Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Apr 1.
Published in final edited form as: Mol Cancer Res. 2014 Jan 10;12(4):491–503. doi: 10.1158/1541-7786.MCR-13-0418

KIF3a Promotes Proliferation and Invasion via Wnt Signaling in Advanced Prostate Cancer

Zun Liu 1,1, Ryan E Rebowe 1,1, Zemin Wang 1, Yingchun Li 1, Zehua Wang 1, John S DePaolo 1, Jianhui Guo 1, Chiping Qian 1, Wanguo Liu 1
PMCID: PMC4001865  NIHMSID: NIHMS556389  PMID: 24413182

Abstract

Aberrant activation of the Wnt/β-catenin signaling pathway is a critical event in advanced prostate cancer, but the genetic alterations which activate the Wnt signaling pathway in many other cancers are rarely observed in prostate cancer. Other molecular mechanisms that regulate the Wnt signaling pathway in prostate cancer remain to be identified. Here it is demonstrated that KIF3a, a subunit of kinesin-II motor protein, functions as an agonist of the Wnt signaling pathway in prostate cancer. KIF3a is up-regulated in the majority of human prostate cancer cell lines and primary tumor biopsies. The expression levels of KIF3a correlate with a higher Gleason score, TNM grade, and metastatic status of prostate cancer. Moreover, exogenous expression of KIF3a promoted cell growth in the benign prostate cells, whereas silencing KIF3a in cancer cells decreased cell proliferation, anchorage-independent cell growth, and cell migration/invasion. Mechanistically, KIF3a increases CK1-dependent DVL2 phosphorylation and β-catenin activation in prostate cancer cells, leading to transactivation of the Wnt signaling target genes such as Cyclin D1, HEF1, and MMP9. These findings support the notion that up-regulation of KIF3a is causal of aberrant activation of Wnt signaling in advanced prostate cancer through the KIF3a-DVL2-β-catenin axis.

Implications

Inactivation of KIF3a may improve survival of patients with advanced prostate cancer in which Wnt signaling is activated.

Keywords: KIF3a, Wnt signaling activation, prostate cancer progression and invasion

Introduction

Prostate cancer (PCa) remains the most diagnosed cancer and the second leading cause of cancer-related death in men in the US (1). Although the incidence and mortality of this cancer are decreasing, advanced or aggressive prostate cancer (PCa) remains the major cause of PCa-related death (1). Aggressive PCa is characterized by early age onset, high Gleason score (7–10), high PSA level (over 50ng/ml), and/or androgen-independence (2, 3). The mortality of aggressive PCa patients is about four-times higher than non-aggressive PCa (4). Since aggressive and non-aggressive PCa have dramatically different clinical outcomes, markers associated with aggressiveness of PCa would be of great clinical utility. Identifying these markers and understanding their mechanisms will identify novel therapeutic or chemopreventive targets for patients with aggressive PCa.

Wnt signaling plays a crucial role in the progression of PCa, and particularly, in aggressive PCa (5–11). Wnt activation in other tumor types, such as colon cancer, is induced by gene mutations in APC, β-catenin, or AXIN1/2, components of the β-catenin destruction complex of the Wnt signaling pathway (12–14). In cells harboring these mutations, β-catenin accumulates, translocates to the nucleus and interacts with the T-cell factor/lymphoid enhancer factor (TCF/LEF) family of transcription factors to activate specific Wnt target genes, such as c-Myc, Cyclin D1, HEF1, and MMPs leading to tumorigenesis (15–18). In addition, increased phosphorylation of DVL2 also activates Wnt/β-catenin signaling in certain cancers (19). However, in contrast to colon cancer, mutations in β-catenin and APC are rare in PCa (20). Only 5% of prostate tumors harbor activating mutations in β-catenin and even less contain APC mutations, however, the frequency of nuclear accumulation of β-catenin was reported in 23–83% of PCa (21). Thus, the mechanisms activating the Wnt/β-catenin signaling pathway in a large proportion of PCa have yet to be identified.

KIF3a is a member of the kinesin family of motor proteins. It has been implicated downstream of the Hedgehog (Hh) signaling complex and has been shown to regulate early development, ciliogenesis, and tumorigenesis (22). Interestingly, KIF3a interacts with Wnt signaling component, APC, through an association with the kinesin superfamily-associated protein (KAP3) for regulating cell migration (23). As a microtubule-directed motor subunit of the KIF3 complex, KIF3a also plays an important role in the subcellular transport of β-catenin-cadherin(s) complex (24). In addition, it was demonstrated that KIF3a can constrain β-catenin-dependent Wnt signaling through dual ciliary and non-ciliary mechanisms (25). Moreover, selective deletion of Kif3a in osteoblasts of the Kif3a9Oc-cKO mice impairs osteoblast-mediated bone formation through multiple pathways including Wnt signaling (26). Although these studies provided evidence that KIF3a regulates the Wnt signaling pathway, whether KIF3a plays a role in the activation of the Wnt signaling pathway in PCa remains unknown.

In this study, we measured the expression levels of KIF3a in PCa cell lines and primary tumor tissues and showed the correlation of KIF3a levels with PCa progression and metastasis. We also examined the role of KIF3a in phosphorylation of DVL2 and in activation of the Wnt signaling pathway and identified the KIF3a downstream targets Cyclin D1, MMP9, and HEF1. Our data provide evidence to support the hypothesis that up-regulation of KIF3a activates the Wnt signaling pathway to promote PCa cell proliferation and cancer progression. KIF3a is a potential therapeutic target for advanced PCa.

Materials and Methods

Cell lines, primary tumor tissues, and tissue microarray

Cell lines including 293T, LNCaP, DU145, PC-3 and RWPE-2 were purchased from American Type Culture Collection (ATCC, Manassas, VA); BPH1 (27), P69 (28), M12 (29), M2182 (30) and C4-2B (31) cell lines were kindly provided by Dr. Haojie Huang (Mayo Clinic) or Dr. Shahriar Koochekpour (LSUHSC, New Orleans, LA). All the cell lines were maintained in an appropriate medium according to the ATCC’s protocols. The human PCa tumor tissues were obtained from the Louisiana Cancer Research Consortium (LCRC) with patient consent and institutional review board (IRB) approval. The prostate tissue microarray was purchased from US Biomax Inc. (Rockville, MD).

