Abstract
Dopamine not only is a precursor of the catecholamines noradrenaline and adrenaline but also serves as an independent neurotransmitter and paracrine hormone. It plays an important role in the pathogenesis of hypertension and is a potent vasodilator in many mammalian systemic arteries, strongly suggesting an endogenous source of dopamine in the vascular wall. Here we demonstrated dopamine, noradrenaline and adrenaline in rat aorta and superior mesenteric arteries (SMA) by radioimmunoassay. Chemical sympathectomy with 6-hydroxydopamine showed a significant reduction of noradrenaline and adrenaline, while dopamine levels remained unaffected. Isolated endothelial cells were able to synthesize and release dopamine upon cAMP stimulation. Consistent with these data, mRNAs coding for catecholamine synthesizing enzymes, i.e. tyrosine hydroxylase (TH), aromatic l-amino acid decarboxylase, and dopamine-β-hydroxylase were detected by RT-PCR in cultured endothelial cells from SMA. TH protein was detected by immunohistochemisty and Western blot. Exposure of endothelial cells to hypoxia (1% O2) increased TH mRNA. Vascular smooth muscle cells partially expressed catecholaminergic traits. A physiological role of endogenous vascular dopamine was shown in SMA, where D1 dopamine receptor blockade abrogated hypoxic vasodilatation. Experiments on SMA with endothelial denudation revealed a significant contribution of the endothelium, although subendothelial dopamine release dominated. From these results we conclude that endothelial cells and cells of the underlying vascular wall synthesize and release dopamine in an oxygen-regulated manner. In the splanchnic vasculature, this intrinsic non-neuronal dopamine is the dominating vasodilator released upon lowering of oxygen tension.
Introduction
The maintenance of oxygen supply plays a crucial role in the homeostasis of multicellular organisms. Low oxygen tension (hypoxia) is a primary factor in the pathophysiology of many severe diseases like stroke (cerebral ischaemia), heart infarction (myocardial ischaemia) or pulmonary hypertension (Burke & Virmani, 2007; Saeed et al. 2007; Zeng et al. 2007). Modulation of the vascular tone is a very effective way to maintain oxygen supply for tissues and organs. Although it is well established that hypoxia does alter vascular tone, the contractile responses of vascular segments are different: The pulmonary circulation constricts in response to a fall in oxygen while systemic vascular regions respond with a compensatory vasodilatation that restores oxygen supply (Yuan et al. 1990). The mechanisms underlying the hypoxia-induced vasodilatation are currently not fully understood. Proposed modes of action include the release of vasoactive peptides from the calcitonin gene-related peptide and the natriuretic peptide families (Brain & Grant, 2004; Suttner & Boldt, 2004), the release of vasodilatory substances such as nitric oxide (Lundberg & Weitzberg, 2005) or prostanoids (Gupte et al. 2004) from endothelial cells and erythrocytes, and the production of vasodilatory metabolites like adenosine by cardiac myocytes (Shyrock & Belardinelli, 1997).
In this study we identified dopamine as a novel intrinsic vasodilator in the arterial wall. Classically, dopamine is considered as a neurotransmitter and a signalling molecule produced by paraganglia (Kummer & Neuhuber, 1989; Villanueva et al. 2003). Non-neuronal synthesis and release of dopamine has previously been shown for the gastrointestinal tract, spleen and pancreas. In these systems, dopamine is involved in modulation of ion transport, mucosal blood flow and inhibition of gut motility (Galvin & Szabo 1990; Mezey et al. 1999). Stress-inducible synthesis of noradrenaline and adrenaline was shown by Kvetnansky et al. (2012) in rat adipocytes, supposing a role of non-neuronal catecholamines in lipolysis or other metabolic processes. As a member of the catecholamine family, dopamine is not only a precursor of adrenaline (epinephrine) and noradrenaline (norepinephrine) in their biosynthetic pathways (Weiss & Rossi, 1963) but also an independent neurotransmitter (Dunnett et al. 2005) and paracrine hormone (Mezey et al. 1999; DiMarco et al. 2007; Pacheco et al. 2009) acting upon dopamine-specific G-protein coupled receptors D1–D5 (Hartman & Lanau, 1997). Dopamine is synthesized first by hydroxylation of the amino acid tyrosine to l-DOPA by tyrosine hydroxylase (TH) and then by decarboxylation of l-DOPA by aromatic l-amino-acid decarboxylase (AADC) (Weiss & Rossi, 1963). It can be further hydroxylated to noradrenaline by dopamine-β-hydroxylase (DβH), and subsequent N-methylation by phenylethanolamine-N-methyltransferase (PNMT) yields adrenaline. Dopamine plays an important role in the pathogenesis of hypertension (Zeng et al. 2007) and is a potent vasodilator in many mammalian systemic arteries (Bell & Lang, 1979; Toda, 1983; Yamauchi et al. 1992; Huemer et al. 2003), strongly suggesting an endogenous source of dopamine in the vascular wall.
Here, we investigated a potential dopaminergic system in the arterial wall and demonstrate that at least the bulk of vascular dopamine is not derived from noradrenergic nerve fibres but from non-neuronal cells such as endothelial cells. Expression of the synthesizing enzyme, TH, is upregulated by hypoxia, and intrinsic vascular dopamine fully accounts for the vasorelaxation of precontracted rat superior mesenteric arteries (SMA) in response to lowering of
.
Methods
Ethical approval
All experiments were conducted in accordance with European Directive for the Protection of Vertebrate Animals Used for Experimental and Other Scientific Purposes (86/609/EU), the relevant Guidelines of the Czech Ministry of Agriculture for scientific experimentation on animals, and were approved by the University Committee for Experiments on Laboratory Animals (Charles University, Czech Republic).
