Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Apr 29.
Published in final edited form as: Ticks Tick Borne Dis. 2012 Dec 29;4(0):110–119. doi: 10.1016/j.ttbdis.2012.09.005

Anaplasma odocoilei sp. nov. (family Anaplasmataceae) from white-tailed deer (Odocoileus virginianus)

Cynthia M Tate a,1, Elizabeth W Howerth b, Daniel G Mead a,*, Vivien G Dugan a,2, M Page Luttrell a, Alexandra I Sahora a,3, Ulrike G Munderloh c, William R Davidson a,d, Michael J Yabsley a,d,*
PMCID: PMC4003554  NIHMSID: NIHMS572720  PMID: 23276749

Abstract

Recently, an undescribed Anaplasma sp. (also called Ehrlichia-like sp. or WTD agent) was isolated in ISE6 tick cells from captive white-tailed deer. The goal of the current study was to characterize this organism using a combination of experimental infection, morphologic, serologic, and molecular studies. Each of 6 experimentally inoculated white-tailed deer fawns (Odocoileus virginianus) became chronically infected (100+ days) with the Anaplasma sp. by inoculation of either infected whole blood or culture. None of the deer showed evidence of clinical disease, but 3 of the 6 deer evaluated had multiple episodes of transient thrombocytopenia. Light microscopy of Giemsa-stained, thin blood smears revealed tiny, dark, spherical structures in platelets of acutely infected deer. Anaplasma sp. was detected in platelets of inoculated deer by polymerase chain reaction, transmission electron microscopy, immunohistochemistry, and in situ hybridization. Five of 6 deer developed antibodies reactive to Anaplasma sp. antigen, as detected by indirect fluorescent antibody testing. Phylogenetic analyses of 16S rRNA, groESL, and gltA sequences confirmed the Anaplasma sp. is related to A. platys. Two attempts to transmit the Anaplasma sp. between deer by feeding Amblyomma americanum, a suspected tick vector, were unsuccessful. Based on its biologic, antigenic, and genetic characteristics, this organism is considered a novel species of Anaplasma, and the name Anaplasma odocoilei sp. nov. is proposed with UMUM76T (=CSUR-A1) as the type strain.

Keywords: Anaplasma, Cervid, Novel species, White-tailed deer

Introduction

In the United States, white-tailed deer (WTD; Odocoileus virginianus) are infected with multiple tick-transmitted rickettsiae in the genera Ehrlichia and Anaplasma (Lockhart et al., 1997a; Little et al., 1998; Yabsley et al., 2002, 2008a). Three species, E. chaffeensis, E. ewingii, and Anaplasma (A.) phagocytophilum are zoonotic pathogens and infect a wide range of mammalian species (Dumler et al., 2001). A fourth organism, detected by PCR in the blood of wild WTD, has been referred to as WTD agent or Ehrlichia sp. of WTD (Dawson et al., 1996; Little et al., 1997) and was recently isolated in tick cell culture and identified as a member of the genus Anaplasma (Munderloh et al., 2003).

This Anaplasma sp. is common among white-tailed deer populations in the southeastern United States and has been reported from Georgia, Oklahoma, Nebraska, Virginia, and Missouri (Little et al., 1997; Lockhart et al., 1997b; Arens et al., 2003; Yabsley, unpublished). A closely-related species has been detected in mule deer (O. hemionus hemionus) and black-tailed deer (O. hemionus columbianus) from California (Foley et al., 1998; Yabsley et al., 2005) and mule deer and white-tailed deer from Arizona (Yabsley et al., 2005). However, additional data are needed to determine if this Anaplasma represents a variant of the Anaplasma sp. detected in white-tailed deer in the southeastern United States. In the southeastern United States, it has significant temporal and spatial associations with lone star tick (Amblyomma americanum) infestation (Brandsma et al., 1999). Additionally, this Anaplasma sp. has been detected by polymerase chain reaction (PCR) in field-collected Amblyomma americanum ticks from Missouri (GenBank accession number ELU52514). These previous studies suggest that this Anaplasma sp. infects white-tailed deer and could be transmitted by Amblyomma americanum, similar to 2 important zoonotic rickettsiae, E. chaffeensis and E. ewingii (Ewing et al., 1995; Little et al., 1998; Yabsley et al., 2003). The significance of this organism as a pathogen of deer or as a potential zoonotic agent is currently unknown. Previous analysis of partial 16S rRNA and GroESL gene sequences of this Anaplasma sp. indicates that it is most closely related to A. platys, a canine rickettsia that infects platelets of dogs and potentially humans (Dawson et al., 1996; Arraga-Alvarado et al., 1999; Dumler et al., 2001; Sumner et al., 2003).

In the current study, we experimentally infected deer with this Anaplasma sp. in order to (i) investigate infection dynamics and cellular tropism of this organism in vivo, (ii) conduct a small-scale Amblyomma americanum transmission study, and (iii) more fully characterize the morphologic, molecular, and antigenic relationships of this so far undescribed Anaplasma sp.

Materials and methods

Experimental animals and procedures

Nine orphaned white-tailed deer fawns (WTD76, 77, 81, 86, 128, and 135, and Deer 1, 2, and 3) were hand-raised and housed in a tick-free building at the College of Veterinary Medicine, UGA, Athens, GA. Fawns were acquired within 1–3 days of birth, and prior to inoculation, tested negative for E. chaffeensis, E. ewingii, A. phagocytophilum, and the Anaplasma sp. by PCR and negative for antibodies to E. chaffeensis and A. phagocytophilum by indirect fluorescent antibody (IFA) assays as described (Dawson et al., 1994, 1996; Lockhart et al., 1997a; Little et al., 1998; Yabsley et al., 2002; Munderloh et al., 2003). For inoculations, deer were anesthetized by intramuscular injection of 1.7 mg/kg of xylazine (Mobay Corporation, Shawnee, KS) and 0.1 mg/kg ketamine (Fort Dodge Laboratories Inc., Fort Dodge, IA) and reversed with 1.3 mg/kg of yohimbine (Lloyd Laboratory, Shenandoah, IA).

Following inoculation, whole blood was collected periodically for PCR, serologic tests, and blood smears. Complete physical examination of each deer was performed at each blood collection date (Blood et al., 1983). Periodically, whole-blood anticoagulated in ethylenediaminetetraacetic acid (EDTA) from WTD76, WTD81, and WTD77 was submitted to the Clinical Pathology Laboratory, College of Veterinary Medicine, The University of Georgia, for analysis of the following parameters: hematocrit, erythrocyte count, hemoglobin levels, platelet count, total and differential leukocyte counts, and fibrinogen. At the end of the study, all deer were anesthetized as described above, euthanized via intravenous sodium pentobarbital overdose, and a necropsy performed. All procedures were approved by the UGA Institutional Animal Care and Use Committee (A2004-10136).