Western blotting, Immunofluorescence, and immunohistochemistry analyses

Western blotting was performed as described previously (32) using anti-KIF3a (Sigma, St. Louis, MO), anti-β-catenin (BD Transduction Laboratories, San Jose, CA), anti-MMP9 (EMD Millipore, Billerica, MA), anti-HEF1 (ImmuQuest, UK), anti-DVL2 (Cell Signaling, Danvers, MA) and anti-Cyclin D1 (BD Transduction Laboratories) antibodies. Protein bands were visualized using the Enhanced Chemiluminescence Kit (Thermo Scientific, Rockford, IL). For immunofluorescence analysis, cells were grown on 12-well chamber slides coated with 100 nmol/L poly-l-lysine (Invitrogen, Carlsbad, CA) for 24 hours. Cells were then washed, fixed, and blocked in 1% bovine serum albumin–PBS, incubated with primary antibodies and goat anti-rabbit secondary antibody conjugated to Alexa 488 (Invitrogen). Imaging was performed on Carl Zeiss fluorescence microscope or Confocal Laser Scanning Microscope (Thornwood, NY). ImageJ 1.47 (National Institutes of Health, Bethesda, MD) software was used for fluorescence intensity measurement and densitometry analysis of western blot. Immunohistochemical analyses of the human prostate tissue microarray were conducted using the anti-KIF3a antibody (Sigma). Tissue sections were deparaffinized and rehydrated. Antigen retrieval was achieved by boiling the sections for 20 minutes in 10mM citric acid buffer (pH6.0). After a 10 minute treatment with 3% hydrogen peroxide in 1X PBS to remove endogenous peroxidase and a 30 minutes incubation with 5% bovine serum albumin (BSA) for blocking non-specific binding, tissue sections were incubated with Kif3a antibody (1:100 in 2% BSA) overnight and followed by incubation with biotinylated goat anti-rabbit antiserum (Jackson Immune Research laboratory, West Grove, PA) diluted 1:200 in 2% BSA for 30 minutes at room temperature, and detected with ABC immunodection kit (Vector Laboratories, Burlingame, CA). Sections were counterstained with Harris hematoxylin solution (Sigma), passed through a dehydration process and cover slipped. The stained sections were scored as 0 (no staining), 1 (+, weak positive), 2 (++, medium positive) and 3 (+++, strong positive), respectively. To assess the specificity of antibodies used for immunohistochemistry, omission of the primary antibodies or incubation of samples with normal rabbit IgG as the negative control was performed in tumor samples in parallel with regular anti-KIF3a antibody incubation. These negative controls demonstrated no immunoreactivity.

Overexpression and shRNA-mediated silencing of KIF3a

The KIF3a expressing construct was generated by inserting human KIF3a cDNA into pCMV-Tag2b vector (Stratagene, La Jolla, CA) with BamHI/HindIII restriction sites, and verified by sequencing. Transient overexpression of KIF3a was performed, according to manufacturer’s instructions, by transfection using X-tremeGene HP DNA transfection reagent (Roche, Mannheim, Germany). Lentiviral shRNA constructs targeting KIF3A or a scramble control were generated by inserting the sequences 5’-TCCGCCAGTTTCAGAAAGAAA-3’ (shKIF3a-1), 5’-CCAAAGACATTTACTTTCGAT-3’ (shKIF3a-2), or 5’-CCTAAGGTTAAGTCGCCCTCG-3’ (shControl) into the pLKO.1 vector (Addgene, Cambridge, MA) with the EcoRI/BamHI restriction sites. The lentiviral particles expressing the control or KIF3a shRNA were produced in 293T cells using pPACKH1-XL Packaging Mix (System Biosciences, Mountain View, CA) and FuGENE Transfection Reagent (Roche, Indianapolis, IN) following the manufactures’ instructions. Transfection of LNCaP cells was conducted following a protocol previously described (33). Knockdown efficiency was determined by western blot analysis 48 hours after transduction.

Cell proliferation and anchorage-independent growth assays

LNCaP cells were transduced with lentiviral particles expressing shKIF3a or control shRNA for 48 hours and then plated at a density of 5×103 cells/well in 96 well plates. The p69 cells were transfected with pCMV KIF3a or pCMV vector constructs at a density of 5×103 cells/well in 96 well plates. The growth and viability effects of KIF3a knockdown on LNCaP cell or overexpression on p69 cell were determined using MTT (3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide) assay (Promega, Madison, WI) as described in the manufacturer’s instruction. Three independent experiments were performed and each experiment was performed in triplicates. Clonogenic growth of cells was evaluated by assessing plating efficiency for anchorage-independent growth in soft agar using an approach described previously (34). Colonies were scored at day 16 after plating. The results were shown as a mean ± SD of colonies from three independent experiments.

In vitro cell migration and invasion Assays

In vitro cell migration was determined with a 24-well Transwell plate (8-µm pore polycarbonate membrane inserts, Corning Inc., Corning, NY) according to the manufacturer’s protocol. The cells were trypsinized, washed and suspended in serum free medium. 1 × 105 cells were placed in the upper chamber of the insert and the lower chamber of the insert was filled with migration-inducing medium which contained 10% FBS and 40ug/ml Collagen I (Sigma). After incubation for 24 hrs, the cells on the top chambers were gently removed with cotton swabs. The migratory cells on the bottom of the membrane were fixed with 100% methanol for 10 minutes and stained with 0.1% crystal violet for 30 minutes. Five different views were randomly chosen under a microscope, and the cell number on the bottom side of the membrane was counted. The results were shown as a mean ± SD of migration cells from three independent experiments.

The cancer cell invasive ability with KIF3a knock down and control was examined with a BD BioCoat Matrigel Invasion Chamber (BD Bioscience, San Jose, CA) according to the manufacturer’s protocol. For these assays, 2.5×104 cells were plated in the Matrigel-coated chamber inserts. Cells were suspended in a medium without serum or growth factors, and medium with 10% serum was used as a chemoattractant in the lower chamber. After incubation at 37°C for 18 hours, the noninvasive cells on the top chambers were gently removed with cotton swabs. The invading cells on the underside of the membrane were fixed in 100% methanol for 10 minutes, air dried, stained in 0.1% crystal violet, and counted under a microscope. The numbers of invaded cells in five random microscopic fields were counted and the results were shown as the fold change relative to shRNA control.

Cell Cycle Analysis

Cell cycle analysis was performed using propidium iodide (PI) staining as described previously (35). In brief, LNCaP cells were transduced with the lentiviral constructs for 2 days and were trypsinized and washed with PBS and fixed in 70% ethanol for 24 hours. Cells were then washed once in cold PBS and stained with PBS containing 20 µg/ml PI, 0.1% triton-100 and 200µg/ml DNase-free RNase for 30 minutes at room temperature while protected from light. The cell cycle was analyzed using FACS Calibur flow cytometer and Cell Quest software (BD Biosciences).