Animals
All animal experiments comply with the policies and regulation as demanded by The Journal of Physiology. For sympathectomy experiments, a total of 50 newborn Wistar rats were used. Pups were randomly divided into two groups on the day of birth, designated as postnatal day 0 (PD0). The first group (6-hydroxydopamine, 6-OHDA) received subcutaneously 6-OHDA (100 mg kg−1) on PD1–7, 14, 21, and 28. The control group received equal volumes of solvent at the same time points. Before weaning (3 weeks after birth), 7–9 pups were kept with one nursing dam and then the animals were housed five per cage, fed standard laboratory chow ad libitum and with free access to drinking water. All rats were used for further experiments at the ages of 40, 60 and 90 postnatal days. Rats were anaesthetized in an exsiccator with ethyl ether and killed by decapitation
Extraction and measurement of noradrenaline, adrenaline and dopamine
Aortae and mesenteric arteries were excised, rinsed with ice-cold saline and freed of connective tissue and fat. Immediately after dissection, the tissues were frozen on dry ice and weighed. Noradrenaline, adrenaline and dopamine were extracted from the vessels by homogenization in 10 volumes of 0.01 mol l−1 HCl and subsequent centrifugation (10,000 g, 4°C, 20 min). Noradrenaline, adrenaline and dopamine concentrations were determined simultaneously using commercial kits manufactured by Immuno Biological Laboratories (Hamburg, Germany). The primary antibodies for the assays were raised against acylated derivatives of normetanephrine, metanephrine, and methoxytyramine. After extraction, catecholamines were acylated and methylated, mixed with the appropriate antigen labelled with 125I and the respective antiserum. Samples were incubated overnight at 4°C. On the following day, precipitating antiserum was added and after vortexing, incubation, and centrifugation, supernatants were removed and bound radioactivity was counted in a gamma counter. Recovery was assessed by addition of known amount of noradrenaline (norepinephrine), adrenaline (epinephrine) and dopamine to tissue extracts before radioimmuniassay (RIA) extraction procedure (n = 5). About 90% of added exogenous noradrenaline, adrenaline and dopamine could be detected in the final extract. Results were not corrected for recovery. Intra-and inter-assay variations did not exceed 12% and 15%, respectively.
Cell culture
Primary rat SMA endothelial cells were purchased from Cell Biologics (Chicago, USA). The cells were cultured in animal endothelial cell medium (M1266, Cell Biologics) on gelatine coated flasks (0.2%) as recommended by the manufacturer. Porcine endothelial cells were isolated from pulmonary arteries taken from the slaughterhouse. The arteries were dissected and washed with prewarmed Hank's Balanced Salt Solution (HBSS; Life Technologies; Darmstadt, Germany). One end of the artery was closed with a ligature, the artery filled with 0.5% collagenase II in M199 (PAA) and incubated for 1 h at 37°C. Detached endothelial cells were collected by centrifugation and resuspended/cultured in Endothelial Cell Growth Medium MV (PromoCell, Heidelberg, Germany). To isolate smooth muscle cells, the rats were killed by inhalation of isoflurane. The aorta was removed and placed in ice-cold DMEM medium (Invitrogen, Karlsruhe, Germany). The aorta was then opened longitudinally and the endothelium was abraded with a sterile cotton wrap. The opened aorta was cut into pieces, 1–2 mm in size, placed in a 24-well plate and incubated in Smooth Muscle Growth Medium (Invitrogen). After 4–6 days, smooth muscle cells start to migrate out of the graft.
Immunofluorescence
For SMA–TH immunofluorescence, rats were killed by inhalation of an overdose of isoflurane (Baxter, Unterschleißheim, Germany). SMAs were prepared and fixed in 4% paraformaldehyde (PFA). Non-specific protein binding sites were saturated with 10% horse serum. Primary rabbit monoclonal antibody against TH (Clone: EP 1533Y, Epitomics, Burlingame, USA) was applied in a 1:400 dilution for 12 h at room temperature. Cy3-conjugated anti-rabbit Ig antibody from donkey (1:100, Merck Millipore, Billerica, USA) served as secondary antibody. Smooth muscle cells were characterized by immunolabelling of α-smooth muscle actin with FITC-conjugated mouse monoclonal anti-smooth muscle actin antibody diluted 1:500 (Clone 1A4; Sigma, Taufkirchen, Germany). For nuclear labelling, cells were incubated with 4′,6-diamino-2-phenylindole dihydrochloride (DAPI; 1 mg ml−1 Sigma, 1:5000 diluted in PBS).
DiI-labelled acetylated low-density lipoprotein uptake
Endothelial cells were incubated with DiI-labelled acetylated low-density lipoprotein in 8-well cell culture slides (NUNC, New York, USA), at a concentration of 10 μg ml−1 at 37°C for 4 h. After washing with cell growth medium and subsequent PBS, the cells were fixed with 4% PFA.
Western blot
For Western blot analysis, rat adrenal gland and SMA was homogenized in 250 μl 2 × Laemmli buffer, boiled for 5 min at 100°C, and centrifuged for 5 min at 14,000 rpm. One microlitre of adrenal gland supernatant and 25 μl of SMA supernatant were subjected to 7.5% SDS-PAGE under reducing conditions. Protein was transferred to PVDF membrane (Immobilon-P; Millipore, Bedford, MA, USA) by semidry blotting. Subsequently, the membrane was washed in 25 mm Tris-buffered saline with 0.05% Tween-20 (TTBS) for 5 min. Blocking of unspecific binding sites was done by incubating the membrane in 10% non-fat dry milk in TTBS for 4 h. Primary rabbit monoclonal TH antibody (Clone: EP 1533Y, Epitomics, Burlingame, USA) was diluted 1:2000 in 5% non-fat dry milk in TTBS. Incubation was for 14 h at room temperature. Horseradish peroxidase (HRP)-conjugated anti-rabbit IgG from goat (1:10,000 in 2.5% non-fat dry milk in TTBS, 1 h at room temperature; Thermo Scientific, Rockford, IL, USA) was used as a secondary antibody, and SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific) for detection of HRP. Negative control was done by omitting the first antibody.
Vasoregulation
Rats were decapitated after anaesthesia with ether. The abdominal wall was opened and the small intestine with the mesentery was removed. Second-order vessels from mesenteric arcade were freed under a stereoscopic microscope from surrounding adipose and connective tissue. Arterial segments, 3–6 mm in length, were used for the experiments. External vessel diameter was microscopically recorded from the internally perfused rat SMA placed in a superfusion chamber as described previously (Hermsteiner et al. 1999). Drugs were administered from the luminal side via the perfusion solution. In the open system,
of the medium was lowered from room air conditions (160 mmHg) to 135 and 55 mmHg by gassing the chamber with nitrogen. Endothelial denudation was done by rubbing inside the vessel with a hair.