To detect Anaplasma sp. in blood of experimental deer and ticks, RNA was extracted from whole blood with the RNA Blood Minikit (Qiagen, Inc., Valencia, CA) and ticks with the QiAmp® Viral RNA Extraction Kit (Qiagen). For ticks, individuals were frozen in liquid nitrogen and then macerated with glass beads in a Mini Beadbeater-8 (Biospec Products, Inc., Bartlesville, OK). Reverse transcriptase (RT)-nested PCR (nPCR) assays for the 16S rRNA and groESL genes were performed as described (Munderloh et al., 2003; Tate et al., 2005); except that for the groESL assay, secondary amplification was performed using primers EDF10 and EDR11 (Sumner et al., 2003) (Table 1). As a control for the quality of the RNA preparations from frozen ticks, a random subset were tested for the presence of tick RNA using primers 16S+1 and 16S−1 (Table 1) which amplify a fragment of the tick mitochondrial 16S rRNA (Norris et al., 1999). Amplification products were separated by electrophoresis in a 2% agarose gel stained in ethidium bromide and visualized using ultraviolet transillumination.

Table 1.

Oligonucleotide sequences of primers used in this study.

Primer pair Gene target Target organism(s) Nucleotide sequence (5′ → 3′) Product size (bp) References
ECC
ECB		 16S rRNA Anaplasma and Ehrlichia spp. CGTATTACCGCGGCTGCTGGCA
AGAACGAACGCTGGCGGCAAGCC		 480 Dawson et al. (1994)
GE9F
GA1UR		 16S rRNA A. phagocytophilum and Anaplasma sp. UMUMT AACGGATTATTCTTTATAGCTTGCT
GAGTTTGCCGGGACTTCTTCT		 411 Chen et al. (1994) and Little et al. (1997)
DGA
GA1UR		 16S rRNA Anaplasma sp. UMUMT TTATCTCTGTAGCTTGCTACG
GAGTTTGCCGGGACTTCTTCT		 411 Little et al. (1997)
DGA
T7-398R		 16S rRNA Anaplasma sp. UMUMT TTATCTCTGTAGCTTGCTACG
T7-GCATAGCTGGATCAGGCTTTC		 325 Dawson et al. (1994) and Little et al. (1997)
APF1
APR1		 groESL A. phagocytophilum and Anaplasma sp. UMUMT TAGTGATGAAGGAGAGTGAC
CCAGGIGCCTTIACAGCWGCAAC		 1603 Sumner et al. (2003)
EDF10
EDR11		 groESL Anaplasma sp. UMUMT GATTCTCCGGTTTGTTCTGT
GGAGAAAGATAACCCCTG		 650 Sumner et al. (2003)
F4b
HG1085R		 gltA Anaplasma and Ehrlichia spp. CCGGGTTTTATGTCTACTGC
ACTATACCKGAGTAAAAGTC		 935 Inokuma et al. (2001, 2002)
16S+1
16S−1		 16S rRNA Tick CCGGTCTGAACTCAGATCAAGT
CTGCTCAATGATTTTTTAAATTGCTGTGG		 460 Norris et al. (1999)
Open in a new tab

Experimental inoculation trials

Details of fawn numbers and source of infections are summarized in Table 3. Briefly, two 4-month-old fawns (WTD76 and WTD81) became infected with the Anaplasma sp. after inoculation with blood collected from field-collected deer as described (Yabsley et al., 2002; Munderloh et al., 2003). Whole blood (8.0 ml) in EDTA collected from WTD 76, the original source of UMUM76T, at 177 DPI was used to inoculate one 10-month-old deer (WTD 77) by each of 4 routes (2 ml each): intradermal, subcutaneous, intravenous, and intraperitoneal (ID, SQ, IV, IP). A 13-month-old deer (WTD 86) and a 6-month-old deer (WTD135) were inoculated with 1 × 106 Anaplasma sp. UMUM76T-infected ISE6 tick cells (passage 7 and passage 14, respectively). A fourth deer, a 5-month-old fawn (WTD 128), subsequently was inoculated with whole blood collected from WTD 86 at 189 DPI in the same manner as WTD 77.

Table 3.

RT-nPCR detection of Anaplasma sp. UMUM76T in blood of experimentally inoculated deer.

WTDa Source of infection DPIb first tested DPI first PCR positive No. of times positive/no. of times sampled DPI last tested
76 Wild deer bloodc 2 5 35/36 250
81 Wild deer bloodc 2 2 22/22 117
77 Blood from WTD76 10 10 13/13 252
86 Tick cell isolate (UMUM76T) 12 12 8/8 214
128 Blood from WTD86 4 4 5/9 153
135 Tick cell isolate (UMUM76T) 15 15 5/9 129
Open in a new tab
a

WTD, white-tailed deer.

b

DPI, days post inoculation.

c

Details of inoculation are given in Munderloh et al. (2003).

Biomagnetic blood cell fractionation with Dynabeads

Whole blood in sodium citrate Vacutainer tubes (Beckton Dickinson, Rutherford, NJ) obtained from WTD76 and WTD81 was centrifuged at 50 × g for 20 min. The platelet-rich plasma (PRP) was removed, centrifuged at 800 × g for 25 min, and the pellet was resuspended in Dulbecco’s phosphate buffered saline (DPBS; Sigma, St. Louis, MO) at a concentration of 1 × 107 cells/ml.

Dynabeads® (Dynal Biotech, Brown Deer, WI) were prepared through a series of washes using DPBS (pH 7.4) with 0.1% bovine serum albumin (BSA) solution, using the Magnetic Particle Concentrator (MPC) magnet (Dynal) to sequester beads after each wash. Subsequently, sheep anti-rabbit IgG beads were coated with anti-P-selectin (CD62P) polyclonal rabbit antibody (PharMingen, San Diego, CA) for platelet fractionation. Beads were incubated with the antibody overnight on a rocking plate at 4 °C and then washed 3 times with 0.1% BSA solution, removing the beads after each wash using the MPC magnet.

Platelet preparations were purified by incubating 250 μl of PRP for 24 h at 4 °C with 6 μl of CD62P antibody-coated beads followed by a second 24-h incubation of the non-target cell-depleted sample with 6 μl of the antibody-coated beads. The pellet was washed 3 times with and resuspended in 0.1% BSA solution. To detect the Anaplasma sp., DNA was extracted (DNeasy, Qiagen), and PCR targeting the 16S rRNA gene was conducted as described.

Electron microscopy

Transmission electron microscopy (TEM) was completed on PRP collected from WTD76, WTD81, and WTD86. PRP was obtained from citrate anticoagulated blood as described above. The platelets were pelleted and fixed in either 2% glutaraldehyde–2% (para)formaldehyde–0.2% picric acid in 0.1 M cacodylate–HCl buffer (pH 7.0–7.3) or 2% (para)formaldehyde–2% glutaraldehyde in phosphate buffer (pH 7.0). Pellets of fixed platelets were enrobed in agar, routinely embedded in Epon-Araldite (EMS, Hatfield, PA), and ultrathin sections were stained with Reynold’s lead citrate and 5% methanolic uranyl acetate and viewed with a JEOL JSM-1210 transmission electron microscope.

