plasmid-free recipient strain E. coli HK225 strain (Strep r, Rifr) [13] in order to assess the transferability of the plasmid-mediated quinolone resistance markers qnrS1, aac-6′-Ib-cr and qepA. Four qnrS1 (OW1E2, OW54E2, OW60E1 and OW95E1), five aac-6′-Ib-cr (OW8C2, OW29E1; OW55C1, OW77E1 and OW89E1) and one qepA (OW54E1) positive isolates were selected at random as putative conjugation donors. Briefly, single colonies of the donor and recipient were inoculated in LB broth (Difco Laboratories) and grown overnight at 37°C. Subsequently, equal volumes of the donor and recipient cultures were mixed and incubated overnight at 37°C without shaking. Serial dilutions were then plated on LB agar (Difco Laboratories) selection plates supplemented with a combination of 600 µg/ml streptomycin (Sigma-Aldrich, Switzerland), 100 µg/ml rifampicin (Sigma-Aldrich, Switzerland) and either 10 µg/ml cefotaxime (Sigma-Aldrich, Switzerland) or 20 µg/ml tetracycline (Sigma-Aldrich, Switzerland). The colonies from the selection plates were examined by pulsed field gel electrophoresis (PFGE) to ensure acquisition of the plasmid. PCR was performed to (i) identify the resistance genes acquired by the transconjugants and (ii) for replicon typing the plasmids harboring PMQR genes co-transferred to the transconjugants.
Replicon Typing
Plasmids were assigned to incompatibility groups on the basis of the presence of specific replicon sequences identified by PCR [14].
Results
Of the total of 60 ESBL-producing E. coli isolates, 42 co-expressing (F)Q resistance were further characterized. Based on the Etest assay, two strains showed intermediate resistance to NA, nine were classified as resistant to NA, two were resistant to NA and showed intermediate resistance to CIP and 29 were resistant to NA and CIP.
In 40/42 (95.2%) of the investigated isolates, at least one point mutation leading to amino acid substitution in any of the quinolone resistance-determining regions (QRDR) of gyrA, parC and parE was detected (Table 2). No mutations were identified in gyrB. High-level resistance to NA was always attributed to a single mutation in gyrA, whereas strains resistant to both tested (F)Qs exhibited at least one point mutation in two different topoisomerase genes; most frequently in gyrA and parC. A total of ten strains showed only one point mutation, nine had the predominate substitution in GyrA Ser83→Leu and one a Ser83→Val exchange. One strain (OW55E1) showed one substitution in GyrA (Ser83→Leu) and one in ParC (Ser80→Arg). Six strains had the following set of substitutions: GyrA (Ser83→Leu and Asp87→Asn), and ParC (Ser80→Ile). OW86E2 showed the same substitutions in GyrA, but in ParC (Glu84→Val). Twenty-one strains showed four substitutions in at least two different proteins: fourteen had substitutions in GyrA (Ser83→Leu, Asp87→Asn) in ParC (Ser80→Ile) and in ParE (Ser458→ Ala), five strains in GyrA (Ser83→Leu, Asp87→Asn) in ParC (Ser80→Ile, Glu84→Val), OW54E1 in GyrA (Ser83→Leu, Asp87→Asn) in ParC (Ser80→Ile, Glu84→Gly) and OW60C2 in GyrA (Ser83→Leu, Asp87→Asn) in ParC (Ser80→IIe) and ParE (Glu460→Asp), respectively. Strain OW1C2 exhibited unique substitutions in GyrA: besides the frequently substituted position Ser83, here (Ser83→Tre), also positions Ile112→Val, Leu127→Met, Ala128→Ser and Lys154→Arg were affected. Additionally, substitutions in ParC (Ser80→Ile) and in ParE (Ser458→ Ala) were detected.
Table 2. Quinolone resistance, amino acid substitutions in the QRDR of GyrA, ParC and ParE proteins in terms of amino acid positions and PMQR determinants in extended-spectrum β-lactamase (ESBL) producing Escherichia coli isolated from rivers and lakes in Switzerland.