TCF Reporter Assay

To determine the effects of KIF3a on β-catenin/TCF reporter constructs, cells were transfected in 24-well plates, with either TOPFLASH or FOPFLASH (100 ng) and the internal control plasmid pRL-TK (5 ng) (Promega) and other plasmids indicated, using LipofectAMINE™ 2000 Reagent (Invitrogen). The cells were incubated for 36 hours at 37°C, washed with PBS, and then lysed to measure luciferase reporter gene expression by dual-luciferase reporter assay system (Promega). Firefly luciferase activity was normalized to Renilla luciferase activity. All results are expressed as a mean ± SD for independent triplicate cultures.

Quantitative real-time PCR

Total RNA was extracted from cultured cells by homogenizing in Trizol Reagent according to the manufacturer’s instruction (Invitrogen). Superscript First-Strand Kit was used to synthesize first-strand cDNA (Invitrogen). Quantitative real-time PCR (qRT-PCR) was carried out with iQ SYBR Green Supermix (Bio-Rad, Hercules, CA) using primers: HEF1, forward primer 5′-ACTGATGCAGCAGACCTTTG -3′, reverse primer 5′- TGGCACTTGGTAGATGGTGT-3′; MMP9 (Matrix Metalloproteinase 9), forward primer: 5’-CCGGACCAAGGATACAGTTT -3’, reverse primer: 5’ – CGGCACTGAGGAATGATCTA -3’; cyclin D1, forward primer 5′-CTGTTTGGCGTTTCCCAGAGTCATC-3’, reverse primer 5′-AGCCTCCTCCTCACACCT CCTC-3′. Quantitation of gene expression was calculated by comparative Ct method. GAPDH was chosen as the housekeeping gene for template concentration control. Data was analyzed according to the comparative cycle threshold (Ct) method and were normalized by GAPDH expression in each sample as we previously described (32).

Statistical analysis

Data are expressed as a mean ± SD from at least 3 experiments. Statistical analyses were performed by using Student’s t test and chi-square tests as appropriate. The chi-square test was applied to compare KIF3a expression level to the Gleason scores, TNM stage and metastasis status of PCa. P < 0.05 was considered statistically significant.

Results

Up-regulation of KIF3a in PCa cell lines and primary tumor tissues

To investigate the role of KIF3a in prostate tumorigenesis, we first compared KIF3a protein levels in 6 PCa cell lines and 3 benign prostate epithelial cell lines by western blotting. We found that the average expression level of KIF3a in PCa cell lines was almost double that of the level in the benign cell lines (Fig. 1A, B). Moreover, the three metastatic PCa cell lines (M12, M182, and C4-2B) had the highest expression levels of KIF3a among all PCa cell lines analyzed (Fig. 1B). The aberrant expression of KIF3a observed in PCa cell lines was further validated in vivo by western blot analysis of 18 paired fresh frozen primary prostate tumors and their matched adjacent normal prostate tissues (Fig. 1C). Of the 18 tumors, 12 of the 13 tumors with Gleason scores of 7 or above showed relatively higher levels of KIF3a expression compared to matched normal tissues, while 5 (#3, 5, 6, 10, and 15) of the 6 tumors with low Gleason scores (5 or 6) showed relatively lower levels of KIF3a expression (Fig. 1D). These data indicate that KIF3a is up-regulated in PCa and suggest that the expression level of KIF3a likely increases as the tumor becomes more aggressive.

Figure 1.

Figure 1

Open in a new tab

KIF3a is up-regulated in PCa. A, B: KIF3a levels in PCa cell lines were determined by Western blotting and by densitometry analysis of the Western bands. The intensity of the KIF3a bands was normalized to the intensity of their respective β-actin bands and quantified against each other. * P < 0.05 and ** P < 0.01 as compared with benign prostate epithelial cell lines. C, D: KIF3a levels were determined in 18 paired prostate tumors and matched normal prostate tissues by Western blotting and by quantification of the protein bands as described in A and B. E: The histogram shows the percentage of positive Immunohistochemistry (IHC) staining of KIF3a in 9 normal and 74 PCa tissues samples. The IHC staining of a prostate tissue microarray was performed with a KIF3a antibody. F: Representative microphotographs of IHC analysis of KIF3a in the prostate tissue microarray. Images a-d represent IHC staining in normal prostate and grade I–III PCa tissues (magnification: × 200).

KIF3a upregulation and PCa progression

For clinical relevance, we determined the expression levels of KIF3a by immunohistochemistry (IHC) in a prostate tumor tissue microarray with 89 unrelated prostate tissue sample cores. We found a high level expression of KIF3a (scored as +2 and +3) in 39/74 (53%) tumor tissues but absent or very low level expression of KIF3a (scored as 0 and +1) in all 9 normal prostate tissues (Table 1; Fig. 1E). KIF3a staining was observed in both the cytoplasm and nucleus of cancer cells and staining scores was obtained by intensity × percentage of cells. The representative images of the KIF3a staining in normal or prostate tumor tissues are presented in Fig. 1F.

Table 1.

KIF3a expression levels and clinic characteristics of PCa

a. KIF3a expression levels and the Gleason scores of PCa
Gleason scores IHC Score Total
0~1+ 2+ 3+
Normal 9 (100%) 0 0 9
3–5 4 (50%) 4 (50%) 0 8
6–7 16 (47%) 17 (50%) 1 (3%) 34
8–10 16 (50%) 9 (28%) 7 (22%) 32
ND 6
Total 89
b. KIF3a expression levels and the TNM stages of PCa
TNM stages IHC Score Total
0~1+ 2+ 3+
T0 9 0 0 9
T1 2 (67%) 1 (33%) 0 3
T2 29 (66%) 12 (27%) 3 (7%) 44
T3 7 (28%) 16 (64%) 2 (8%) 25
T4 3 (38%) 2 (25%) 3 (38%) 8
Total 89
c. KIF3a expression levels and metastasis status of PCa
Metastatic
stages		 IHC Score Total
0~1+ 2+ 3+
Normal 9 (100%) 0 0 9
M0 32 (56%) 23 (40%) 2 (4%) 57
M1 10 (43%) 8 (35%) 5 (22%) 23
Total 89
Open in a new tab

To examine the potential correlation of KIF3a expression level and tumor characteristics, we compared the tumors with strong KIF3a expression (the highest level of IHC staining scored as +3) to their respective Gleason score, TNM grade, and metastatic status. We observed a stepwise correlation between strong KIF3a expression and the tumor Gleason score (Table 1a). High KIF3a expression was observed in 22% of tumors with Gleason scores of 8–10 and 3% with Gleason scores of 6–7 but was not observed in normal or tumor tissues with Gleason scores below 6. The correlation between strong KIF3a expression and high Gleason scores of 8–10 is statistically significant (chi-square test, P < 0.005). Similarly, elevated KIF3a expression correlates significantly with the highest tumor TNM grade, T4 (chi-square test, P < 0.005) (Table 1b). 38% of T4 tumors were scored as high KIF3a expression compared to 8% of T3, 7% of T2, and 0% of T1 or T0 samples. Consistently, increased KIF3a expression was observed in 22% of metastatic prostate tumors compared to only 4% of the localized prostate tumors (Table 1c). The different expression levels of KIF3a between metastatic (M1) and non-metastatic prostate tumors (M0) are statistically significant (Chi-Square test, P < 0.01). Taken together, these data indicate that high level expression of KIF3a is associated with aggressive PCa, suggesting that increased KIF3a expression may promote PCa progression and metastasis.