Immunohistochemistry

To localize the Anaplasma sp., immunohistochemistry (IHC) was conducted on platelets collected fromWTD135 on DPI 129. PRP was obtained as described above, pelleted by centrifugation, and the pellet of platelets was fixed in 10% buffered formalin, enrobed in agarose, and routinely embedded in paraffin. Briefly, 3-μm sections of formalin-fixed paraffin embedded tissue (PET) were deparaffinized and rehydrated. Sections were blocked with Universal Blocking Reagent (BioGenex, San Ramon, CA) for 7 min. Polyclonal primary antibody was prepared using precipitated pre-and post-inoculation (71 DPI) serum from WTD86. Sections were incubated with the primary antibody at a 1:100 dilution in Dako-Cytomation Antibody Diluent (DakoCytomation, Carpinteria, CA) for 60 min and then incubated with 1:20 peroxidase-labeled rabbit anti-deer IgG (KPL, Gaithersburg, MD) for 30 min. Sections were then treated with supersensitive link biotinylated anti-rabbit immunoglobulins (BioGenex) for 20 min, followed by supersensitive label alkaline phosphatase-conjugated streptavidin (BioGenex) and Fast Red (DAKO, Carpinteria, CA). Sections were counterstained with Mayer’s hematoxylin.

In situ hybridization assay

The 16S rRNA riboprobe was generated from hemi-nested RT-PCR products amplified from the Anaplasma sp. by use of an interior reverse primer with an RNA polymerase promoter sequence. The primers were A. phagocytophilum- and Anaplasma sp.-specific primers GE9F and GA1UR in the primary reaction (Chen et al., 1994; Little et al., 1997), and DGA (Little et al., 1997) and T7-398R in the secondary reaction (Table 1). The primer T7-398R was complementary to 16S rRNA and had T7 promoter sequence at the 5′ end (Table 1) (Dawson et al., 2001). DNA was amplified from Anaplasma sp. UMUM76T-infected tick cells, and the digoxigenin-labeled RNA probe was generated as described (Dawson et al., 2001).

In situ hybridization assays using the digoxigenin-labeled riboprobe and a biotin-streptavidin method were performed. Briefly, 3-μm sections of formalin-fixed paraffin-embedded pelleted platelets from WTD135 (129 DPI) were deparaffinized and rehydrated. Tissue proteases were digested in PK Buffer (Dawson et al., 2001) for 30 min. Sections were then post-fixed with 4% paraformaldehyde (J.T. Baker Chemical Co., Phillipsburg, NJ) in DPBS, acetylated with fresh 0.25% acetic anhydride (Sigma) in 0.1 M triethanolamine (J.T. Baker), and denatured with 70% deionized formamide (DFA; Sigma) in 2× saline sodium citrate (SSC; Roche, Switzerland). Slides were prehybridized with Dig Easy Hyb Buffer (Boehringer Mannheim, Germany) at 42 °C for 30 min. The RNA probe was diluted to 100 ng/ml in Dig Easy Hyb Buffer, denatured, and then applied to sections. Sections were covered with ApopTag™ Plastic Coverslips (ONCOR, Gaithersburg, MD) and hybridized overnight at 42 °C in a humidified chamber. Slides were then washed twice in 50% DFA/2× SSC at 52 °C, followed by 2 washes with 2× SSC at room temperature. Sections were then blocked with 10% goat serum. Mouse anti-digoxigenin antibodies (Roche) diluted to 0.4 μg/ml were applied to the sections for 60 min and detected by serial application of goat anti-mouse biotinylated immunoglobulins (Biogenex), streptavidin alkaline phosphatase (Biogenex), and naphthol fast red substrate (DAKO). Sections were counterstained in Mayer’s hematoxylin (DAKO) and mounted with Supermount Permanent Aqueous Mounting Adhesive (Biogenex). All steps were carried out at room temperature unless otherwise noted. All solutions were formulated with diethylpyrocarbonate (DEPC; Sigma)-treated deionized water and autoclaved prior to use. All antibodies were diluted with DakoCytomation Antibody Diluent (DAKO).

Indirect fluorescent antibody assays

Actively growing (3–4 days after passage) ISE6 tick cells infected with Anaplasma sp. isolate UMUM76T were gently rinsed with and then resuspended in DPBS to obtain a concentration of approximately 5 × 105 cells/ml. Slides were prepared as described (Yabsley et al., 2008b) except that before use, antigen slides were treated with 0.1 mg/ml Proteinase K (Sigma) for 2 min and then rinsed twice in DPBS for 5 min. IFA assays for antibodies reactive to the Anaplasma sp. in the serum of experimentally-inoculated deer were conducted as described (Munderloh et al., 2003; Tate et al., 2005). A. phagocytophilum and E. chaffeensis IFA assays were conducted using commercially available antigen slides (Focus Technologies, Inc., Cypress, CA) (Munderloh et al., 2003). A. marginale IFA assays were conducted with the St. Marie isolate propagated in ISE6 tick cells as antigen prepared as described above except that a blocking step, using 10% non-fat dry milk in DPBS, was added before primary antibody incubation. For IFA cross-reactivity, we used white-tailed deer antisera to A. phagocytophilum, E. chaffeensis, and A. marginale from previous experimental infection studies in our laboratory (Keel et al., 1995; Dugan et al., 2004; Tate et al., 2005).

Tick transmission trials

Laboratory-reared Amblyomma americanum nymphs (Oklahoma State University, Stillwater, OK) were placed in tick containment chambers adhered to areas of shaved skin on donor and recipient deer. Pools of nymphs were tested for the Anaplasma sp. using RT-PCR and shown to be negative. Briefly, 2 separate transmission trials were conducted in which Amblyomma americanum nymphs were first acquisition-fed on Anaplasma sp.-positive donor deer (on WTD76 at 119 DPI; on WTD135 at 41 DPI), allowed to molt, and then transmission-fed on 3 naïve recipient deer (Deer 1, 2, and 3). At the time of feeding, WTD135 was RT-nPCR- and culture-positive for the Anaplasma sp. For each trial, RT-nPCR was performed on multiple blood samples of recipient deer and on a subset of the adult ticks that had acquisition-fed on positive deer as nymphs.

Phylogenetic analysis

Partial 16S rRNA, groESL, citrate synthase (gltA), and RNA polymerase β-subunit (rpoB) genes were amplified and sequenced from the Anaplasma sp. UMUM76T (Inokuma et al., 2001, 2002; Taillardat-Bisch et al., 2003; Kawahara et al., 2004). Resulting sequences were aligned with those from related organisms in GenBank using ClustalX and the 16S rRNA, groESL, and gltA sequences were concatenated for phylogenetic analyses which were conducted with the MEGA program using the neighbor-joining algorithm with the Kimura 2-parameter model (Kumar et al., 2001) (GenBank numbers provided in Table 2).

Table 2.

GenBank accession numbers used in phylogenetic analyses.