| Isolate a) | Origin | blaESBL | NA MIC (mg/ml) | CIP MIC (mg/ml) | Substitutions in the QRDR | PMQR determinants | |||||
| GyrA | ParC | ParE | qnrS1 | aac(6′)-Ib-cr | qepA | Additional resistance profile | |||||
| OW60E1 | Reuss | CTX-M-27 | 12 | 0.5 | − | − | − | + | − | − | AM, CF, CTX, TE, S |
| OW54E2 | Aare | CTX-M-55 | 24 | 0.5 | − | − | − | + | − | − | AM, CF, CTX, TE, SMZ |
| OW2E1 | Eibach | CTX-M-15 | 256 | 0.19 | S83L | − | − | − | − | − | AM, AMC, CF, CTX, GM, TE, TMP |
| OW64E2 | Rhein | CTX-M-15 | 256 | 0.19 | Ser83L | − | − | − | − | − | AM, CF, CTX, S, SMZ, TMP |
| OW65E1 | Rhein | CTX-M-15 | 256 | 0.19 | Ser83L | − | − | − | − | − | AM, AMC, CF, CTX, SMZ |
| OW67E1 | Rhein | CTX-M-15 | 256 | 0.19 | S83L | − | − | − | − | − | AM, CF, CTX, SMZ, TMP |
| OW77E2 | Goldach | CTX-M-15 | 256 | 0.19 | S83L | − | − | − | − | − | AM, CF, CTX, TE, S, SMZ, TMP |
| OW8E1 | Marbach | CTX-M-3 | 256 | 0.25 | S83V | − | − | − | − | − | AM, CF, CTX, SMZ, TMP |
| OW63E2 | Limmat | CTX-M-15 | 256 | 0.25 | Ser83L | − | − | − | − | − | AM, AMC, CF, CTX, TE, S, C, SMZ, TMP |
| OW95E1 | Lorze | CTX-M-15 | 256 | 1.5 | S83L | − | − | + | − | − | AM, CF, CTX, TE, S, SMZ, TMP |
| OW1E2 | Birs | CTX-M-55 | 256 | 2 | S83L | − | − | + | − | − | AM, CF, CTX, TE, S, C, SMZ TMP |
| OW18E1 | Reuss | CTX-M-15 | >256 | 0.25 | S83L | − | − | − | − | − | AM, CF, CTX, TE, S, SMZ, TMP |
| OW55E1 | Aare | SHV-12 | >256 | 1 | S83L | S80R | − | − | − | − | AM, AMC, CF, CTX, TE, S, C, K, SMZ, TMP |
| OW38E1 | Emme | CTX-M-3 | >256 | 8 | S83L, D87N | S80I | − | − | − | − | AM, CF, CTX, TE, S, K, SMZ, TMP |
| OW48E1 | Aabach | CTX-M-1 | >256 | 12 | S83L, D87N | S80I | − | − | − | − | AM, CF, CTX, GM, TE, S, C, K, SMZ, TMP |
| OW3E1 | Birs | SHV-12 | >256 | 24 | S83L, D87N | S80I | − | − | − | − | AM, CF, CTX TE, S, C, SMZ, TMP |
| OW65E2 | Rhein | CTX-M-1 | >256 | 24 | S83L, D87N | S80I | − | − | − | − | AM, CF, CTX, TE, SMZ |
| OW76E2 | Thur | CTX-M-14 | >256 | 24 | S83L, D87N | S80I | − | − | − | − | AM, CF, CTX, GM, TE, S, SMZ, TMP |
| OW86E2 | Rotbach | CTX-M-27 | >256 | >32 | S83L, D87N | E84V | − | − | − | − | AM, CF, CTX, TE, S, SMZ, TMP |
| OW4E2 | Ergolz | CTX-M-27 | >256 | >32 | S83L, D87N | S80I, E84V | − | − | − | AM, CF, CTX, TE, S, SMZ | |
| OW14E1 | Rhein | CTX-M-14 | >256 | >32 | S83L, D87N | S80I, E84V | − | − | − | − | AM, CF, CTX, SMZ |
| OW15E1 | Rhein | CTX-M-27 | >256 | >32 | S83L, D87N | S80I, E84V | − | − | − | − | AM, CF, CTX, SMZ, TMP |
| OW18E2 | Reuss | CTX-M-15 | >256 | >32 | S83L, D87N | S80I, E84V | − | − | − | − | AM, CF, CTX, TE, S, SMZ, TMP |
| OW54E1 | Aare | CTX-M-55 | >256 | >32 | S83L, D87N | S80I, E84G | − | − | - | + | AM, CF, CTX, TE, S, C, SMZ, TMP |
| OW77E1 | Goldach | CTX-M-15 | >256 | >32 | S83L, D87N | S80I, E84V | − | − | + | − | AM, CF, CTX, TE, K, SMZ, TMP |
| OW89E1 | Reuss | CTX-M-15 | >256 | >32 | S83L, D87N | S80I, E84V | − | − | + | − | AM, CF, CTX, GM, TE, K, SMZ, TMP |