Transmission electron microscopy
Arteries were fixed by immersion in phosphate-buffered fixative containing 2% paraformaldehyde and 1.5% glutaraldehyde, subsequently washed, osmicated (1% OsO4), stained en bloc with uranyl acetate (1% in 0.05 m maleate buffer, pH 6.0), dehydrated in an ascending ethanol series and finally embedded in epoxy resin. Ultrathin sections were cut with an ultramicrotome, stained with lead citrate and uranyl acetate and viewed with an EM902 transmission electron microscope (Zeiss, Oberkochen, Germany).
RNA isolation and real-time RT-PCR
Total RNA was isolated using RNeasy mini kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol. Genomic DNA was degraded by DNase treatment (1 U DNase μg–1 RNA; Invitrogen, Karlsruhe, Germany). Superscript RNase H− reverse transcriptase (200 U μg−1 RNA; Invitrogen) was used for reverse transcription. RT controls were prepared by omitting the reverse transcriptase during sample setup. Real-time quantitative PCR was performed using the I-cycler IQ detection system (Bio-Rad, Munich, Germany) as described (Pfeil et al. 2006). The relative expression was calculated as: 2−(ΔCT hypoxic sample) × 1/2−(ΔCT mean: housekeeping gene), where ΔCT is: ΔCT = CTGOI-CTHKG (CT, Cycle Threshold, GOI, gene of interest, HKG, housekeeping gene). Primer sequences are indicated in Table 1. The PCR products were analysed by electrophoresis on a 2% Tris-acetate–EDTA agarose gel.
Table 1.
Primers used for RT-PCR
| Gene | Sequence | Product length | Accession no. |
|---|---|---|---|
| β-Actin | Forward: CAACCTTCTTGCAGCTCCTC | 253 bp | NM031144 |
| Reverse: AGGGTCAGGATGCCTCTCTT | (30–283) | ||
| β2-MG | Forward: TGTCTCAGTTCCACCCACC | 191 bp | NM012512 |
| Reverse: GGGCTCCTTCAGAGTGACG | (147–338) | ||
| TH | Forward: ACGTCCCCAAGGTTCATC | 215 bp | NM012740 |
| Reverse: TACAGCCCGAGACAAGGA | (99–314) | ||
| AADC | Forward: AGAGGGAAGGAGATGGTGGA | 220 bp | NM012545 |
| Reverse: GTGGGGAAGTAAGCGAAGAAGT | (103–323) | ||
| DβH | Forward: AGCCCCTTCCCTTACCACA | 161 bp | NM013158 |
| Reverse: TGCGTTCTCCATCTCACCTC | (148–309) | ||
| PNMT | Forward: GCGAGGGTGAAGCGAGTC | 105 bp | NM031526 |
| Reverse: GGCAGAAGGCAGAGACCAAG | (468–573) | ||
| eNOS | Forward: GTGGATTTGCTGCTCTGTAGG | 163 bp | NM021838 |
| Reverse: CGAGATATCTTCAGTCCCAAGC | (2164–2327) |
β2-MG, β2-microglobulin; TH, tyrosine hydroxylase; AADC, aromatic l-amino acid decarboxylase; DβH, dopamine β-hydroxylase; PNMT, phenylethanolamine N-methyltransferase; eNOS, endothelial nitric oxide synthase.
Statistical analysis
Differences in arterial catecholamine concentrations were first tested for normality of populations and homogeneity of variances, and then subjected to ANOVA followed by post hoc Fisher's least significant difference test. All other data are presented as box plots and were analysed by non-parametric rank sum tests (Kruskal–Wallis for k > 2 groups, Mann–Whitney for k = 2 groups).
Results
Dopamine is produced in splanchnic vessels
Dopamine, noradrenaline and adrenaline concentrations were measured by radioimmunoassay (RIA) in rat aortae from postnatal day (PD) 2 to PD90 and in superior mesenteric arteries (SMA) from PD40 to PD90. In the aorta, concentrations of all these catecholamines were highest at PD2 and fell to about 10% of initial values by PD40. Throughout, noradrenaline was the predominant catecholamine followed by dopamine and adrenaline. At PD40 to PD90, catecholamine concentrations were markedly higher in SMA as compared to aorta. Noradenaline concentrations in SMA exceeded that of aorta by about 25-fold (PD60 to PD90), whereas dopamine and adrenaline concentrations were about 6-and 2-fold higher, respectively (Fig. 1). To evaluate how much of these catecholamines is contained in sympathetic nerve fibres, rats were subjected to chemical sympathectomy by repeated (PD1–7, 14, 21, and 28) subcutaneous injections of the sympathetic neurotoxin, 6-hydroxydopamine (6-OHDA, 100 mg kg−1). Twelve days later, i.e. PD40, both noradrenaline and adrenaline levels were significantly reduced in aortae (Fig. 2A) and SMA (Fig. 2B) to 20–30% of controls and remained at this level for another 20 days. Due to nerve regeneration, noradrenaline and adrenaline concentrations returned to 70% of control at PD90. Dopamine levels, however, were not significantly affected during the entire period (Fig. 2A and B).
Figure 1. Catecholamine concentrations in the rat aorta and SMA in postnatal development.

Catecholamine concentrations in rat aorta from postnatal day (PD) 2 to PD90 and in rat SMA from PD40 to PD90. Data are presented as means ± SEM; n = 12 for aorta PD2, 8 for aorta PD7, 7 for aorta PD10–90, and 6 for SMA PD40–90.
Figure 2. Arterial dopamine is of non-neuronal origin.

Catecholamine concentrations (means ± SEM, expressed as percentage of age-matched control) in the rat aorta (A) and SMA (B) after destruction of sympathetic axons by repeated injections of the neurotoxin, 6-OHDA, until day 28. In contrast to noradrenaline (▪; #P < 0.05 compared to age-matched control; ANOVA with Fisher's post hoc test) and adrenaline (•; *P < 0.05 compared to day 10), dopamine (Δ) is not affected. n = 9 for aorta PD10, 7 for aorta PD20–90, and 6 throughout for SMA.