Organism 16S rRNA groESL gltA
Anaplasma sp. UMUMT JX876644 JX876642 DQ020101
Anaplasma platys AF536828 AY044161 AB058782
Anaplasma phagocytophilum AY055469 AF172161 AF304136
Anaplasma marginale AF309867 AF414865 AF304140
Ehrlichia ruminantium X62432 U13638 AF304146
Ehrlichia ewingii EEU96436 AF195273 DQ365879
Ehrlichia chaffeensis AF147752 L10917 AF304142
Ehrlichia canis AF373613 U96731 AF304143
Neorickettsia sennetsu M73225 ESU88092 AF304148
Open in a new tab

Results

Infection dynamics and clinical outcome

All 6 deer experimentally inoculated with the Anaplasma sp. became infected and remained infected, as determined by RT-nPCR of blood, at every sampling date for 100–200+ days until euthanasia (Table 3). Light microscopy of Giemsa-stained thin blood smears of acutely infected deer revealed tiny, dark, spherical structures in platelets consistent with Anaplasma inclusions. Clinical signs of illness (i.e., fever, body condition, activity level) were not apparent in any of the infected deer. All 3 deer for which platelet counts were performed experienced 2–4 episodes of transient thrombocytopenia (fewer than 100 × 103 platelets/μl blood) during the time period (duration 75–245 days) in which platelets were measured. Thrombocytopenia occurred as early as 13 DPI, as late as 187 DPI, and at intervals of 21–65 days. Mean platelet counts (excluding values <100 × 103) were 619, 419, and 363 × 103/μl blood for WTD76, WTD77, and WTD81, respectively. For comparison, the mean platelet count of 5 age-matched white-tailed deer not infected with the Anaplasma sp., but that were housed, anesthetized, and sampled in a similar manner was 685 × 103/μl blood (Tate et al., 2005). No gross or histopathologic lesions were apparent in any of the deer.

Antibody responses of infected deer

At 72 DPI, serum from WTD86 reacted with individual organisms and clusters of organisms and had a reproducible titer of 1:128 (Fig. 1). The negative control antiserum (WTD128; pre-inoculation) showed no specific fluorescence at dilutions ≥1:32 on repeated testing. Neither pre-immune sera nor the Anaplasma sp. antisera showed reactivity with uninfected ISE6 tick cells. Five of 6 experimentally-inoculated deer developed antibody titers ≥64 (seropositive cut-off) between 2 and 4 weeks post inoculation, and 2 deer remained seropositive until they were euthanized at 36 weeks (Fig. 2). Peak titer was 512 and gross mean titer was 151.

Fig. 1.

Fig. 1

Open in a new tab

In situ hybridization and immunohistochemical localization of Anaplasma sp. UMUM76T in infected tick cell culture and platelets of experimentally infected deer. Signal appears as minute red dots within cells. Results of in situ hybridization (ISH) assays (top), on infected tick cell culture control (A) and platelets of WTD135 (129 DPI) (D). Results of immunohistochemistry (IHC) assays (bottom), on infected tick cell culture control (C) and platelets of WTD135 (129 DPI) (E). Result of indirect fluorescent antibody assay (B) performed on tick cell culture antigen slides using WTD86 (71 DPI) serum at a dilution of 1:64.

Fig. 2.

Fig. 2

Open in a new tab

Antibody response of deer experimentally infected with the Anaplasma sp. UMUM76T, as determined by IFA. (A) Animals inoculated with blood from infected deer. (B) Animals inoculated with tick cell isolate UMUM76T or with blood from animals inoculated with UMUM76T.

Immunologic cross-reactivity

Two Anaplasma sp. antisera from WTD 86 (titer 512) and 135 (titer 256) were tested for serologic cross-reactivity with related organisms. WTD86 serum only reacted weakly with A. marginale antigen (titer 64), and no reaction was noted with E. chaffeensis or A. phagocytophilum antigens. A. phagocytophilum antisera (titers 256 and 2048) reacted weakly with both the Anaplasma sp. UMUM76T antigen and with A. marginale antigen (titers of 64 each). Two E. chaffeensis antisera (titers of 1024) and 2 A. marginale antisera (titers of 128 and 512) did not react with Anaplasma sp. UMUM76T antigen.

Cellular tropism and ultrastructure

Antibody-coated magnetic bead-purified platelets from WTD76 and WTD81 were PCR-positive for the Anaplasma sp. in 15 of 16 samples. Immunohistochemistry demonstrated antigen reactive to the Anaplasma sp. immune sera in platelets of WTD135 (Fig. 1) that appeared as eccentrically located, densely stained, minute red dots. Positive reactivity of infected platelets was not apparent with non-immune serum. In situ hybridization demonstrated RNA of the Anaplasma sp. in platelets of WTD135 (Fig. 1) appearing as eccentrically located, densely stained, minute red dots within platelets. Positive reactivity of infected platelets was absent when DigEasy-Hyb without template RNA was used.

Ultrastructurally, platelets of deer infected via both blood (WTD76 and WTD81) and UMUM76T culture (WTD86) contained Anaplasma-like organisms (Figs. 3 and 4). Infected platelets contained one to several organisms in individual membrane-bound vacuoles or 2–5 organisms in a single large membrane-bound vacuole (Fig. 3). The single organisms were spherical, ranged from 0.250 to 0.786 μm (n = 8) in diameter, and typically tightly filled the vacuole (Fig. 4A and B). Organisms were surrounded by 2 smooth-contoured trilaminar membranes, one protoplasmic and one cell wall, with a very narrow intervening periplasmic space. Peripherally, organisms had a rim of electron-dense granular material and centrally were either relatively electron-lucent with dispersed fibrillar material or moderately electron-dense with uniformly dispersed fibrillar and granular material. Vacuoles containing multiple organisms (morulae) were irregularly spherical, approximately 1.0–1.15 μm in greatest diameter (n = 5) and contained loosely packed organisms that varied in size, shape, and protoplasmic characteristics (Fig. 4C and D). These organisms were either spherical, 0.250–0.675 μm in diameter (n = 8), or ovoid, 0.250–0.450 μm in width and 0.450–0.675 μm in length (n = 4), and were surrounded by 2 relatively smooth-contoured trilaminar membranes with a small periplasmic space. Larger organisms had central moderately electron-dense protoplasm with evenly distributed fibrils and clumps of electron-dense densely granular material and a peripheral rim of more electron-dense granular material. As organisms decreased in size there was condensation of the fibrils and granular material making the protoplasm diffusely more electron-dense with the eventual formation of an eccentric electron-dense condensation. Overlying these condensations, the periplasmic space was enlarged. The vacuolar matrix was generally electron-lucent, but had a few small bits of moderately electron-dense fibrillar material.

Fig. 3.

Fig. 3

Open in a new tab

Transmission electron micrograph of white-tailed deer platelets from WTD81 at 20 DPI. One platelet contains a single organism (arrow), and one has a membrane-bound morula loosely filled with 3 organisms (1, 2, 3). Bar = 0.2 μm. Lead citrate/uranyl acetate.

Fig. 4.

Fig. 4

Open in a new tab

Transmission electron micrograph of white-tailed deer platelets. (A) Platelet from WTD86 at 33 DPI containing single reticulated form of the organism (R) tightly filling a membrane-bound vacuole. Note electron-lucent center primarily containing a few DNA fibrils and peripheral granular layer of ribosomes. Inset is enlargement of square showing membrane of vacuole (long black arrow) and the 2 trilaminar membranes surrounding the organism (2 short white arrows) separated by narrow periplasmic space (long white arrow). The platelet contains normal platelet alpha granules (A). Bar = 0.1 μm. (B) Platelet from WTD81 at 20 DPI containing single reticulated form of the organism (R) tightly filling a membrane-bound vacuole. The center of this organism is denser due to the fairly evenly distributed DNA fibrils and clumps of ribosomes. The platelet contains normal platelet alpha granules (A). Bar = 0.1 μm. (C) Platelet from WTD76 at 20 DPI as seen on edge. A membrane-bound morula loosely filled with 3 organisms forms a bulge in the platelet (arrow). The organisms are surrounded by 2 membranes and have fairly evenly dispersed DNA fibrils and ribosomal aggregates. Bar = 0.2 μm. (D) Platelet from WTD81 at 20 DPI containing a morula loosely filled with 5 organisms. The matrix of the membrane-bound vacuole is electron-lucent and contains a small amount of fibrillar material. Organisms are bound by 2 trilaminar membranes, and there is an eccentric electron-dense condensation in 3 of the organisms. The periplasmic space is enlarged over the condensation (arrow). Bar = 0.1 μm. Lead citrate/uranyl acetate.