| OW1C2 | Birs | CTX-M-15 | >256 | >32 | S83T, I112V, L127M, A128S, K154R | S80I | S458A | − | + | − | AM, AMC, CF, CTX, GM, K, SMZ, TMP |
| OW3C1 | Birs | CTX-M-15 | >256 | >32 | S83L, D87N | S80I | S458A | − | + | − | AM, AMC, CF, CTX, GM, K, SMZ |
| OW5E1 | Ergolz | CTX-M-14 | >256 | >32 | S83L, D87Y | S80I | S458A | − | − | − | AM, CF, CTX, GM, S, SMZ, TMP |
| OW8C2 | Marbach | CTX-M-15 | >256 | >32 | S83L, D87N | S80I | S458A | − | + | − | AM, AMC, CF, CTX, TE, K, SMZ, TMP |
| OW14E2 | Rhein | CTX-M-15 | >256 | >32 | S83L, D87N | S80I | S458A | − | + | − | AM, AMC, CF, CTX, TE, S, K, SMZ, TMP |
| OW15C1 | Rhein | CTX-M-15 | >256 | >32 | S83L, D87N | S80I | S458A | − | + | − | AM, AMC, CF, CTX, GM, TE, K, SMZ, TMP |
| OW16E2 | Rhein | CTX-M-15 | >256 | >32 | S83L, D87N | S80I | S458A | − | + | − | AM, AMC, CF, CTX, GM, TE, K, SMZ, TMP |
| OW18C1 | Reuss | CTX-M-15 | >256 | >32 | S83L, D87N | S80I | S458A | − | + | − | AM, AMC, CF, CTX, GM, TE, S, K, SMZ, TMP |
| OW29E1 | Binzmühleweiher | CTX-M-15 | >256 | >32 | S83L, D87N | S80I | S458A | − | + | − | AM, AMC, CF, CTX, GM, TE, C, K, SMZ, TMP |
| OW50E1 | Aabach | CTX-M-15 | >256 | >32 | S83L, D87N | S80I | S458A | − | − | − | AM, CF, CTX, TE, S, C, SMZ, TMP |
| OW55C1 | Aare | CTX-M-15 | >256 | >32 | S83L, D87N | S80I | S458A | − | + | − | AM, AMC CF, CTX, GM, TE, K, SMZ |
| OW60C2 | Reuss | CTX-M-79 | >256 | >32 | S83L, D87N | S80I | E406A | − | − | − | AM, CF, CTX, TE, S, C, K, SMZ |
| OW60E2 | Reuss | CTX-M-15 | >256 | >32 | S83L, D87N | S80I | S458A | − | + | − | AM, AMC, CF, CTX, GM, TE, K, SMZ, TMP |
| OW77C1 | Goldach | CTX-M-15 | >256 | >32 | S83L, D87N | S80I | S458A | − | + | − | AM, CF, CTX, GM, C, K, SMZ, TMP |
| OW78E1 | Rotbach | CTX-M-15 | >256 | >32 | S83L, D87N | S80I | S458A | − | + | − | AM, AMC, CF, CTX, GM, TE, S, K, SMZ, TMP |
| OW80E1 | Katzensee | CTX-M-15 | >256 | >32 | S83L, D87N | S80I | S458A | − | + | − | AM, CF, CTX, GM, TE, C, K, SMZ, TMP |
) see Zurfluh et al. [10] for comparison.
AM, ampicillin; AMC, amoxicillin-clavulanic acid; CF, cephalothin; CTX, cefotaxime; CIP, ciprofloxacin; GM, gentamicin; TE, tetracycline; S, streptomycin; C, chloramphenicol; K, kanamycin; NA, nalidixic acid; SMZ, sulfamethoxazole; TMP, trimethoprim.
QRDR: quinolone resistance-determining regions; PMQR: plasmid-mediated quinolone resistance mechanisms.
Twenty isolates (48%) harbored plasmid-mediated quinolone resistance (PMQR) genes. Most frequently the aac-6′-Ib-cr gene 15/42 (36%) was found, followed by qnrS1 4/42 (10%) and qepA 1/42 (2%). The qnrA, qnrB, qnrC and qnrD genes were not detected in this study.
Intermediate resistance to NA was associated either with the presence of the plasmid-mediated resistance protein QnrS1 since in two strains (OW54E2 and OW60E1) chromosomal mutations and other PMQR determinants were absent, or with the presence of general efflux pumps.
Conjugation experiments revealed that two of the four qnrS1, three of five selected aac-6′-Ib-cr but not the qepA bearing plasmid were transferable to the recipient strain E. coli HK225.