KIF3a regulates PCa cell proliferation in vitro

To investigate the effect of KIF3a on PCa progression and aggressiveness, we performed cell proliferation assay and anchorage-independent colony formation assay. As shown in Fig. 2A, transient overexpression of KIF3a in benign prostate p69 cells, which had low level expression of KIF3a, increased cell proliferation (P < 0.05). In contrast, silencing KIF3a in LNCaP cells, which have a high level expression of KIF3a, using the two different Lentiviral-KIF3a-shRNA constructs specifically against human KIF3a significantly reduced the cell growth rate compared to the cells expressing scramble-shRNA (P < 0.05) (Fig. 2B). Silencing KIF3a in LNCaP cells significantly reduced (P < 0.005) the number of colonies on soft-agar compared to the control cells (Fig. 2C). These data demonstrate that up-regulation or depletion of KIF3a promotes or inhibits cell growth respectively, suggesting that KIF3a up-regulation observed in the majority of PCa probably promotes PCa cell progression.

Figure 2.

Figure 2

Open in a new tab

KIF3a regulates prostate cell proliferation and anchorage-independent cell growth. A: proliferation rate of p69 cells with overexpression of KIF3a versus vector control. The cells were cultured in 96-well plates at a density of 5 × 103/well in 100 µl growth medium after transient transfection of pCMV-KIF3a construct or pCMV vector control. The proliferation of KIF3a-overexpressing cells was measured by MTT assays at the indicated number of days. KIF3a overexpression efficiency was determined using western blotting. β-actin was used as a loading control. Values represent mean ± SD of 3 independent experiments performed in triplicates. *P < 0.05. B: Proliferation rate of LNCaP cells with knockdown of KIF3a versus vector control. LNCaP cells (2 × 105/well) were transducted with two different lentiviral shKIF3a (shKIF3a-1 and shKIF3a-2) or control shRNA and then cultured in 96-well plates at a density of 5 × 103/well in 100 µl growth medium. MTT assay was performed at the indicated time points. Values represent mean ± SD of 3 independent experiments performed in triplicates. *P < 0.05. KIF3a knockdown efficiency was determined using western blotting as shown. C: Quantitative data of soft agar colony formation assay and representative images of colonies by LNCaP cells 16 days post-transduction with two shRNA-targeting KIF3a or negative control. Colonies >50µm in diameter were counted. Data are presented as mean ± SD of 3 independent experiments performed in triplicates.

KIF3a induces PCa cell migration and invasion in vitro

The highest levels of KIF3a observed in metastatic PCa cell lines and in high percentage of metastatic prostate tumor tissues suggest that KIF3a may be involved in PCa metastasis. Therefore, we assessed the effects of KIF3a manipulation on cell migration and invasion by Boyden Chamber assays. Silencing of KIF3a by Lentiviral-KIF3a-shRNA in LNCaP cells reduced cell migration rate by more than 80 percent compared to the control cells (Fig 3A–C). In addition, the invasive capability of the C4-2B cell (a bone metastatic LNCaP-derivative PCa cell line) was reduced by more than 75% when KIF3a was reduced by shRNA compared to the control cells (Fig 3D–F). These results provide evidence that up-regulation of KIF3a may be involved in the metastatic process of PCa.

Figure 3.

Figure 3

Open in a new tab

Effects of KIF3a depletion on PCa cell migration and invasion. A–C: Cell migration analysis of LNCaP cells with lentiviral shRNA-mediated depletion of KIF3a or shRNA control. Cells that migrated through Transwell microporous membrane were fixed in methanol and stained with crystal violet. A. KIF3a knockdown efficiency was determined using western blotting as shown. β-actin was used as a loading control. B. Photos are representative fields of migration cells on the membrane. Scale bars: 100 µm. C. Bar graphs represent the relative fold difference of migrated cell numbers compared to control cells. P < 0.005 compared with shRNA Control-transducted cells. D–F: Effects of KIF3a depletion on invasion of C4-2B cells. C4-2B cells transduced with scramble shRNA, KIF3a shRNA-1 or KIF3a shRNA-2 were plated on Matrigel-coated Transwell filters containing 10% FBS in the bottom well. Cells that migrated through Matrigel-coated Transwell membrane were fixed in methanol and stained with crystal violet. D. KIF3a knockdown efficiency was determined using western blotting as shown. β-actin was used as a loading control. E. Representative images of cells on the Transwell filters. Scale bars: 100 µm. F. The numbers of invading cells were counted and the invasion values are shown as fold change of invading cells relative to control with the means ± SD of three experiments performed in triplicate. P < 0.005 compared with shRNA control cells.

KIF3a activates the Wnt/β-catenin signaling pathway in PCa cells

To determine the potential downstream effectors of the KIF3a signaling which may have contributed to PCa cell proliferation and invasion, we examined the expression levels of β-catenin by western blotting following exogenous KIF3a expression in p69 cells or silencing of KIF3a in LNCaP cells. We found that overexpression of KIF3a in p69 cells induced up-regulation of β-catenin while silencing of KIF3a in LNCaP cells reduces the expression level of β-catenin (Fig. 4A, B). In agreement with the Western blotting data, immunoflueresence analysis indicates that silencing of KIF3a in LNCaP cells reduced β-catenin levels in both the cytoplasm and nuclei (Fig. 4C, D). Moreover, TCF reporter assays showed that overexpression of KIF3a in p69 cells increases TCF activity while silencing of KIF3a in C4-2B cells dramatically reduces TCF reporter activities (Fig. 4E, F). These results indicate that KIF3a contributes to PCa cell proliferation and invasion probably through activation of the Wnt/β-catenin signaling pathway.

Figure 4.