Phylogenetic analysis

The UMUM76T partial 16S rDNA sequence (1403 bp) was identical to sequences previously amplified from this Anaplasma sp. from deer in Georgia and Oklahoma (100% similarity of overlapping 1163 bp; U27101–U27104) and an Anaplasma sp. from a pool of Amblyomma americanum ticks from Missouri (99.8% similarity, 1403 bp, ELU52514) followed by A. platys (98.2%, EF139459). Sequences of groESL (1603 bp) and gltA (912 bp, DQ020101) were most similar to A. platys with 69.6–70% and 83.2–83.3% similarity to numerous strains of A. platys. Phylogenetic analysis of the 16S rRNA, groESL, and gltA concatenated sequences (3502 bp) confirmed the close relationship of the Anaplasma sp. with A. platys (Fig. 5). Phylogenies of each individual gene confirmed the result of the concatenated sequence analysis (data not shown). A sequence of the rpoB gene was not available for A. platys for comparison, but the Anaplasma sp. UMUM76T sequence (1722 bp) was 80.1% similar to A. phagocytophilum (AF237414), 76% similar to A. centrale (CP001759), 75.2% similar to A. marginale (CP001079), 70% similar to E. chaffeensis (CP000236), and 60.4% similar to Neorickettsia risticii (CP001431).

Fig. 5.

Fig. 5

Open in a new tab

Phylogenetic analysis of the 16S rRNA, groESL, and gltA concatenated sequences (3502 bp) of the Anaplasma sp. UMUM76T and related organisms. Numbers at nodes indicate levels of bootstrap support based on 500 replicates.

Tick transmission trials

Attempts to transmit the Anaplasma sp. to naïve deer using Amblyomma americanum nymphs acquisition-fed on infected deer were unsuccessful in 2 separate trials, as determined by RT-nPCR of blood samples on multiple days post tick infestation (Table 4). In addition, 10 and 20 adult ticks from WTD76 and WTD135, respectively, were RT-nPCR-negative.

Table 4.

Attempted transmission trials of Anaplasma sp. UMUM76T between white-tailed deer (Odocoileus virginianus) with Amblyomma americanum.

Acquisition deer No. of nymphs fed/no. molted to adults Transmission deer No. of adult ticks fed per deer/no. that fed to repletion No. of times transmission deer were tested by PCR (during days post tick infestation)
WTD76 103/55 Deer 1 45/21 6 (13–79)
WTD135 390/222 Deer 2 102/10 8 (4–60)
Deer 3 100/17 8 (4–74)
Open in a new tab

Discussion

Numerous studies have detected a previously undescribed Anaplasma sp. in white-tailed deer throughout the southeastern United States (Little et al., 1997; Lockhart et al., 1997b). An identical, or closely related, organism has been detected in Odocoileus spp. from the western United States (Foley et al., 1998; Yabsley et al., 2005). Recently, the Anaplasma sp. was isolated in tick cells (Munderloh et al., 2003). In the current study, we determined that white-tailed deer were experimentally susceptible to a recently obtained isolate of the Anaplasma sp. (strain UMUM76T), that they developed a detectable antibody response following infection, and that the Anaplasma sp. infected platelets. In addition, phylogenetic analyses of multiple gene targets indicated that the Anaplasma sp. was most similar to A. platys, another platelet-dwelling rickettsia. Two attempts to transmit the organism between deer with feeding Amblyomma americanum failed. Because of the unique cellular tropism and host and molecular analyses, we propose the name Anaplasma odocoilei sp. nov.

All 6 deer exposed to the Anaplasma sp. UMUM76T, whether by infected whole blood or culture, became persistently infected for more than 100 days, and 3 maintained infections for over 200 days. It has been suggested that low-level persistent infection is a common feature of Anaplasma species (Palmer et al., 1998), documented in cattle infected with A. marginale (Eriks et al., 1989), goats infected with A. ovis (Ndung’u et al., 1995; Palmer et al., 1998), rodents, dogs, and sheep infected with A. phagocytophilum (Engvall et al., 2000; Castro et al., 2001; Stuen and Bergström, 2001), and dogs infected with A. platys (Harvey et al., 1978; Engvall et al., 2000). Similar to dogs infected with A. platys (Harvey et al., 1978), infected deer revealed no apparent clinical signs of illness despite 2–4 episodes of thrombocytopenia.

Phylogenetic analyses of multiple genes confirmed that the Anaplasma sp. UMUM76T is most closely related to, but genetically distinct, from A. platys, a platelet-infecting organism of dogs (Dumler et al., 2001). Based on light and electron microscopy, PCR testing of purified platelets, immunohistochemistry, and in situ hybridization, we have confirmed that the Anaplasma sp. infects platelets. By both immunocytohistochemistry and in situ hybridization, A. odocoilei appeared as small, eccentrically located inclusions in platelets. This appearance corresponds to the small, eccentrically located, darkly stained structures visualized within platelets in Giemsa-stained blood smears. By PCR, both purified platelets and monocytes were positive for the Anaplasma sp. UMUM76T which was somewhat surprising because A. platys has no known stage in monocytes (Dumler et al., 2001). Although the Anaplasma sp. may infect both cell types, other possible explanations for PCR-positive monocytes include monocyte preparations that were contaminated with platelets, monocytes that had phagocytosed infected platelets, or organisms could have been released from platelets during sample processing. The latter possibility has been suggested in a previous study in which the Anaplasma sp. was detected by PCR in serum samples of wild WTD (Brandsma et al., 1999).

Five of 6 experimentally-infected deer developed low titers of antibodies that remained detectable (≥1:64) for several weeks. The single deer that failed to develop a detectable titer was only intermittently PCR-positive. Although this assay has not been validated, we believe that these low-titer antibody levels are due to reaction with the Anaplasma sp. UMUM76T because the deer were free of known co-infecting Anaplasma and Ehrlichia spp. prior to inoculation, and the serum from one deer reacted specifically with the Anaplasma sp. UMUM76T inclusions in infected platelets and the Anaplasma sp. UMUM76T-infected tick cells as detected by IHC. Because antigenic cross-reactivity among Anaplasma and Ehrlichia spp. has been reported when testing polyclonal antibodies by immunofluorescence (Nicholson et al., 1997; Rikihisa et al., 1997; Wong et al., 1997; Walls et al., 1998; Comer et al., 1999), we tested cross-reactivity of the Anaplasma sp. UMUM76T with related organisms. Antigenically, the Anaplasma sp. UMUM76T antigens reacted weakly with A. phagocytophilum antisera, but not with A. marginale and E. chaffeensis antisera. Antisera against the Anaplasma sp. UMUM76T were slightly reactive when tested with A. marginale antigen, but unreactive with A. phagocytophilum and E. chaffeensis antigens. Because A. phagocytophilum antisera reacted weakly with the Anaplasma sp. UMUM76T antigens in an IFA assay, field serologic studies on the Anaplasma sp. would be complicated due to the common infection of white-tailed deer with A. phagocytophilum (Dugan et al., 2006).