Endothelial cells synthesize and release dopamine
Endothelial cells were isolated from the porcine pulmonary trunk. When cultured in the absence of inhibitors of the catecholamine metabolizing enzyme monoamine oxidase, dopamine was detectable in the endothelial cells but not in the culture medium supernatant (authors’ unpublished data). In the presence of the monoamine oxidase inhibitor pargyline (10 μm), dopamine was detectable both in the endothelial cells (13.7 ± 11.4 pg mg−1; mean ± SEM, n = 5, Fig. 3A) and in supernatants (1.1 ± 0.6 pg ml−1; mean ± SEM, n = 10, Fig. 3B). Noradrenaline and adrenaline were found in the supernatants while in endothelial cells, their concentrations fell below the sensitivity limit of the method in two of three samples.
Figure 3. Endothelial cells produce catecholamines and their synthesizing enzymes in a regulated fashion.

Dopamine (DA) content of porcine pulmonary trunk endothelial cells (A) and release into the culture supernatant (B) were enhanced by db-cAMP. Noradrenaline (NA) and adrenaline (Ad) were detected only in supernatants and were not regulated (B). Box plots show all quartiles from 0 to 100, small open circle depicts data beyond 3 × SD; *P < 0.05.
To exclude the possibility of an exogenous uptake of dopamine prior to cell isolation we sought to stimulate de novo synthesis of dopamine in cultured endothelial cells. To this end, we treated cultured porcine pulmonary trunk endothelial cells for 6 h with the cell-permeable cAMP analogue dibutyryl-cAMP (1 mm) in the presence of pargyline (to prevent degradation by monoamine oxidase), resulting in a 6-fold increase in intracellular dopamine (Fig. 3A) and a 22-fold increase in dopamine concentration in the culture supernatant (Fig. 3B). Noradrenaline and adrenaline concentrations in the supernatants were not affected by treatment with db-cAMP (Fig. 3B).
Catecholamine synthesizing enzymes are expressed by endothelial cells from SMA
Messenger RNAs coding for TH, AADC, and DβH, but not PNMT were detected by RT-PCR in cultured endothelial cells from rat mesenteric artery (Fig. 4A). Exposure of rat mesenteric artery endothelial cells to 1% oxygen caused a 3.4-fold increase of TH mRNA after 16 h of incubation (Fig. 4B). Endothelial cells were characterized by their ability to express the mRNA for endothelial nitric oxide synthase (eNOS; Fig. 4A) and uptake of DiI-labelled acetylated low-density lipoprotein (Fig. 4C). Additionally, the rate-limiting enzyme of catecholamine synthesis, i.e. TH, was also demonstrated in endothelial cells of dissected rat SMA by immunostaining (Fig. 5A). Western blot analysis showed a specific band of about 60 kDa in SMA and adrenal gland (Fig. 5B).
Figure 4. Superior mesenteric artery endothelial cells express mRNA for catecholamine synthesizing enzymes.

A, cultured primary SMA endothelial cells express mRNA for TH, AADC, and DβH. Control runs without reverse transcriptase (–RT) and without template (H2O) were negative. Treatment of rat SMA endothelial cells with hypoxia (1% oxygen) caused a 3.4-fold increase in TH mRNA expression after 16 h of incubation. N = normoxia, H = hypoxia. B, box plots show all quartiles from 0 to 100, *P < 0.05, Mann–Whitney rank sum test, n = 4 in each group. Endothelial cells were characterized by their ability to express endothelial nitrite oxide synthase mRNA (eNOS, A) and uptake of DiI-labelled acetylated low density lipoprotein. C, cell nuclei were counterstained with DAPI (scale bar = 20 μm).
Figure 5. Superior mesenteric artery express TH protein.

A, TH protein was detected by immunohistochemistry in endothelial cells (arrowheads) in sections of rat superior mesenteric arteries. l = lumen, m = media, a = adventitia, bar = 50 μm. B, Western blot analysis showed a single band of about 60 kDa in rat SMA. Adrenal gland served as positive control. Control runs omitting the first antibody were negative.
Dopamine fully accounts for oxygen-dependent vasorelaxation in the rat SMA
Freshly dissected SMAs were mounted on and perfused through glass capillary tubes in a superfusion chamber, and the external diameter was microscopically recorded. Two examples of original recordings of these experiments were shown in Fig. 6A and B. To observe a potential vasodilatory effect, SMAs were pre-contracted with the thromboxane analogue U46619 at a concentration (5.9 × 10−7 mol l−1) which evokes 50% of maximal contraction as determined in preceding experiments. In this set-up, exogenous dopamine caused vasorelaxation in the concentration range of 10−10–10−5 mol l−1 whereas at higher concentrations a constrictory effect was observed (authors’ unpublished data). Lowering of medium
by 25 mmHg resulted in a relaxation that accounted for 16% of the constriction induced by U46619. This hypoxic vasodilatory effect was completely abolished and converted into a slight constriction in the presence of the specific D1 receptor antagonist SCH 23990 (10−7 mol l−1), demonstrating that it is critically dependent on endogenously released dopamine acting upon D1 receptors (Fig. 6C). To evaluate the role of the endothelium in this vasodilatation, arteries were denuded from their endothelium, the efficacy of which was validated by transmission electron microscopy (Fig. 6D and E). In such vessels, hypoxic vasodilatation was greatly reduced but not entirely abolished, and the remaining effect was still sensitive to the D1 receptor antagonist (Fig. 6C). Under these conditions, the effect of D1 receptor blockade was not significantly different in vessels with and without endothelium (reduction in SMA diameter compared to non-treated group: 22% versus 20%, n = 5; P = 0.31, Mann–Whitney test). Further lowering of oxygen tension to 55 mmHg (Δ
= 105 mmHg) augmented both the hypoxic relaxation (nearly 40% of constriction induced by U46619) and the hypoxic constriction in presence of the D1 receptor antagonist (Fig. 6C). In the presence of endothelium, D1 receptor blockade reduced hypoxic SMA diameter by 75.5 ± 1.9% (mean ± SEM; n = 5), compared to untreated hypoxic vessels, and this D1 receptor sensitive response was reduced by about tenth in endothelial-denuded vessels (68.9 ± 0.9%; n = 5; P = 0.008, Mann–Whitney test).