Plasmid incompatibility typing of the transconjugants revealed that both the qnrS1 and aac-6′-Ib-cr genes were present on IncF plasmids. Furthermore, all transferred PMQR determinants were detected on the same plasmids as the bla ESBL genes. The contribution to FQ resistance of the plasmids bearing the PMQR determinates was measured by the difference in the MICs (NA and CIP) of the recipient strain (E. coli HK225) compared to the transconjugants. The effect on the resistance to NA was minimal since the MICs increased only 1-3-fold. However, the resistance to CIP increased by factors of 4 to 16 in the presence of PMQR determinant harboring plasmids (Table 3).
Table 3. Plasmid-mediated quinolone resistance mechanisms, replicon types of transferred plasmids and quinolone resistance levels of the transconjugants of selected E. coli isolates.
| Strain | Transferred gene | Replicon types | Etest MIC (µg/mL) [Fold-MIC increase vs. donor] | |
| NA | CIP | |||
| E. coli HK225 StrepRRifR | – | 4 | 0.023 | |
| TC_OW54E2 | qnrS1 | F | 12 [3] | 0.38 [16] |
| TC_ OW95E1 | qnrS1 | F | 8 [2] | 0.25 [10] |
| TC_OW8C2 | aac-6′-Ib-cr | F | 4 [1] | 0.094 [4] |
| TC_OW29E1 | aac-6′-Ib-cr | F | 6 [1.5] | 0.094 [4] |
| TC_OW77E1 | aac-6′-Ib-cr | F | 4 [1] | 0.094 [4] |
E. coli HK225 StrepRRifR, recipient strain resistant to streptomycin and rifamycin.
TC_OW54E2, transconjugant receiving the plasmid from the donor strain OW54E2.
In the presence of the efflux pump inhibitor PAβN, the MICs of NA decreased 4 to 32-fold. This finding confirmed that also efflux pump activity is involved in quinolone resistance (Table 4).
Table 4. MIC values of nalidixic acid in the presence and absence of Phe-Arg-β-naphthylamide in selected E. coli isolates.
| MIC Values (µg/mL) | Number of amino acid-relevant mutations | ||||||
| Isolate | NA | NA +PAβN | Fold-decrease | PMQR genes | gyrA | parC | parE |
| OW1E2 | 128 | 16 | 8 | qnrS1 | 1 | – | – |
| OW1C2 | >1024 | 64 | >16 | aac–6′-Ib-cr | 5 | 1 | 1 |
| OW3E1 | >1024 | 128 | >8 | – | 2 | 1 | – |
| OW8E1 | 512 | 16 | 32 | – | 1 | – | – |
| OW14E2 | >1024 | 256 | >4 | aac-6′-Ib-cr | 2 | 2 | – |
| OW54E1 | >1024 | 256 | >4 | qepA | 2 | 2 | – |
| OW54E2 | 32 | 2 | 16 | qnrS1 | – | – | – |
| OW55C1 | >1024 | 64 | >16 | aac-6′-Ib-cr | 2 | 1 | 1 |
| OW55E1 | >1024 | 128 | >8 | – | 1 | 1 | – |
| OW60E1 | 16 | 2 | 8 | qnrS1 | – | – | – |
| OW64E2 | 256 | 16 | 16 | – | 1 | – | – |
| OW65E2 | >1024 | 128 | >8 | – | 2 | 1 | – |
| OW77E1 | >1024 | 128 | >8 | aac-6′-Ib-cr | 2 | 2 | – |
| OW86E2 | >1024 | 128 | >8 | – | 2 | 1 | – |
| OW95E1 | 256 | 16 | 16 | qnrS1 | 2 | 2 | – |
| ATCC25922 | <1 | <1 | 1 | – | – | – | – |
Discussion
So far, there are only few studies that have investigated the occurrence of (fluoro)quinolone resistant Enterobacteriaceae in surface waters [15]–[18]. Rivers and lakes are known to be a relevant putative reservoir of multiresistant bacteria since they collect surface waters containing material from different origins, e.g., wastewater plants, water from urban or industrial effluents, agricultural activities, and they harbor an immense antibiotic resistome, distributed to pathogenic and nonpathogenic bacteria [19].
FQ resistance in E. coli is associated predominantly with DNA topoisomerase II (DNA gyrase) and topoisomerase IV involving specific mutations in the QRDRs of gyrA and parC genes [2]. A single mutation in the QRDR of gyrA seems to be sufficient to generate a high-level quinolone, and a double mutation even a high-level fluoroquinolone resistance phenotype [20]. It is supposed that these mutations occur in a stepwise manner [2]. The effect of these mutations may alter the formation of hydrogen bonds, and the negative charge of the amino acids seem to be important for quinolone interactions with the DNA-gyrase-DNA complex [21].