Ultrastructurally, the organisms and morulae in platelets are similar to other Anaplasmataceae including other platelet-dwelling species such as A. platys in dogs (Arraga-Alvarado et al., 2003), a rickettsia-like organism in humans (Arraga-Alvarado et al., 1999), and a rickettsia-like organism seen in impala (Aepyceros melampus) (DuPlessis et al., 1997). The singlet organisms and those with similar morphology in morulae resemble the reticulated forms whilst the cells with electron-dense condensations resemble the dense forms of other Anaplasma and Ehrlichia spp. (Popov et al., 1995, 1998; Munderloh et al., 2004). However, the Anaplasma sp. UMUM76T in platelets differed morphologically from the Anaplasma sp. UMUM76T that was previously isolated and grown in tick cell culture (Munderloh et al., 2003). In tick culture, the Anaplasma sp. UMUM76T forms much larger morulae with numerous pleomorphic and elongated organisms. This may be due to the cell type infected, with the small size of the platelets perhaps conferring a limit of the size of a developing morula. Differences in morphology between in vivo-infected cells and various cell culture-infected cells have been documented with related organisms (e.g. A. phagocytophilum) (Sells et al., 1976; Chen et al., 1994; Munderloh et al., 1996, 2004; Rikihisa et al., 1997; Woldehiwet et al., 2002).

The majority of Anaplasma and Ehrlichia spp. are transmitted by ticks and, in the southeastern and midwestern United States, deer are infested with multiple species of ticks, most commonly with Amblyomma americanum (Paddock and Yabsley, 2007). A previous study found that the Anaplasma sp. had a spatial and temporal association with Amblyomma americanum in the southeastern United States (Brandsma et al., 1999), but the only evidence of infected Amblyomma americanum was a single PCR-positive pool of ticks which were collected from deer and likely contained the Anaplasma sp.-infected blood meals (Lockhart et al., 1997b) and a sequence submitted to GenBank indicating the organism was detected in a pool of Amblyomma americanum from Missouri (GenBank ELU53514). In the current study, our attempts to experimentally transmit the Anaplasma sp. UMUM76T by Amblyomma americanum failed; however, few potentially infected ticks were ultimately fed on transmission deer. Further, transmission studies with related bacteria have failed despite the tick being an appropriate vector (Mathew et al., 1996). Additional studies are needed to determine the route of transmission of the Anaplasma sp., including potentially transmission-feeding wild-caught questing Amblyomma americanum from an endemic area on naïve fawns as has been done for related tick-borne organisms (Varela-Stokes, 2007).

Description of Anaplasma odocoilei sp. nov

Anaplasma odocoilei (odo coil’ei L. gen. n. odocoileus, of deer in the genus Odocoileus. The reference strain is UMUM76T (=CSUR A1). Originally isolated from a white-tailed deer fawn that was experimentally infected with A. odocoilei by inoculation with blood from naturally infected adult deer from central Georgia, USA (Munderloh et al., 2003). Has also been detected in white-tailed deer in numerous locations in the eastern United States (Little et al., 1997; Lockhart et al., 1997b). Experimental infections of white-tailed deer can be achieved by inoculation with either whole blood of infected donor deer or infected cell culture preparations. Clinical signs of illness were not apparent in experimentally infected white-tailed deer. Natural infections, as determined by 16S rRNA PCR, have also been reported in related Odocoileus spp. (mule deer and black-tailed deer) from California and Arizona (Foley et al., 1998; Yabsley et al., 2005). Inclusions of A. odocoilei UMUM76T were observed in platelets of acutely infected deer by electron microscopy, light microscopy of Giemsa-stained, thin blood smears, immunohistochemistry, and in situ hybridization.

Morphology of organisms in naturally infected platelets and ISE6 tick cells was similar to other members of the family Anaplasmataceae. The bacterium is classified as a member of the family Anaplasmataceae and genus Anaplasma based on 16S rRNA, groESL, gltA, and rpoB gene sequences and growth within membrane-bound cytoplasmic vacuoles. In ISE6 tick cells, the organism tends to form larger morulae with numerous organisms and is very pleomorphic and elongate, rather than spherical. Organisms are Gram-negative. Ultrastructurally, organisms are small, pleomorphic cocci within membrane-lined vacuoles, and each organism is surrounded by 2 trilaminar membranes, one protoplasmic and one cell wall, with a narrow periplasmic space. Within platelets, organisms may occur singly or in morulae. Singlet organisms are spherical (mean diameter 0.521 ± 0.200 μm) while clustered organisms vary in shape and size (mean diameter 1.070 ± 0.057 μm with spherical organisms 0.423 ± 0.11 μm in diameter and ovoid organisms 0.350 ± 0.913 μm wide and 0.503 ± 0.823 μm long).

A. phagocytophilum antisera reacted weakly with A. odocoilei UMUM76T whole-cell organisms. A. odocoilei UMUM76T antisera from infected white-tailed deer did not cross-react with A. phagocytophilum or E. chaffeensis antigens in IFA assays, but in some cases did weakly cross-react with A. marginale antigen.

Analysis of gltA sequence fragment revealed 3 novel insertions compared with A. platys. A single 3-bp deletion was present in groESL sequence compared with A. platys. This strain can also be differentiated from other Anaplasma species based on its unique 16S rDNA, groESL, gltA, and rpoB sequences. The G + C content of the 4 sequenced genes of A. odocoilei UMUM76T is 49.2 mol%.

Acknowledgments

We are grateful to David Stallknecht for insightful guidance, Jane Huffman for facilitating acquisition of fawns, Andrea Varela-Stokes and Molly Murphy for significant technical help, Mary Ard for electron microscopy expertise, and Jeff Tucker and Frank Waters for animal handling and husbandry assistance. Work was supported primarily by the National Institutes of Allergy and Infectious Diseases (5 R01 AI044235-02). Further support was provided by the Federal Aid to Wildlife Restoration Act (50 Stat. 917) and through sponsorship from fish and wildlife agencies in Alabama, Arkansas, Florida, Georgia, Kansas, Kentucky, Louisiana, Maryland, Mississippi, Missouri, North Carolina, Oklahoma, Puerto Rico, South Carolina, Tennessee, Virginia, and West Virginia.