Figure 6. Dopamine fully accounts for oxygen dependent vasorelaxation in the rat SMA.

Examples of original recordings were shown in A and B. Perfused arteries were precontracted with the thromboxane analogue U46619 (5.9 × 10−7 mol l−1) to yield 50% of the maximal constriction, and this diameter was set as baseline. Lowering
resulted in relaxation of the vessel which was not only abrogated but turned into vasoconstriction in the presence of the dopamine D1 receptor antagonist, SCH23990 (10−7 mol l−1). Both effects are markedly enhanced by increasing
gradient from 25 to 105 mmHg. C, endothelium removal attenuated hypoxic relaxation, but did not abrogate it. Box plots show all quartiles from 0–100, small circles depict data beyond 3 × SD, *P < 0.05 compared to corresponding control without SCH23990 administration, #P < 0.05 compared to corresponding situation with endothelium, n = 5 per group. D and E, transmission electron microscopy showed intact endothelial cells (e) on the internal elastic lamella (el) at the end of perfusion experiments with diameter measurements (D, intact) whereas only cell remnants (arrowheads) are seen after endothelial denudation (E). Arrows point to endothelial foot processes contacting myocytes. Scale bar = 5 μm.
Vascular smooth muscle cells partially express catecholaminergic traits
Isolated aortic smooth muscle cells were characterized by their ability to express α-smooth muscle actin (Fig. 7A). RT-PCR revealed DβH and PNMT mRNA in isolated aortic vascular smooth muscle cells, but expression of TH mRNA was noted only weakly and irregularly in about 50% of the samples (Fig. 7B). AADC mRNA was not detected. This expression pattern was not changed by culture in hypoxia (1% O2) for 6–24 h (Fig. 7C).
Figure 7. Vascular smooth muscle cells partially express catecholaminergic traits.

A, isolated aortic cells were characterized as smooth muscle cells by immunolabelling for α-smooth muscle actin; scale bar = 50 μm. B, RT-PCR. These cells express DβH and PNMT, weakly TH (here, one positive sample out of 4 positive and 4 negative samples is shown), and AADC was not detected (only primer dimers seen on the gel). β2-MG: β2-microglobulin; –RT = control run without reverse transcriptase; H2O = control run without template. C, real-time PCR. Exposure to hypoxia for 6–24 h neither changed levels of DβH-mRNA nor that of PNMT-mRNA in abdominal aortic smooth muscle cells. n = 4 in each group; P > 0.05 in Kruskal–Wallis rank sum test.
Discussion
The present study identifies dopamine as a novel non-neuronal intrinsic vasodilator in the arterial wall which is crucial in
-driven vasoregulation. Initial RIA experiments detected a substantial pool of catecholamines, i.e. dopamine, noradrenaline, and adrenaline, in the vascular wall of rat aortae and SMA. In comparison to noradrenaline and adrenaline, dopamine levels were nearly unaffected by chemical sympathectomy, indicating that the source of dopamine are not sympathetic perivascular axons. In accordance with recently published data from Sorriento and coworkers (2012), we identified endothelial cells as a source of dopamine in the vascular wall. Nevertheless, in view of endothelial cell's ability to take up exogenous catecholamines (Iijima & Wasano, 1980; Westwood et al. 1996) the possibility remained that the dopamine was taken up by endothelial cells prior to isolation. To exclude this possibility we stimulated de novo synthesis of dopamine in cultured endothelial cells. In a predominantly dopaminergic cell line from a rat adrenal medullary tumour, PC12 cells, a rise in intracellular cAMP is the most powerful stimulus to drive expression of the rate-limiting enzyme of catecholamine synthesis, TH, and hence catecholamine synthesis (Lewis-Tuffin et al. 2004). Treatment of endothelial cells with the cell-permeable cAMP analogue dibutyryl-cAMP in the presence of the monoamine oxidase inhibitor pargyline (Edmondson et al. 2004) indeed increased intracellular dopamine and, moreover, the concentration of dopamine detectable in the supernatant. Thus, endothelial cells synthesize and secrete dopamine in a regulated fashion.
The rate-limiting step in catecholamine synthesis is hydroxylation of tyrosine to l-DOPA by TH. l-DOPA is decarboxylated to dopamine by AADC, and then hydroxylated to yield noradrenaline by DβH, and noradrenaline methylation by PNMT finally leads to adrenaline (Weiss & Rossi, 1963). Messenger RNAs coding for TH, AADC and DβH were detectable by RT-PCR in cultured endothelial cells from SMA. The rate-limiting enzyme TH was also demonstrated at protein level in endothelial cells in rat SMA. In the carotid body, an arterial oxygen sensor organ, TH expression is regulated by hypoxia (Hui et al. 2003). Similarly, we observed an increase in TH mRNA in endothelial cells exposed to hypoxia.
Given the fact that endothelial cells are able to synthesize and release dopamine we set out to determine a physiological role of endothelial dopamine in situ, focusing upon the rat SMA which we had identified as a rich source of non-neuronal dopamine in our sympathectomy experiments. Dopamine dilates this vessel via D1 receptors (Zeng et al. 2004), and hypoxia is a well-known stimulus for SMA relaxation that is mediated neither by nitric oxide nor prostaglandins (Otter & Austin, 1999; Bruce et al. 2004). In these experiments, exogenous dopamine caused vasorelaxation in a concentration range of 10−10–10−5 m whereas at higher concentrations a constrictory effect was observed, fully in line with the known conversion of D1 receptor-mediated vasorelaxation to α-adrenoreceptor-mediated vasoconstriction at higher dopamine concentration (Shepperson et al. 1982). Lowering of medium
from room air conditions (160 mmHg) to 135 mmHg resulted in a relaxation which was completely abolished and converted into a slight constriction in the presence of the D1 receptor antagonist SCH 23990 (Hilditch et al. 1984), demonstrating that it is critically dependent on endogenously released dopamine acting upon D1 receptors. To evaluate the role of the endothelium in dopamine-induced vasodilatation, arteries were denuded from their endothelium. In such vessels, hypoxic vasodilatation was greatly reduced but not entirely abolished, and the remaining effect was still sensitive to the D1 receptor antagonist revealing an additional source of dopamine other than the endothelial cells. This non-endothelial component dominated functionally in that it accounted for approximately 90% of the D1 receptor blockade sensitive hypoxic vasodilatation.