Figure 4

Open in a new tab

KIF3a modulates the expression of β-catenin in PCa cells. A: KIF3a modulates the protein expression of β-catenin. p69 cells were transiently transfected with pCMV-tag2b-KIF3a or pCMV-tag2b vector for 48 hr, and LNCaP cells were transduced with lentiviral shKIF3a or shControl for 48 hr, cells were then collected for Western blot analysis using antibodies as indicated. β-actin was used as a loading control. B: Densitometric quantification of the protein bands of (A) as described in Figure 1. *P<0.05, **P<0.005. C: KIF3a and β-catenin expression was analyzed by immunostaining in C4-2B cell following silencing of KIF3a. C4-2B cells were transduced with lentiviral shKIF3a or shControl for 48 hr, and cells were then immunostained with the indicated antibodies after methanol fixation and permeabilization with 0.5% Triton X-100. DAPI was used to counter stain the nuclei. D: The intensities of immunostained fluorescence in individual cell were measured by ImageJ software and expressed as Relative Fluorescence (Arbitray Units). Figure shows mean ± SD of four independent measurements. * P < 0.05, ** P < 0.005 compared with Control cells. E and F: KIF3a regulates β-catenin/TCF-driven transcription. KIF3a overexpression p69 cell (E), or KIF3a knockdown C4-2B cell (F) were transfected with TOPflash (100ng) and FOPflash (100ng) along with 5ng of pRL-SV40, and luciferase activities were determined 36 hrs after transfection. Renilla luciferase vector was used as an internal control. Normalized luciferase activity of control cells was set to 1, and results are given in relative luciferase activity. Statistics: ** P < 0.005 compared with Control cells.

KIF3a regulates expression levels of Cyclin D1, MMP9, and HEF1 in PCa cells

Cyclin D1 is a Wnt/β-catenin signaling target, and elevation of Cyclin D1 accelerates cell cycle progression and cell proliferation (37, 38). We therefore investigated whether KIF3a regulates the expression of Cyclin D1 in PCa. The results from both Western blot analysis and quantitative real-time RT-PCR analysis indicated that the level of Cyclin D1 was increased in p69 cells ectopically expressing KIF3a but was reduced in LNCaP cells expressing KIF3a specific shRNA (Fig. 5A–D). In addition, cell flow cytometry analysis of LNCaP cells expressing either KIF3a specific shRNA or scramble shRNA demonstrated that KIF3a-dependent down-regulation of Cyclin D1 by KIF3a shRNA increased G0/G1 cell population (Fig. 5E). These results suggest that KIF3a-induced cell proliferation is probably through transactivation of Cyclin D1 due to KIF3a-dependent activation of the Wnt signaling pathway in PCa.

Figure 5.

Figure 5

Open in a new tab

KIF3a regulates MMP9, HEF1 and Cyclin D1 expression in PCa cells. A. Quantitative RT-PCR analysis of MMP9, HEF1 and Cyclin D1 transcripts from p69 cells after overexpression of KIF3a for 48 hrs or from LNCaP cells after KIF3a depletion with lentiviral shKIF3a for 48 hrs. Data represent mean values ± S.D. from three independent experiments. Statistics: * P < 0.05, ** P < 0.005, *** P < 0.001. B. Western blot analysis of whole cell lysates against antibodies as indicated from the same cells described in A. β-actin was used as a loading control. C, D: Quantification of the Western bands of B. All protein levels were normalized to β-actin level. Densitometric quantification of protein was relative to the control set in each case (indicated by a value of percentage). The bar graph represents the mean ± SD of values from three independent experiments. *P<0.05, **P<0.01 and ***P<0.005. E: KIF3a modulates cell cycle progression. LNCaP cells after KIF3a depletion with lentiviral shKIF3a for 48 hrs as described in B were subjected to flow cytometry analysis. Silencing of KIF3a leads to accumulation of LNCaP cells in G0/G1 phase of the cell cycle. On the basis of DNA content, cells in G0/G1 can be distinguished from those in S and G2/M. The percentages of cells in each phase are shown. Values are means ± SD, n = 2. Bars with asterisks are significantly different from control values of the corresponding cell cycle phase, * P < 0.05; ** P < 0.005.

Next, we examined the effect of KIF3a on expression of MMP2/9 and HEF1, the three Wnt signaling targets that have been shown to be involved in cancer cell migration/invasion and are the hallmark of PCa metastasis (39–41). Quantitative RT-PCR analysis showed that the RNA levels of MMP9 and HEF1 were increased in p69 cells following overexpression of KIF3a while being reduced in C4-2B cells following KIF3a depletion by KIF3a shRNA (Fig. 5A). However, no obvious change of MMP2 activity or expression was detected in these cells (data not shown). Protein levels of MMP9 and HEF1 showed the consistent up-/down-regulatory tendency as mRNA level of KIF3a after manipulation of KIF3a expression level except the MMP9 protein was barely detected in p69 cells (Fig 5B–D). Taken together, these data indicate that KIF3a may modulate PCa migration and invasion through Wnt-dependent activation of MMP9 and HEF1 contributing to PCa metastasis.

KIF3a increases DVL2 phosphorylation via CK1 in PCa cells

To understand the mechanism of KIF3a-dependent activation of Wnt signaling, we studied the stability and the phosphorylation of DVL2 in PCa since the increase of DVL2 phosphorylation activates canonical Wnt signaling in PCa (36). We found that the expression of KIF3a in p69 cells increased DVL2 phosphorylation and its protein level (Fig 6A, B). In contrast, silencing of KIF3a in LNCaP cells reduced DVL2 phosphorylation and its protein level (Fig 6A, B). In addition, silencing of DVL2 by DVL2-specific shRNA following overexpression of KIF3a in p69 cells reduced phosphorylation of DVL2 and expression level of β-catenin (Fig 6C, D). Furthermore, we also showed that KIF3a-induced DVL2 phosphorylation is CK1 dependent since treatment of p69 cells overexpressing KIF3a with the CK1 inhibitor D4476 abolished KIF3a-induced DVL2 phosphorylation (Fig. 6E). These results indicate that up-regulation of KIF3a in advanced PCa activates the Wnt signaling pathway probably through induction of CK1-dependent DVL2 phosphorylation.

Figure 6.