References

  1. Arens MQ, Liddell AM, Buening G, Gaudreault-Keener M, Sumner JW, Comer JA, Buller RS, Storch GA. Detection of Ehrlichia spp.in the blood of wild white-tailed deer in Missouri by PCR assay and serologic analysis. J Clin Microbiol. 2003;41:1263–1265. doi: 10.1128/JCM.41.3.1263-1265.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Arraga-Alvarado C, Palmar M, Parra O, Salas P. Fine structural characteristics of a rickettsia-like organism in human platelets from patients with symptoms of ehrlichiosis. J Med Microbiol. 1999;48:991–997. doi: 10.1099/00222615-48-11-991. [DOI] [PubMed] [Google Scholar]
  3. Arraga-Alvarado C, Palmar M, Parra O, Salas P. Ehrlichia platys (Anaplasma platys) in dogs from Maracaebo, Venezuela: an ultrastructural study of experimental and natural infections. Vet Pathol. 2003;40:149–156. doi: 10.1354/vp.40-2-149. [DOI] [PubMed] [Google Scholar]
  4. Blood DC, Radostits OM, Henderson JA. Clinical examination and making a diagnosis. In: Radostits OM, Gay CC, Hinchcliff KW, Constable PD, editors. Veterinary Medicine: A Textbook of the Diseases of Cattle, Sheep, Pigs, Goats and Horses. 6. Bailliere Tindall; Eastbourne, UK: 1983. pp. 3–22. [Google Scholar]
  5. Brandsma AR, Little SE, Lockhart JM, Davidson WR, Stallknecht DE, Dawson JE. Novel Ehrlichia organism (Rickettsiales: Ehrlichieae) in white-tailed deer associated with lone star tick (Acari: Ixodidae) parasitism. J Med Entomol. 1999;36:190–194. doi: 10.1093/jmedent/36.2.190. [DOI] [PubMed] [Google Scholar]
  6. Castro MB, Nicolson WL, Kramer VL, Childs JE. Persistent infection in Neotoma fuscipes (Muridae: Sigmodontidae) with Ehrlichia phagocytophila sensu lato. Am J Trop Med Hyg. 2001;65:261–267. doi: 10.4269/ajtmh.2001.65.261. [DOI] [PubMed] [Google Scholar]
  7. Chen S, Dumler JS, Bakken JS, Walker DH. Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease. J Clin Microbiol. 1994;32:589–595. doi: 10.1128/jcm.32.3.589-595.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Comer JA, Nicholson WL, Olson JG, Childs JE. Serologic testing for human granulocytic ehrlichiosis at a national referral center. J Clin Microbiol. 1999;37:558–564. doi: 10.1128/jcm.37.3.558-564.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Dawson JE, Stallknecht DE, Howerth EW, Warner C, Biggie K, Davidson WR, Lockhart JM, Nettles VF, Olson JG, Childs JE. Susceptibility of white-tailed deer (Odocoileus virginianus) to infection with Ehrlichia chaffeensis, the etiologic agent of human ehrlichiosis. J Clin Microbiol. 1994;32:2725–2728. doi: 10.1128/jcm.32.11.2725-2728.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Dawson JE, Warner CK, Baker V, Ewing SA, Stallknecht DE, Davidson WR, Kocan AA, Lockhart JM, Olson JG. Ehrlichia-like 16S rDNA sequence from wild white-tailed deer (Odocoileus virginianus) J Parasitol. 1996;82:52–58. [PubMed] [Google Scholar]
  11. Dawson JE, Paddock CD, Warner CK, Greer PW, Bartlett JH, Ewing SA, Munderloh UG, Zaki SR. Tissue diagnosis of Ehrlichia chaffeensis in patients with fatal ehrlichiosis by use of immunohistochemistry, in situ hybridization, and polymerase chain reaction. Am J Trop Med Hyg. 2001;65:603–609. doi: 10.4269/ajtmh.2001.65.603. [DOI] [PubMed] [Google Scholar]
  12. Dugan VG, Varela AS, Stallknecht DE, Hurd CC, Little SE. Attempted experimental infection of domestic goats with Ehrlichia chaffeensis. Vector Borne Zoonotic Dis. 2004;4:131–136. doi: 10.1089/1530366041210684. [DOI] [PubMed] [Google Scholar]
  13. Dugan VG, Yabsley MJ, Tate CM, Mead DG, Munderloh UG, Munderloh UG, Herron MJ, Stallknecht DE, Little SE, Davidson WR. Evaluation of white-tailed deer (Odocoileus virginianus) as natural sentinels for Anaplasma phagocytophilum. Vector Borne Zoonotic Dis. 2006;6:192–207. doi: 10.1089/vbz.2006.6.192. [DOI] [PubMed] [Google Scholar]
  14. Dumler JS, Barbet AF, Bekker CPJ, Dasch GA, Palmer GH, Ray SC, Rikihisa Y, Rurangirwa FR. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and ‘HGE agent’ as subjective synonyms of Ehrlichia phagocytophila. Int J Syst Evol Microbiol. 2001;51:2145–2165. doi: 10.1099/00207713-51-6-2145. [DOI] [PubMed] [Google Scholar]
  15. DuPlessis L, Reyers F, Stevens K. Morphological evidence for infection of impala, Aepyceros melampus, platelets by a rickettsia-like organism. Onderstepoort J Vet Res. 1997;64:317–318. [PubMed] [Google Scholar]
  16. Engvall A, Lilliehöök I, Bjöersdorff A, Engvall EO, Karlstam E, Artursson K, Heldtander M, Gunnarsson A. Detection of granulocytic Ehrlichia species DNA by PCR in persistently infected dogs. Vet Rec. 2000;146:186–190. doi: 10.1136/vr.146.7.186. [DOI] [PubMed] [Google Scholar]
  17. Eriks IS, Palmer GH, McGuire TC, Allred DR, Barbet AF. Detection and quantitation of Anaplasma marginale in carrier cattle by using a nucleic acid probe. J Clin Microbiol. 1989;27:279–284. doi: 10.1128/jcm.27.2.279-284.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Ewing SA, Dawson JE, Kocan AA, Barker RW, Warner CK, Panciera RJ, Fox JC, Kocan KM, Blouin EF. Experimental transmission of Ehrlichia chaffeensis (Rickettsiales: Ehrlichieae) among white-tailed deer by Amblyomma americanum (Acari: Ixodidae) J Med Entomol. 1995;32:368–374. doi: 10.1093/jmedent/32.3.368. [DOI] [PubMed] [Google Scholar]
  19. Foley JE, Barlough JE, Kimsey RB, Madigan JE, DeRock E, Poland A. Ehrlichia spp. in cervids from California. J Wildl Dis. 1998;34:731–737. doi: 10.7589/0090-3558-34.4.731. [DOI] [PubMed] [Google Scholar]
  20. Harvey JW, Simpson CF, Gaskin JM. Cyclic thrombocytopenia induced by a Rickettsia-like agent in dogs. J Infect Dis. 1978;137:182–188. doi: 10.1093/infdis/137.2.182. [DOI] [PubMed] [Google Scholar]