Attractive candidates for an additional source of dopamine are vascular smooth muscle cells, the dominating non-endothelial cell type of the arterial wall. Even though not containing the full set of dopamine synthesizing enzymes itself, smooth muscle cells express catecholamine uptake transporters. Specifically, the plasma membrane dopamine transporter has been localized in the media of splenic arteries by immunohistochemistry (Mignini et al. 2006), and blood vessels exhibit the highest expression of the extraneuronal monoamine uptake system, i.e. organic cation transporter-3, among all organs investigated (Slitt et al. 2002). Accordingly, functional non-neuronal dopamine uptake in the arterial wall has been directly shown (Amenta & Ferrante, 1983). It remains to be established whether dopamine taken up by non-neuronal cells in the arterial wall originates from the endothelium or from circulating blood where it predominantly has a sympathoneuronal source (Goldstein & Holmes, 2008). Of course, alternative pathways for dopamine synthesis, as recently reported for d-amino acid oxidase (Kawazoe et al. 2007), also have to be considered.
Our results show that endothelial cells from various origins synthesize and release dopamine in an oxygen-regulated manner. In addition, there is a releasable dopamine pool in the underlying vascular wall. In the splanchnic vasculature, this intrinsic non-neuronal dopamine is the dominating vasodilator released upon lowering of oxygen tension. In view of the known wide spectrum of vascular dopaminergic effects including regulation of endothelial gene expression (Berger et al. 2000), inhibition of angiogenesis (Basu et al. 2001), and of histamine-induced secretion of von Willebrand factor (Zarei et al. 2006), our findings of an intrinsic vascular dopaminergic system are likely to be of broader importance beyond oxygen-dependent vasoregulation.
Key points
Dopamine is a member of the catecholamine family and a precursor in the biosynthetic pathway of adrenaline and noradrenaline, which acts as an independent neurotransmitter in the sympathetic nervous system and as a paracrine hormone.
We found that the arterial wall of systemic vessels itself, i.e. the endothelial cells and the underlying tissue, produces a substantial pool of dopamine.
This intrinsic vascular dopamine is released upon stimulation by decreasing oxygen concentrations, causing a dilatation of the blood vessel, thereby increasing blood flow and subsequently oxygenation of the tissue.
This study identifies dopamine as a novel non-neuronal intrinsic vasodilator in the arterial wall, crucially involved in
-driven modulation of vascular tone and maintenance of tissue oxygenation under conditions where reduced oxygen supply may cause severe damage to body systems as in stroke, heart infarction and pulmonary hypertension.
Acknowledgments
We thank M. Bodenbenner-Türich for isolation of the endothelial cells, P. Mermer and A. Goldenberg for technical assistance in cell culture experiments, G. Magdowski for technical assistance in sample preparation for electron microscopy, K. Michael for figure preparation, and D. R. Zoltan for preparation and handling of rat SMA.
Glossary
- AADC
aromatic l-amino acid decarboxylase
- cAMP
cyclic adenosine monophosphate
- DβH
dopamine-β-hydroxylase
- DOPA
l-3,4-dihydroxyphenylalanine
- 6-OHDA
6-hydroxydopamine
- PD
postnatal day
- PNMT
phenylethanolamine-N-methyltransferase
- MA
superior mesenteric artery
- TH
tyrosine hydroxylase
- TTBS
Tris-buffered saline with 0.05% Tween-20
Additional information
Competing interests
None declared.
Author contributions
U.P. and J.K.: conception and design of the experiments, collection of data, drafting of the manuscript. D.B., K.-D.S. and J.S.: collection of data, analysis and interpretation of data. R.P.: collection, analysis and interpretation of data, drafting the manuscript. A.R., M.H. and M.W.: collection of data. M.A.W. and R.M.: analysis and interpretation of data. W.K.: conception and design of the experiments. Sympathectomy and RIA measurements were done at the Department of Physiology, Faculty of Medicine in Plzen, Charles University in Prague, Czech Republic. Recordings of vessel diameter were done at the Department of Obstetrics and Gynecology, Justus-Liebig-University, Giessen, Germany. All other experiments were done at the Institute for Anatomy and Cell Biology, Justus-Liebig-University, Giessen, Germany. All authors have read and approved the final version of the manuscript.
Funding
This work was supported by the Deutsche Forschungsgemeinschaft (GK 534 to W.K.; Excellence Cluster Cardio-Pulmonary System to W.K. and K.-D.S), the Czech Ministry of Education, Youth and Sports (MSM 0021620819; to J.K. and J.S.), and the Charles University Research Fund (project number P36).