As in previous studies, we mainly detected the substitutions in terms of amino acid positions GyrA Ser83→Leu and GyrA Asp87→Asn, which are located within the QRDR. Interestingly, OW1C2, besides harboring a substitution at position GyrA Ser83→Val, contained additional substitutions at position 112, 127, 128 and 154. So far, these four substitutions have been found in a Raoultella planticola and a Klebsiella oxytoca isolate (except for position 154), as shown by sequence alignments using the NCBI BLASTP program (accession-numbers: BAN58234.1 and CAQ76691.1). Hitherto, very few studies have focused upon the role of amino acid substitutions outside the QRDR [22], hence little is known about their effect on resistance levels. Our finding suggests that in addition to the standard QRDR, additional sites in GyrA seem to play a role in FQ resistance. Further studies thus need to be conducted in order to further characterize the role of rare substituions in GyrA.
In clinical E. coli isolates, quinolone resistance is mainly associated with mutations in gyrA whereas mutations in the topoisomerase IV genes, parC and parE, play a secondary role [2]. To date, mutations within parC and parE are always linked to mutations in gyrA, and it is supposed that mutations within these genes only occur if the strain already posses a reduced sensitivity to fluoroquinolones by mutations in DNA gyrase. Therefore, additional mutations in parC and parE are supposed to play an important role in the formation of highly resistant strains [2], [23]. As many as 71% of the isolates described in this study, in addition to showing one to two substitutions in GyrA, harbored substitutions in ParC. Interestingly, the substitutions in ParC were found predominantly at position Ser80, which, apart from substitutions in GyrA, is one of the most common alterations in FQ-resistant clinical isolates [24]. This finding is suggestive of the anthropogenic origin of these strains that were isolated from the aquatic environment.
PMQR is a phenomenon of increasing importance. The most relevant PMQR genes known to date are the acetyltransferase gene aac(6′)-Ib-cr, the qnr-like genes and genes encoding efflux pumps, such as qepA [25], [26].
In the isolates described in this study, PMQR determinant aac(6′)-Ib-cr was the most prevalent (36%), followed by qnrS1 (10%) and qepA (2%). The relatively high prevalence of aac(6′)-Ib-cr is not surprising since several reports showed that this gene is often present on the same plasmid as bla ESBL [27], [28]. QnrS-producing strains were frequently described in aquatic environments, and - as shown by a study by Cattoir and Co-workers [29] - Vibrio splendidus, an aquatic Gram-negative bacteria, was identified as a possible source for qnrS-like genes. Interestingly, in a previous study by Picão et al. [30], a qnrS2 bearing Aeromonas allosaccharophila strain was isolated from Lake Lugano in the southern part of Switzerland. QnrS is found very rarely and only sporadically in clinical isolates in Europe [31]. Further, Liassine et al. [32] investigated human ESBL-producing Enterobacteriacae isolates for qnrA, qnrB and qnrS collected by a Swiss clinical microbiology laboratory. However, from 155 analyzed isolates, they found only qnrB4 (3 Citrobacter freundii, 1 Klebsiella pneumonia and 1 E. coli) and qnrB2 (1 E. coli). In contrast to our data, no qnrS variants were found in that study, indicating that qnrS is not characteristic for FQ-resistant human isolates in Switzerland.
Our conjugation experiments revealed that qnrS1, and aac-6′-Ib-cr harboring plasmids were transferable to FQ-susceptible strains. The resistance phenotypes of the resulting transconjugants confirmed previous observations that the contribution of PMQR determinants to fluoroquinolone resistance levels of the plasmid-bearing strains is minor compared with the chromosomal mutations in DNA gyrase. The proposed role of these genes is that they enhance resistance to fluoroquinolones, supplementing chromosomal resistance genes [33]. Poor transfer of qnrS-encoding plasmids is confirmative of a previous study describing a qnrS-harboring clinical E. coli isolate [31]. Nevertheless, our results demonstrate that qnrS determinants are indeed transferable and capable of conferring very low level resistance, also in the absence of chromosomally-encoded (F)Q-resistance determinants.
Replicon typing of the transconjugants revealed that both qnrS1 and aac-6′-Ib-cr are present on IncF plasmids. Additionally, the genes coding for ESBL were detected on the same plasmids. CTX-M-15, the most prevalent CTX-M-type isolated from water bodies in Switzerland, is often associated with aac(6′)-Ib-cr resistance genes and has been located frequently on IncF group plasmids [34]. IncF type plasmids carrying CTX-M-15 are an inhomogeneous group of plasmids with sizes that vary between 50–200 kb and often carry more than one replicon (e.g., repFII, repFIA and/or repFIB) [34]. This multi-replicon plasmid-genotype was also observed in our study.