Figure 6

Open in a new tab

KIF3a modulates CK1-dependent DVL2 phosphorylation in PCa cells. A. KIF3a induces DVL2 expression and phosphorylation. Western blot analysis of DVL2 in whole cell lysates of the same samples as described in Fig 5A for DVL2 expression and phosphorylation levels. B. Densitometry analysis of protein bands in figure A for DVL2 expression and phosphorylation levels are shown as means ± SD of three independent experiments. *P < 0.05; *** P < 0.001. C, D. β-catenin levels were assessed by Western blot analysis following overexpression of KIF3a and silencing of DVL2 in p69 cells. Levels of phosphorylated DVL2 and β-catenin were normalized to β-actin. Densitometry analyses of protein bands in 6C were displayed as the mean ± SD of values from three independent experiments. **P < 0.005. E. CK1 inhibitor abolishes KIF3a induced DVL2 phosphorylation. Western blot analysis of DVL2 in p69 cells overexpressing KIF3a following starvation and treatment with 100 µM D4476 or vehicle (DMSO) for 2 h. F. Ligand-independent activation of KIF3a-DVL2-β-catenin signaling in PCa. In PCa, KIF3a probably functions as an agonist of the β-catenin/TCF signaling by promoting DVL2 phosphorylation and stabilizing β-catenin in the absence of Wnt stimulation. Subsequently, stabilized β-catenin activates the transcriptional targets, including MMP9, HEF1, and Cyclin D1. Elevation of Cyclin D1 increases PCa cell proliferation and tumorigenesis while elevation of MMP9 and HEF1 contribute to the regulation of PCa cell migration and invasion for potential metastasis of PCa.

Discussion

The Wnt signaling pathway is frequently activated in advanced PCa. But the underlying molecular mechanisms are poorly understood. In this study, we showed for the first time that the motor protein KIF3a is a potent activator of the Wnt signaling pathway in human PCa. We showed that KIF3a is up-regulated in the majority of PCa cell lines and primary tumor tissues. The up-regulation of KIF3a activates the Wnt signaling pathway as demonstrated by increased CK1-dependent DVL2 phosphroylation, β-catenin activation, and increased expression of Wnt signaling target genes such as Cyclin D1. These findings suggest the presence of a novel KIF3a-DVL2-β-catenin axis in human PCa (Fig. 6F). Cyclin D1 is a well-known Wnt target gene. It is often associated with advanced PCa for increasing the proliferative potential of human PCa cells (42). We show that KIF3a modulates Cyclin D1 expression and KIF3a-dependent down-regulation of Cyclin D1 increases cell population in G0/G1 phase. These data provide evidence that up-regulation of KIF3a is one of the molecular mechanisms activating the Wnt signaling pathway in a sub-group of patients with PCa, particularly in advanced PCa.

Metastatic potential is the hallmark of the advanced PCa. Many studies on dysregulation of Wnt signaling in PCa suggest that aberrant activation of β-catenin is correlated with tumor progression and metastasis (11, 43, 44). In this report, we showed that KIF3a regulates PCa cell migration and invasion through KIF3a-dependent activation of MMP-9 and HEF1, which are two Wnt signaling target genes (45, 32). It has been reported that excessive production of MMP-9, the major MMP, correlates with aggressive PCa (46). HEF1, a key protein in cell migration, has recently been shown to promote PCa invasion (47). We showed that KIF3a modulates the expression of MMP9 and HEF1 in metastatic PCa cell lines. Importantly, depletion of KIF3a by shRNA reduced the expression of MMP9, HEF1, and the invasive properties of metastatic C4-2B cells. These data support the notion that KIF3a activates the Wnt signaling pathway, leading to transactivation of MMP-9 and HEF1, and increasing the metastatic potential of PCa.

The association of KIF3a up-regulation with metastatic potential in PCa is also clinically evident in PCa specimens. We observed that among all the PCa cell lines analyzed, the three metastatic PCa cell lines expressed the highest levels of KIF3a (Fig. 1A). Consistently, the highest level expression of KIF3a, shown by strong IHC staining (scored as +3), was detected in a high frequency of tumors with a higher Gleason score (8–10), high TNM grade (T4), and metastasis (Table 1). These data further suggest that up-regulation of KIF3a may associate with PCa aggressiveness and metastasis. However, although the association is statistically significant, the numbers of tissue specimens analyzed in this study is rather small. Further analysis of large sample sets of PCa will be necessary to determine the significance of up-regulation of KIF3a in clinical practice and possible therapeutic interventions for advanced PCa.

In summary, we demonstrated for the first time that KIF3a is a novel agonist of the Wnt signaling pathway in human PCa and an oncoprotein associated with PCa progression and metastasis. KIF3a controls PCa cell proliferation and invasion, at least in part, through the induction of DVL2 phosphorylation and transcriptional activation of three Wnt target genes: Cyclin D1, HEF1, and MMP-9 (Fig. 6F). Furthermore, this study reveals a new molecular mechanism for activation of the Wnt signaling pathway in PCa through the KIF3a-DVL2-β-catenin axis. KIF3a may be a potential therapeutic target for advanced PCa in which Wnt signaling is activated.

Acknowledgements

We would like to thank Dr. Haojie Huang and Dr. Shahriar Koochekpour for providing some of the prostate cell lines. We also thank Ms. Euraque Samantha for critical editing of this manuscript.

Grant Support: This work was supported by National Institutes of Health (NIH) grants R01 CA115555, R01 CA115555-03S1, P20 MD004817, and Research Enhancement Fund from Louisiana State University School of Medicine (to W. Liu).

Footnotes

Disclosure of Potential Conflicts of Interest: No potential conflicts of interest were disclosed.