References
- Amenta F, Ferrante F. Detection of neuronal uptake of [3H]dopamine in the rabbit celiac artery. Eur J Pharmacol. 1983;88:251–254. doi: 10.1016/0014-2999(83)90013-4. [DOI] [PubMed] [Google Scholar]
- Basu S, Nagy JA, Pal S, Vasile E, Eckelhoefer IA, Bliss VS, Manseau EJ, Dasgupta PS, Dvorak HF, Mukhopadhyay D. The neurotransmitter dopamine inhibits angiogenesis induced by vascular permeability factor/vascular endothelial growth factor. Nat Med. 2001;7:569–574. doi: 10.1038/87895. [DOI] [PubMed] [Google Scholar]
- Bell C, Lang WJ. Evidence for dopaminergic vasodilator innervation of the canine paw pad. Br J Pharmacol. 1979;67:337–343. doi: 10.1111/j.1476-5381.1979.tb08685.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Berger SP, Hünger M, Yard BA, Schnuelle P, Woude van der FJ. Dopamine induces the expression of heme oxygenase-1 by human endothelial cells in vitro. Kidney Int. 2000;58:2314–2319. doi: 10.1046/j.1523-1755.2000.00415.x. [DOI] [PubMed] [Google Scholar]
- Brain SD, Grant AD. Vascular actions of calcitonin gene-related peptide and adrenomedullin. Physiol Rev. 2004;84:903–934. doi: 10.1152/physrev.00037.2003. [DOI] [PubMed] [Google Scholar]
- Bruce J, Taggart M, Austin C. Contractile responses of isolated rat mesenteric arteries to acute episodes of severe hypoxia and subsequent reoxygenation. Microvasc Res. 2004;68:303–312. doi: 10.1016/j.mvr.2004.08.001. [DOI] [PubMed] [Google Scholar]
- Burke AP, Virmani R. Pathophysiology of acute myocardial infarction. Med Clin North Am. 2007;91:553–572. doi: 10.1016/j.mcna.2007.03.005. [DOI] [PubMed] [Google Scholar]
- Di Marco GS, Vio CP, Dos Santos OF, Schor N, Casarini DE. Catecholamine production along the nephron. Cell Physiol Biochem. 2007;20:919–924. doi: 10.1159/000110452. [DOI] [PubMed] [Google Scholar]
- Dunnett SB, Bentivoglio M, Björklund A, Hökfelt T. Handbook of Chemical Neuroanatomy. Vol. 21. Amsterdam, Netherlands: Elsevier; 2005. Dopamine; pp. 1–588. [Google Scholar]
- Edmondson DE, Mattevi A, Binda C, Li M, Hubalek F. Structure and mechanism of monoamine oxidase. Curr Med Chem. 2004;11:1983–1993. doi: 10.2174/0929867043364784. [DOI] [PubMed] [Google Scholar]
- Galvin GB, Szabo S. Dopamine in gastrointestinal disease. Dig Dis Sci. 1990;35:1153–1161. doi: 10.1007/BF01537589. [DOI] [PubMed] [Google Scholar]
- Goldstein DS, Holmes C. Neuronal source of plasma dopamine. Clin Chem. 2008;54:1864–1871. doi: 10.1373/clinchem.2008.107193. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gupte SA, Zias EA, Sarabu MR, Wolin MS. Role of prostaglandins in mediating differences in human internal mammary and radial artery relaxation elicited by hypoxia. J Pharmacol Exp Ther. 2004;311:510–518. doi: 10.1124/jpet.104.070995. [DOI] [PubMed] [Google Scholar]
- Hartman DS, Lanau F. Diversity of dopamine receptors: new molecular and pharmacological developments. Pol J Pharmacol. 1997;49:191–199. [PubMed] [Google Scholar]
- Hermsteiner M, Zoltan DR, Doetsch J, Rascher W, Kuenzel W. Human chorionic gonadotropin dilates uterine and mesenteric resistance arteries in pregnant and nonpregnant rats. Pflügers Arch. 1999;439:186–194. doi: 10.1007/s004249900151. [DOI] [PubMed] [Google Scholar]
- Hilditch A, Drew GM, Naylor RJ. SCH 23390 is a very potent and selective antagonist at vascular dopamine receptors. Eur J Pharmacol. 1984;97:333–334. doi: 10.1016/0014-2999(84)90471-0. [DOI] [PubMed] [Google Scholar]
- Huemer KH, Garhofer G, Zawinka C, Golestani E, Litschauer B, Schmetterer L, Dorner GT. Effects of dopamine on human retinal vessel diameter and its modulation during flicker stimulation. Am J Physiol Heart Circ Physiol. 2003;284:H358–H363. doi: 10.1152/ajpheart.00642.2002. [DOI] [PubMed] [Google Scholar]
- Hui AS, Striet JB, Gudelsky G, Soukhova GK, Gozal E, Beitner-Johnson D, Guo SZ, Sachleben LR, Jr, Haycock JW, Gozal D, Czyzyk-Krzeska MF. Regulation of catecholamines by sustained and intermittent hypoxia in neuroendocrine cells and sympathetic neurons. Hypertension. 2003;42:1130–1136. doi: 10.1161/01.HYP.0000101691.12358.26. [DOI] [PubMed] [Google Scholar]
- Iijima T, Wasano T. Further studies on catecholamine-containing specific endothelial granules in carp cerebral veins. A fluorescence histochemical and electron microscopy study. Anat Rec. 1980;198:415–420. doi: 10.1002/ar.1091980303. [DOI] [PubMed] [Google Scholar]
- Kawazoe T, Tsuge H, Imagawa T, Aki K, Kuramitsu S, Fukui K. Structural basis of d-DOPA oxidation by d-amino acid oxidase: alternative pathway for dopamine biosynthesis. Biochem Biophys Res Commun. 2007;355:385–391. doi: 10.1016/j.bbrc.2007.01.181. [DOI] [PubMed] [Google Scholar]
- Kummer W, Neuhuber WL. Vagal paraganglia of the rat. J Electron Microsc Tech. 1989;12:343–355. doi: 10.1002/jemt.1060120407. [DOI] [PubMed] [Google Scholar]
- Kvetnansky R, Ucropec J, Laukova M, Manz B, Pacak K, Vargovic P. Stress stimulates production of catecholamines in rat adipocytes. Cell Mol Neurobiolol. 2012;32:801–813. doi: 10.1007/s10571-012-9822-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lewis-Tuffin LJ, Quinn PG, Chikaraishi DM. Tyrosine hydroxylase transcription depends primarily on cAMP response element activity, regardless of the type of inducing stimulus. Mol Cell Neurosci. 2004;25:536–547. doi: 10.1016/j.mcn.2003.10.010. [DOI] [PubMed] [Google Scholar]