Besides chromosomal mutations and PMQR determinants, efflux pumps can also contribute in a more unspecific way to the (F)Q resistance phenotype. The effect of members of the resistance-nodulation-division (RND) family of membrane transporters can be investigated by inhibiting them with PAβN [35], [36]. In this study, the MICs of NA decreased 4 to 32-fold in the presence of the inhibitor, which clearly confirmed that these efflux pumps play an important role in quinolone resistance. Sáenz et al. [36] could already show that a single amino acid exchange in GyrA was not enough to confer a high level NA resistance phenotype in E. coli.
Recently, Sato et al. [37] investigated an E. coli isolate whose MICs of CIP, levofloxacin and norfloxacin exceeded the respective CLSI breakpoints, although it had no mutations in the QRDRs of either DNA gyrase or topoisomerase. The conclusion of their study was that FQ resistance can also arise due to concomitant acquisition of several PMQR determinates (in their study: QnrS1 and OqxAB, in combination with overexpression of acrAB-TolC and other chromosome-encoded efflux pumps). Our study yielded no isolate of this kind.
In summary, the acquisition of a high-level (F)Q resistance phenotype often includes combination of multiple mechanisms such as acquisition of mutations in DNA gyrase and topoisomerase genes as well as enhanced efflux and these processes can be accelerated by the presence of PMQR-determinants [2]. Our findings suggest that this holds true also for our FQ-resistant strains isolated from the aquatic environment.
It is possible that as a consequence of excretion of unmetabolized quinolones into wastewater by humans and animals, the environmental quinolone accumulation has contributed to the high prevalence of quinolone resistant E. coli in the water environment [9], [38].
This study provides further evidence for the importance of the water-related environment as a reservoir for this emerging threat of FQ resistance. Moreover, the resistance characteristics of the isolates described in this study indicate that multilateral exchange of genetic material between bacteria of both anthropogenic and environmental origins is currently occurring and presents a phenomenon of growing importance. It is, finally, worrisome that more than two thirds of ESBL producers carry resistance determinants against (F)Qs, thus defying the two currently most popular antibiotic options for human therapy, β-lactams and FQs.
Funding Statement
The authors thank the Swiss Federal Office for Public Health, Division Communicable Diseases, for partial financial support. No additional funding received for this study. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Jacoby GA (2005) Mechanisms of resistance to quinolones. Clin Infec Dis 41: S120–S126. [DOI] [PubMed] [Google Scholar]
- 2. Hopkins KL, Davies RH, Threlfall EJ (2005) Mechanisms of quinolone resistance in Escherichia coli and Salmonella: Recent developments. Int J Antimicrob Agents 25: 358–373. [DOI] [PubMed] [Google Scholar]
- 3. Martínez-Martínez L, Pascual A, Jacoby GA (1998) Quinolone resistance from a transferable plasmid. THE LANCET 351: 797–799. [DOI] [PubMed] [Google Scholar]
- 4. Hata M, Suzuki M, Matsumoto M, Takahashi M, Sato K, et al. (2005) Cloning of a novel gene for quinolone resistance from a transferable plasmid in Shigella flexneri 2b. Antimicrob Agents Chemother 49: 801–803. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Jacoby GA, Walsh KE, Mills DM, Walker VJ, Oh H, et al. (2006) qnrB, another plasmid-mediated gene for quinolone resistance. Antimicrob Agents Chemother 50: 1178–1182. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Wang M, Guo Q, Xu X, Wang X, Ye X, et al. (2009) New plasmid-mediated quinolone resistance gene, qnrC, found in a clinical isolate of Proteus mirabilis . Antimicrob Agents Chemother 53: 1892–1897. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Cavaco LM, Hasman H, Xia S, Aarestrup FM (2009) qnrD, a novel gene conferring transferable quinolone resistance in Salmonella enterica serovar Kentucky and Bovismorbificans strains of human origin. Antimicrob Agents Chemother 53: 603–608. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Robicsek A, Strahilevitz J, Jacoby GA, Macielag M, Abbanat D, et al. (2006) Fluoroquinolone-modifying enzyme: a new adaptation of a common aminoglycoside acetyltransferase. Nat Med 12: 83–88. [DOI] [PubMed] [Google Scholar]
- 9. Strahilevitz J, Jacoby GA, Hooper DC, Robicsek A (2009) Plasmid-mediated quinolone resistance: a multifaceted threat. Clin Microbiol Rev 22: 664–689. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Zurfluh K, Hächler H, Nüesch-Inderbinen M, Stephan R (2013) Characteristics of extended-spectrum β-Lactamase- and carbapenemase-producing Enterobacteriaceae isolates from rivers and lakes in Switzerland. Appl Environ Microbiol 79: 3021–3026. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Finley RL, Collignon P, Larsson DGJ, McEwen S a, Li X-Z, et al. (2013) The scourge of antibiotic resistance: The Important Role of the Environment. Clin Infect Dis 57: 704–710. [DOI] [PubMed] [Google Scholar]
- 12.Clinical and Laboratory Standards Institute (2011) Performance standards for antimicrobial susceptibility testing; twenty-first informational supplement, CLSI document M100-S21. Clinical and Laboratory Standards Institute, Wayne PA.