Reference

  • 1.Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA Cancer J Clin. 2013;63:11–30. doi: 10.3322/caac.21166. [DOI] [PubMed] [Google Scholar]
  • 2.Stark JR, Perner S, Stampfer MJ, Sinnott JA, Finn S, Eisenstein AS, et al. Gleason score and lethal prostate cancer: does 3+4 = 4+3? J Clin Oncol. 2009;27:3459–3464. doi: 10.1200/JCO.2008.20.4669. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Greene KL, Albertsen PC, Babaian RJ, Carter HB, Gann PH, Han M, et al. Prostate specific antigen best practice statement: 2009 update. J Urol. 2013;189(1 Suppl):S2–S11. doi: 10.1016/j.juro.2012.11.014. [DOI] [PubMed] [Google Scholar]
  • 4.Albertsen PC, Hanley JA, Fine J. 20-Year Outcomes Following Conservative Management of Clinically Localized Prostate Cancer. JAMA. 2005;293:2095–2101. doi: 10.1001/jama.293.17.2095. [DOI] [PubMed] [Google Scholar]
  • 5.Uysal-Onganer P, Kawano Y, Caro M, Walker MM, Diez S, Darrington RS, et al. Wnt-11 promotes neuroendocrine-like differentiation, survival and migration of prostate cancer cells. Mol Cancer. 2010;9:55. doi: 10.1186/1476-4598-9-55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Hall CL, Bafico A, Dai J, Aaronson SA, Keller ET. Prostate cancer cells promote osteoblastic bone metastases through Wnts. Cancer Res. 2005;65:7554–7560. doi: 10.1158/0008-5472.CAN-05-1317. [DOI] [PubMed] [Google Scholar]
  • 7.Verras M, Brown J, Li X, Nusse R, Sun Z. Wnt3a growth factor induces androgen receptor-mediated transcription and enhances cell growth in human prostate cancer cells. Cancer Res. 2004;64:8860–8866. doi: 10.1158/0008-5472.CAN-04-2370. [DOI] [PubMed] [Google Scholar]
  • 8.Zhu H, Mazor M, Kawano Y, Walker MM, Leung HY, Armstrong K, et al. Analysis of Wnt gene expression in prostate cancer: mutual inhibition by WNT11 and the androgen receptor. Cancer Res. 2004;64:7918–7926. doi: 10.1158/0008-5472.CAN-04-2704. [DOI] [PubMed] [Google Scholar]
  • 9.de la Taille A, Rubin MA, Chen MW, Vacherot F, de Medina SG, Burchardt M, et al. β-Catenin-related anomalies in apoptosis-resistant and hormone-refractory prostate cancer cells. Clin Cancer Res. 2003;9:1801–1807. [PubMed] [Google Scholar]
  • 10.Chesire DR, Ewing CM, Gage WR, Isaacs WB. In vitro evidence for complex modes of nuclear β-catenin signaling during prostate growth and tumorigenesis. Oncogene. 2002;21:2679–2694. doi: 10.1038/sj.onc.1205352. [DOI] [PubMed] [Google Scholar]
  • 11.Chen G, Shukeir N, Potti A, Sircar K, Aprikian A, Goltzman D, et al. Up-regulation of Wnt-1 and β-catenin production in patients with advanced metastatic prostate carcinoma: potential pathogenetic and prognostic implications. Cancer. 2004;101:1345–1356. doi: 10.1002/cncr.20518. [DOI] [PubMed] [Google Scholar]
  • 12.Morin PJ, Sparks AB, Korinek V, Barker N, Clevers H, Vogelstein B, et al. Activation of beta-catenin-Tcf signaling in colon cancer by mutations in beta-catenin or APC. Science. 1997;275:1787–1790. doi: 10.1126/science.275.5307.1787. [DOI] [PubMed] [Google Scholar]
  • 13.Liu W, Dong X, Mai M, Seelan RS, Taniguchi K, Krishnadath KK, et al. Mutations in AXIN2 cause colorectal cancer with defective mismatch repair by activating beta-catenin/TCF signalling. Nat Genet. 2000;26:146–147. doi: 10.1038/79859. [DOI] [PubMed] [Google Scholar]
  • 14.Jin LH, Shao QJ, Luo W, Ye ZY, Li Q, Lin SC. Detection of point mutations of the Axin1 gene in colorectal cancers. Int J Cancer. 2003;107:696–699. doi: 10.1002/ijc.11435. [DOI] [PubMed] [Google Scholar]
  • 15.He TC, Sparks AB, Rago C, Hermeking H, Zawel L, da Costa LT, et al. Identification of c-MYC as a target of the APC pathway. Science. 1998;281:1509–1512. doi: 10.1126/science.281.5382.1509. [DOI] [PubMed] [Google Scholar]
  • 16.Tetsu O, McCormick F. Beta-catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature. 1999;398:422–426. doi: 10.1038/18884. [DOI] [PubMed] [Google Scholar]
  • 17.Xia D, Holla VR, Wang D, Menter DG, DuBois RN. HEF1 is a crucial mediator of the proliferative effects of prostaglandin E(2) on colon cancer cells. Cancer Res. 2010;70:824–831. doi: 10.1158/0008-5472.CAN-09-2105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Zucker S, Vacirca J. Role of matrix metalloproteinases (MMPs) in colorectal cancer. Cancer Metastasis Rev. 2004;23:101–117. doi: 10.1023/a:1025867130437. [DOI] [PubMed] [Google Scholar]
  • 19.Smalley MJ, Sara E, Paterson H, Naylor S, Cook D, Jayatilake H, et al. Interaction of axin and Dvl-2 proteins regulates Dvl-2-stimulated TCF-dependent transcription. EMBO J. 1999;18:2823–2835. doi: 10.1093/emboj/18.10.2823. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Chesire DR, Ewing CM, Sauvageot J, Bova GS, Isaacs WB. Detection and analysis of beta-catenin mutations in prostate cancer. Prostate. 2000;45:323–334. doi: 10.1002/1097-0045(20001201)45:4<323::aid-pros7>3.0.co;2-w. [DOI] [PubMed] [Google Scholar]
  • 21.Voeller HJ, Truica CI, Gelmann EP. Beta-catenin mutations in human prostate cancer. Cancer Res. 1998;58:2520–2523. [PubMed] [Google Scholar]
  • 22.Huangfu D, Liu A, Rakeman AS, Murcia NS, Niswander L, Anderson KV. Hedgehog signalling in the mouse requires intraflagellar transport proteins. Nature. 2003;426:83–87. doi: 10.1038/nature02061. [DOI] [PubMed] [Google Scholar]
  • 23.Jimbo T, Kawasaki Y, Koyama R, Sato R, Takada S, Haraguchi K, et al. Identification of a link between the tumour suppressor APC and the kinesin superfamily. Nat Cell Biol. 2002;4:323–327. doi: 10.1038/ncb779. [DOI] [PubMed] [Google Scholar]
  • 24.Teng J, Rai T, Tanaka Y, Takei Y, Nakata T, Hirosawa M, et al. The KIF3 motor transports N-cadherin and organizes the developing neuroepithelium. Nat Cell Biol. 2005;7:474–482. doi: 10.1038/ncb1249. [DOI] [PubMed] [Google Scholar]