- Lundberg JO, Weitzberg E. NO generation from nitrite and its role in vascular control. Arterioscler Thromb Vasc Biol. 2005;25:915–922. doi: 10.1161/01.ATV.0000161048.72004.c2. [DOI] [PubMed] [Google Scholar]
- Mezey E, Eisenhofer G, Hansson S, Harta G, Hoffman BJ, Gallatz K, Palkovits M, Hunyady B. Non-neuronal dopamine in the gastrointestinal system. Clin Exp Pharmacol Physiol Suppl. 1999;26:S14–22. [PubMed] [Google Scholar]
- Mignini F, Traini E, Tomassoni D, Amenta F. Dopamine plasma membrane transporter (DAT) in rat thymus and spleen: an immunochemical and immunohistochemical study. Auton Autacoid Pharmacol. 2006;26:183–189. doi: 10.1111/j.1474-8673.2006.00370.x. [DOI] [PubMed] [Google Scholar]
- Otter D, Austin C. Mechanisms of hypoxic vasodilatation of isolated rat mesenteric arteries: a comparison with metabolic inhibition. J Physiol. 1999;516:249–259. doi: 10.1111/j.1469-7793.1999.249aa.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pacheco R, Prado CE, Barrientos MJ, Bernales S. Role of dopamine in the physiology of T-cells and dendritic cells. J Neuroimmunol. 2009;216:8–19. doi: 10.1016/j.jneuroim.2009.07.018. [DOI] [PubMed] [Google Scholar]
- Pfeil U, Paddenberg R, Kummer W. Mitochondrial regulation of hypoxia-induced increase of adrenomedullin mRNA in HL-1 cells. Biochem Biophys Res Commun. 2006;343:885–892. doi: 10.1016/j.bbrc.2006.03.042. [DOI] [PubMed] [Google Scholar]
- Saeed SA, Shad KF, Saleem T, Javed F, Khan MU. Some new prospects in the understanding of the molecular basis of the pathogenesis of stroke. Exp Brain Res. 2007;182:1–10. doi: 10.1007/s00221-007-1050-9. [DOI] [PubMed] [Google Scholar]
- Shepperson NB, Duval N, Langer SZ. Dopamine decreases mesenteric blood flow in the anaesthetised dog through the stimulation of postsynaptic alpha 2-adrenoceptors. Eur J Pharmacol. 1982;81:627–635. doi: 10.1016/0014-2999(82)90352-1. [DOI] [PubMed] [Google Scholar]
- Shyrock JC, Belardinelli L. Adenosine and adenosine receptors in the cardiovascular system: biochemistry, physiology, and pharmacology. Am J Cardiol. 1997;79:2–10. doi: 10.1016/s0002-9149(97)00256-7. [DOI] [PubMed] [Google Scholar]
- Slitt AL, Cherrington NJ, Hartley DP, Leazer TM, Klaassen CD. Tissue distribution and renal developmental changes in rat organic cation transporter mRNA levels. Drug Metab Dispos. 2002;30:212–219. doi: 10.1124/dmd.30.2.212. [DOI] [PubMed] [Google Scholar]
- Sorriento D, Santulli G, Guidice del C, Anastasio A, Trimarco B, Iaccarino G. Endothelial cells are able to synthesize and release catecholamines both in vitro and in vivo. Hypertension. 2012;60:129–136. doi: 10.1161/HYPERTENSIONAHA.111.189605. [DOI] [PubMed] [Google Scholar]
- Suttner SW, Boldt J. Natriuretic peptide system: physiology and clinical utility. Curr Opin Crit Care. 2004;10:336–341. doi: 10.1097/01.ccx.0000135513.26376.4f. [DOI] [PubMed] [Google Scholar]
- Toda N. Dopamine vasodilates human cerebral artery. Experientia. 1983;39:1131–1132. doi: 10.1007/BF01943144. [DOI] [PubMed] [Google Scholar]
- Villanueva I, Pinon M, Quevedo-Corona L, Martinez-Olivaras R, Racotta R. Epinephrine and dopamine colocalization with norepinephrine in various peripheral tissues. Life Sci. 2003;73:1645–1653. doi: 10.1016/s0024-3205(03)00491-0. [DOI] [PubMed] [Google Scholar]
- Weiss B, Rossi GV. Catecholamines, biosynthesis, and inhibitors of formation. Am J Pharm Sci Support Public Health. 1963;135:206–218. [PubMed] [Google Scholar]
- Westwood NN, Scarcella DL, Bryan-Lluka LJ. Evidence for uptake1-mediated efflux of catecholamines from pulmonary endothelial cells of perfused lungs of rats. Naunyn Schmiedebergs Arch Pharmacol. 1996;353:528–535. doi: 10.1007/BF00169172. [DOI] [PubMed] [Google Scholar]
- Yamauchi M, Kobayashi Y, Shimoura K, Hattori K, Nakase A. Endothelium-dependent and –independent relaxation by dopamine in the rabbit pulmonary artery. Clin Exp Pharmacol Physiol. 1992;19:401–410. doi: 10.1111/j.1440-1681.1992.tb00482.x. [DOI] [PubMed] [Google Scholar]
- Yuan XJ, Tod ML, Rubin LJ, Blaustein MP. Contrasting effects of hypoxia on tension in rat pulmonary and mesenteric arteries. Am J Physiol Heart Circ Physiol. 1990;259:H281–H289. doi: 10.1152/ajpheart.1990.259.2.H281. [DOI] [PubMed] [Google Scholar]
- Zarei S, Frieden M, Rubi B, Villemin P, Gauthier BR, Maechler P, Vischer UM. Dopamine modulates von Willebrand factor secretion in endothelial cells via D2-D4 receptors. J Thromb Haemost. 2006;4:1588–1595. doi: 10.1111/j.1538-7836.2006.01998.x. [DOI] [PubMed] [Google Scholar]
- Zeng C, Wang D, Yang Z, Wang Z, Asico LD, Wilcox CS. Dopamine D1 receptor augmentation of D3 receptor action in rat aortic or mesenteric vascular smooth muscles. Hypertension. 2004;43:673–679. doi: 10.1161/01.HYP.0000118958.27649.6f. [DOI] [PubMed] [Google Scholar]
- Zeng C, Zhang M, Asico LD, Eisner GM, Jose PA. The dopaminergic system in hypertension. Clin Sci. 2007;112:583–597. doi: 10.1042/CS20070018. [DOI] [PubMed] [Google Scholar]