- 13. Kayser FH, Morenzoni G, Homberger F (1982) Activity of cefoperazone against ampicillin-resistant bacteria in agar and broth dilution tests. Antimicrob Agents Chemother 22: 15–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Carattoli A, Bertini A, Villa L, Falbo V, Hopkins KL, et al. (2005) Identification of plasmids by PCR-based replicon typing J Microbiol Methods. 63: 219–228. [DOI] [PubMed] [Google Scholar]
- 15. Rizzo L, Fiorentino A, Anselmo A (2012) Effect of solar radiation on multidrug resistant E. coli strains and antibiotic mixture photodegradation in wastewater polluted stream. Sci Total Environ 427–428: 263–268. [DOI] [PubMed] [Google Scholar]
- 16. Dhanji H, Murphy NM, Akhigbe C, Doumith M, Hope R, et al. (2011) Isolation of fluoroquinolone-resistant O25b: H4-ST131 Escherichia coli with CTX-M-14 extended-spectrum β-lactamase from UK river water. J Antimicrob Chemother 66: 512–516. [DOI] [PubMed] [Google Scholar]
- 17. Colomer-Lluch M, Mora A, Lopez C, Mamani R, Dahbi G, et al. (2013) Detection of quinolone-resistant Escherichia coli isolates belonging to clonal groups O25b: H4-B2-ST131 and O25b: H4-D-ST69 in raw sewage and river water in Barcelona, Spain. J Antimicrob Chemother 68: 758–765. [DOI] [PubMed] [Google Scholar]
- 18. Sun J, Hu J, Peng H, Shi J, Dong Z (2012) Molecular and physiological characterization of fluoroquinolone resistance in relation to uropathogenicity among Escherichia coli isolates isolated from Wenyu River, China. Chemosphere 87: 37–42. [DOI] [PubMed] [Google Scholar]
- 19. Lupo A, Coyne S, Berendonk TU (2012) Origin and evolution of antibiotic resistance: the common mechanisms of emergence and spread in water bodies. Front Microbiol 3: 1–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Vila J, Ruiz J, Marco F, Barcelo A, Goñi P, et al. (1994) Association between Double Mutation in gyrA Gene of Ciprofloxacin-Resistant Clinical Isolates of Escherichia coli and MICs. Antimicrob Agents Chemother 38: 2477–2479. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Sáenz Y, Zarazaga M, Briñas L, Ruiz-Larrea F, Torres C (2003) Mutations in gyrA and parC genes in nalidixic acid-resistant Escherichia coli strains from food products, humans and animals. J Antimicrob Chemother 51: 1001–1005. [DOI] [PubMed] [Google Scholar]
- 22. Friedman SM, Lu T, Drlica K (2001) Mutation in the DNA gyrase A gene of Escherichia coli that expands the quinolone resistance-determining region. Antimicrob Agents Chemother 45: 2378–2380. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Heisig P (1996) Genetic evidence for a role of parC mutations in development of high-level fluoroquinolone resistance in Escherichia coli . Antimicrob Agents Chemother 40: 879–885. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Ruiz J (2003) Mechanisms of resistance to quinolones: target alterations, decreased accumulation and DNA gyrase protection. J Antimicrob Chemother 51: 1109–17. [DOI] [PubMed] [Google Scholar]
- 25. Rodríguez-Martínez JM, Cano ME, Velasco C, Martínez-Martínez L, Pascual A (2011) Plasmid-mediated quinolone resistance: an update. J Infect Chemother 17: 149–182. [DOI] [PubMed] [Google Scholar]
- 26. Yamane K, Wachino J, Suzuki S, Kimura K, Shibata N, et al. (2007) New plasmid-mediated fluoroquinolone efflux pump, QepA, found in an Escherichia coli clinical isolate. Antimicrob Agents Chemother 51: 3354–3360. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Coque TM, Novais Â, Carattoli A, Poirel L, Pitout J, et al. (2008) Dissemination of clonally related Escherichia coli strains expressing extended-spectrum β-Lactamase CTX-M-15. Emerging Infect Dis 14: 195–200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Pitout JDD, Wei Y, Church DL, Gregson DB (2008) Surveillance for plasmid-mediated quinolone resistance determinants in Enterobacteriaceae within the Calgary Health Region, Canada: the emergence of aac(6′)-Ib-cr . J Antimicrob Chemother 61: 999–1002. [DOI] [PubMed] [Google Scholar]