  • 25.Corbit KC, Shyer AE, Dowdle WE, Gaulden J, Singla V, Chen MH, et al. Kif3a constrains beta-catenin-dependent Wnt signalling through dual ciliary and non-ciliary mechanisms. Nat Cell Biol. 2008;10:70–76. doi: 10.1038/ncb1670. [DOI] [PubMed] [Google Scholar]
  • 26.Qiu N, Xiao Z, Cao L, Buechel MM, David V, Roan E, et al. Disruption of Kif3a in osteoblasts results in defective bone formation and osteopenia. J Cell Sci. 2012;125:1945–1957. doi: 10.1242/jcs.095893. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Hayward SW, Dahiya R, Cunha GR, Bartek J, Deshpande N, et al. Establishment and characterization of an immortalized but non-transformed human prostate epithelial cell line: BPH-1. In Vitro Cell Dev Biol Anim. 1995;31:14–24. doi: 10.1007/BF02631333. [DOI] [PubMed] [Google Scholar]
  • 28.Bae VL, Jackson-Cook CK, Brothman AR, Maygarden SJ, Ware JL. Tumorigenicity of SV40 T antigen immortalized human prostate epithelial cells: association with decreased epidermal growth factor receptor (EGFR) expression. Int J Cancer. 1994;58:721–729. doi: 10.1002/ijc.2910580517. [DOI] [PubMed] [Google Scholar]
  • 29.Bae VL, Jackson-Cook CK, Maygarden SJ, Plymate SR, Chen J, Ware JL. Metastatic sublines of an SV40 large T antigen immortalized human prostate epithelial cell line. Prostate. 1998;34:275–282. doi: 10.1002/(sici)1097-0045(19980301)34:4<275::aid-pros5>3.0.co;2-g. [DOI] [PubMed] [Google Scholar]
  • 30.Jackson CC, Bae VL, Edelman W, Brothman A, Ware J. Cytogenetic characterization of the human prostate cancer cell line P69SV40T and its novel tumorigenic sublines M2182 and M15. Cancer Genet. Cytogenet. 1996;87:14–23. doi: 10.1016/0165-4608(95)00232-4. [DOI] [PubMed] [Google Scholar]
  • 31.Thalmann GN, Anezinis PE, Chang SM, Zhau HE, Kim EE, Hopwood VL, et al. Androgen-independent cancer progression and bone metastasis in the LNCaP model of human prostate cancer. Cancer Res. 1994;54:2577–2581. [PubMed] [Google Scholar]
  • 32.Li Y, Bavaria JH, Wang Z, Guo J, Qian C, Thibodeau SN, et al. HEF1, a novel target of Wnt signalling, promotes colonic cell migration and cancer progression. Oncogene. 2011;30:2633–2643. doi: 10.1038/onc.2010.632. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Guo J, Zheng L, Liu WY, Wang X, Wang Z, French AJ, et al. Frequent truncating mutation of TFAM induces mitochondrial DNA depletion and apoptotic resistance in microsatellite-unstable colorectal cancer. Cancer Res. 2011;71:2978–2987. doi: 10.1158/0008-5472.CAN-10-3482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Leone A, Flatow U, VanHoutte K, Steeg PS. Transfection of human nm23-H1 into the human MDA-MB-435 breast carcinoma cell line: effects on tumor metastatic potential, colonization and enzymatic activity. Oncogene. 1993;8:2325–2333. [PubMed] [Google Scholar]
  • 35.Darzynkiewicz Z, Huang X. Analysis of Cellular DNA Content by Flow Cytometry. Curr Protoc Immunol. 2004;Chapter 5(Unit 5):7. doi: 10.1002/0471142735.im0507s60. [DOI] [PubMed] [Google Scholar]
  • 36.Mimeault M, Batra SK. Recent advances on multiple tumorigenic cascades involved in prostatic cancer progression and targeting therapies. Carcinogenesis. 2006;27:1–22. doi: 10.1093/carcin/bgi229. [DOI] [PubMed] [Google Scholar]
  • 37.Shtutman M, Zhurinsky J, Simcha I, Albanese C, D’Amico M, Pestell R, et al. The cyclin D1 gene is a target of the beta-catenin/LEF-1 pathway. Proc Natl Acad Sci USA. 1999;96:5522–5527. doi: 10.1073/pnas.96.10.5522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Resnitzky D, Gossen M, Bujard H, Reed SI. Acceleration of the G1/S phase transition by expression of cyclins D1 and E with an inducible system. Mol Cell Biol. 1994;14:1669–1679. doi: 10.1128/mcb.14.3.1669. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Trudel D, Fradet Y, Meyer F, Harel F, Tetu B. Significance of MMP-2 expression in prostate cancer: an immunohistochemical study. Cancer Res. 2003;63:8511–8515. [PubMed] [Google Scholar]
  • 40.Saleem M, Kweon MH, Johnson JJ, Adhami VM, Elcheva I, Khan N, et al. S100A4 accelerates tumorigenesis and invasion of human prostate cancer through the transcriptional regulation of matrix metalloproteinase 9. Proc Natl Acad Sci USA. 2006;103:14825–14830. doi: 10.1073/pnas.0606747103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.O'Neill GM, Seo S, Serebriiskii IG, Lessin SR, Golemis EA. A new central scaffold for metastasis: parsing HEF1/Cas-L/NEDD9. Cancer Res. 2007;67:8975–8979. doi: 10.1158/0008-5472.CAN-07-1328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Drobnjak M, Osman I, Scher HI, Fazzari M, Cordon-Cardo C. Overexpression of cyclin D1 is associated with metastatic prostate cancer to bone. Clin Cancer Res. 2000;6:1891–1895. [PubMed] [Google Scholar]
  • 43.Culig Z, Hobisch A, Hittmair A, Peterziel H, Cato AC, Bartsch G, et al. Expression, structure, and function of androgen receptor in advanced prostatic carcinoma. Prostate. 1998;35:63–70. doi: 10.1002/(sici)1097-0045(19980401)35:1<63::aid-pros9>3.0.co;2-i. [DOI] [PubMed] [Google Scholar]
  • 44.Hall CL, Keller ET. The role of Wnts in bone metastases. Cancer Metastasis Rev. 2006;25:551–558. doi: 10.1007/s10555-006-9022-2. [DOI] [PubMed] [Google Scholar]
  • 45.Wu B, Crampton SP, Hughes CC. Wnt signaling induces matrix metalloproteinase expression and regulates T cell transmigration. Immunity. 2007;26:227–239. doi: 10.1016/j.immuni.2006.12.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Zhong WD, Han ZD, He HC, Bi XC, Dai QS, Zhu G, et al. CD147, MMP-1, MMP-2 and MMP-9 protein expression as significant prognostic factors in human prostate cancer. Oncology. 2008;75:230–236. doi: 10.1159/000163852. [DOI] [PubMed] [Google Scholar]
  • 47.Guo W, Ren D, Chen X, Tu X, Huang S, Wang M, et al. HEF1 promotes epithelial mesenchymal transition and bone invasion in prostate cancer under the regulation of microRNA-145. J Cell Biochem. 2013;114(7):1606–1615. doi: 10.1002/jcb.24502. [DOI] [PubMed] [Google Scholar]

RESOURCES