- 29. Cattoir V, Poirel L, Mazel D, Soussy C-J, Nordmann P (2007) Vibrio splendidus as the source of plasmid-mediated QnrS-like quinolone resistance determinants. Antimicrob Agents Chemother 51: 2650–2651. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Picão RC, Poirel L, Demarta A, Silva CSF, Corvaglia AR, et al. (2008) Plasmid-mediated quinolone resistance in Aeromonas allosaccharophila recovered from a Swiss lake. J Antimicrob Chemother 62: 948–950. [DOI] [PubMed] [Google Scholar]
- 31. Cavaco LM, Hansen DS, Friis-Møller A, Aarestrup FM, Hasman H, et al. (2007) First detection of plasmid-mediated quinolone resistance (qnrA and qnrS) in Escherichia coli strains isolated from humans in Scandinavia. J Antimicrob Chemother 59: 804–805. [DOI] [PubMed] [Google Scholar]
- 32. Liassine N, Zulueta-Rodriguez P, Corbel C, Lascols C, Soussy C-J, et al. (2008) First detection of plasmid-mediated quinolone resistance in the community setting and in hospitalized patients in Switzerland. J Antimicrob Chemother 62: 1151–1152. [DOI] [PubMed] [Google Scholar]
- 33. Briales A, Rodríguez-Martínez JM, Velasco C, Díaz de Alba P, Domínguez-Herrera J, et al. (2011) In vitro effect of qnrA1, qnrB1, and qnrS1 genes on gluoroquinolone activity against isogenic Escherichia coli isolates with mutations in gyrA and parC . Antimicrob Agents Chemother 55: 1266–1269. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Carattoli A (2009) Resistance plasmid families in Enterobacteriaceae . Antimicrob Agents Chemother 53: 2227–2238. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Karczmarczyk M, Martins M, Quinn T, Leonard N, Fanning S (2011) Mechanisms of fluoroquinolone resistance in Escherichia coli isolates from food-producing animals. Appl Environ Microbiol 77: 7113–7120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Sáenz Y, Ruiz J, Zarazaga M, Teixidó M, Torres C, et al. (2004) Effect of the efflux pump inhibitor Phe-Arg-beta-naphthylamide on the MIC values of the quinolones, tetracycline and chloramphenicol, in Escherichia coli isolates of different origin. J Antimicrob Chemother 53: 544–545. [DOI] [PubMed] [Google Scholar]
- 37. Sato T, Yokota S, Uchida I, Okubo T, Usui M, et al. (2013) Fluoroquinolone resistance mechanisms in an Escherichia coli isolate, HUE1, without quinolone resistance-determining region mutations. Front Microbiol 4: 1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Poirel L, Cattoir V, Nordmann P (2012) Plasmid-mediated quinolone resistance; interactions between human, animal, and environmental ecologies. Front Microbiol 3: 1–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Cattoir V, Poirel L, Rotimi V, Soussy C, Nordmann P (2007) Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr genes in ESBL-producing enterobacterial isolates. J Antimicrob Chemother 60: 394–397. [DOI] [PubMed] [Google Scholar]
- 40. Robicsek A, Strahilevitz J, Sahm DF, Jacoby GA, Hooper DC (2006) qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob Agents Chemother 50: 2872–2874. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Kim HB, Park CH, Kim CJ, Kim E, Jacoby GA, et al. (2009) Prevalence of plasmid-mediated quinolone resistance determinants over a 9-year period. Antimicrob Agents Chemother 53: 639–645. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Park CH, Robicsek A, Jacoby GA, Sahm D, Hooper DC (2006) Prevalence in the United States of aac(6′)-Ib-cr encoding a ciprofloxacin-modifying enzyme. Antimicrob Agents Chemother 50: 3953–3955. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Karczmarczyk M, Martins M, McCusker M, Mattar S, Amaral L, et al. (2010) Characterization of antimicrobial resistance in Salmonella enterica food and animal isolates from Colombia: identification of a qnrB19-mediated quinolone resistance marker in two novel serovars. FEMS Microbiol Lett 313: 10–19. [DOI] [PubMed] [Google Scholar]
- 44. Fendukly F, Karlsson I, Hanson HS, Kronvall G, Dornbusch K (2003) Patterns of mutations in target genes in septicemia isolates of Escherichia coli and Klebsiella pneumoniae with resistance or reduced susceptibility to ciprofloxacin. APMIS 111: 857–866. [DOI] [PubMed] [Google Scholar]