  21. Inokuma H, Brouqui P, Drancourt M, Raoult D. Citrate synthase gene sequences: a new tool for phylogenetic analysis and identification of Ehrlichia. J Clin Microbiol. 2001;39:3031–3039. doi: 10.1128/JCM.39.9.3031-3039.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Inokuma H, Fujii K, Okuda M, Onishi T, Beaufils JP. Determination of the nucleotide sequences of heat shock operon groESL and the citrate synthase gene (gltA) of Anaplasma (Ehrlichia) platys for phylogenetic and diagnostic studies. Clin Diagn Lab Immunol. 2002;9:1132–1136. doi: 10.1128/CDLI.9.5.1132-1136.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kawahara M, Rikihisa Y, Isogai E, Takahashi M, Misumi H, Suto C, Shibata S, Zhang C, Tsuji M. Ultrastructure and phylogenetic analysis of ‘Candidatus Neoehrlichia mikurensis’ in the family Anaplasmataceae, isolated from wild rats and found in Ixodes ovatus ticks. Int J Syst Evol Microbiol. 2004;54:1837–1843. doi: 10.1099/ijs.0.63260-0. [DOI] [PubMed] [Google Scholar]
  24. Keel MK, Goff WL, Davidson WR. An assessment of the role of white-tailed deer in the epizootiology of anaplasmosis in the southeastern United States. J Wildl Dis. 1995;31:378–385. doi: 10.7589/0090-3558-31.3.378. [DOI] [PubMed] [Google Scholar]
  25. Kumar S, Tamura K, Jakobsen IB, Nei M. MEGA2: Molecular Evolutionary Genetics Analysis software. Arizona State University; Tempe, AZ: 2001. [DOI] [PubMed] [Google Scholar]
  26. Little SE, Dawson JE, Lockhart JM, Stallknecht DE, Warner CK, Davidson WR. Development and use of a specific polymerase chain reaction for the detection of an organism resembling Ehrlichia sp in the white-tailed deer. J Wildl Dis. 1997;33:246–253. doi: 10.7589/0090-3558-33.2.246. [DOI] [PubMed] [Google Scholar]
  27. Little SE, Stallknecht DE, Lockhart JM, Dawson JE, Davidson WR. Natural coinfection of a white-tailed deer (Odocoileus virginianus) population with three Ehrlichia spp. J Parasitol. 1998;84:897–901. [PubMed] [Google Scholar]
  28. Lockhart JM, Davidson WR, Stallknecht DE, Dawson JE, Howerth EW. Isolation of Ehrlichia chaffeensis from white-tailed deer (Odocoileus virginianus) confirms their role as natural reservoir hosts. J Clin Microbiol. 1997a;35:1681–1686. doi: 10.1128/jcm.35.7.1681-1686.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Lockhart JM, Davidson WR, Stallknecht DE, Dawson JE, Little SE. Natural history of Ehrlichia chaffeensis in the piedmont physiographic region of Georgia. J Parasitol. 1997b;83:887–894. [PubMed] [Google Scholar]
  30. Mathew JS, Ewing SA, Barker RW, Fox JC, Dawson JE, Warner CK, Murphy GL, Kocan KM. Attempted transmission of Ehrlichia canis by Rhipicephalus sanguineus after passage in cell culture. Am J Vet Res. 1996;57:1594–1598. [PubMed] [Google Scholar]
  31. Munderloh UG, Madigan JE, Dumler JS, Goodman JL, Hayes SF, Barlough JE, Nelson CM, Kurtti TJ. Isolation of the equine granulocytic ehrlichiosis agent, Ehrlichia equi, in tick cell culture. J Clin Microbiol. 1996;34:664–670. doi: 10.1128/jcm.34.3.664-670.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Munderloh UG, Tate CM, Lynch MJ, Howerth EW, Kurtti TJ, Davison WR. Isolation of an Anaplasma sp organism from white-tailed deer by tick cell culture. J Clin Microbiol. 2003;41:4328–4335. doi: 10.1128/JCM.41.9.4328-4335.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Munderloh UG, Lynch MJ, Herron MJ, Palmer AT, Kurtti TJ, Nelson RD, Goodman JL. Infection of endothelial cells with Anaplasma marginale and A. phagocytophilum. Vet Microbiol. 2004;101:53–64. doi: 10.1016/j.vetmic.2004.02.011. [DOI] [PubMed] [Google Scholar]
  34. Ndung’u LW, Aguirre C, Rurangirwa FR, McElwain TF, McGuire TC, Knowles DP, Palmer GH. Detection of Anaplasma ovis infection in goats by major surface protein 5 competitive inhibition enzyme-linked immunosorbent assay. J Clin Microbiol. 1995;33:675–679. doi: 10.1128/jcm.33.3.675-679.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Nicholson WL, Comer JA, Sumner JW, Gingrich-Baker C, Coughlin RT, Magnarelli LA, Olson JG, Childs JE. An indirect immunofluorescence assay using cell culture-derived antigen for detection of antibodies to the agent of human granulocytic ehrlichiosis. J Clin Microbiol. 1997;36:1510–1516. doi: 10.1128/jcm.35.6.1510-1516.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Norris DE, Klompen JSH, Black WC., IV Comparison of the mitochondrial 12S and 16S ribosomal DNA genes in resolving phylogenetic relationships among hard ticks (Acari: Ixodidae) Ann Entomol Soc Am. 1999;92:117–129. [Google Scholar]
  37. Paddock CD, Yabsley MJ. Ecological havoc, the rise of white-tailed deer, and the unveiling of Amblyomma americanum-associated zoonoses in the United States. Curr Top Microbiol Immunol. 2007;315:289–324. doi: 10.1007/978-3-540-70962-6_12. [DOI] [PubMed] [Google Scholar]
  38. Palmer GH, Abbott JR, French DM, McElwain TF. Persistence of Anaplasma ovis infection and conservation of the msp-2 and msp-3 multigene families within the genus Anaplasma. Infect Immunol. 1998;66:6035–6039. doi: 10.1128/iai.66.12.6035-6039.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Popov VL, Chen S, Feng H, Walker DH. Ultrastructural variation of cultured Ehrlichia chaffeensis. J Med Microbiol. 1995;43:411–421. doi: 10.1099/00222615-43-6-411. [DOI] [PubMed] [Google Scholar]
  40. Popov VL, Han VC, Chen SM, Dumler JS, Feng HM, Andreadis TG, Tesh RB, Walker DH. Ultrastructural differentiation of the genogroups in the genus Ehrlichia. J Med Microbiol. 1998;47:235–251. doi: 10.1099/00222615-47-3-235. [DOI] [PubMed] [Google Scholar]
  41. Rikihisa Y, Zhi N, Wormser GP, Wen B, Horowitz HW, Hechemy KE. Ultrastructural and antigenic characterization of a granulocytic ehrlichiosis agent directly isolated and stably cultivated from a patient in New York State. J Infect Dis. 1997;175:210–213. doi: 10.1093/infdis/175.1.210. [DOI] [PubMed] [Google Scholar]
  42. Sells DM, Hildebrandt PK, Lewis GE, Nyindo MBA, Ristic M. Ultrastructural observations on Ehrlichia equi organisms in equine granulocytes. Infect Immunol. 1976;13:273–280. doi: 10.1128/iai.13.1.273-280.1976. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Stuen S, Bergström K. Persistence of Ehrlichia phagocytophila infection in two age groups of lambs. Acta Vet Scand. 2001;42:453–458. doi: 10.1186/1751-0147-42-453. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Sumner JW, Yabsley MJ, Arens MQ, Buenning G, Storch GA, Davidson WR. Determination of white-tailed deer agent groESL operon sequences for phylogenetic and diagnostic applications. Ann N Y Acad Sci. 2003;990:1–2. doi: 10.1111/j.1749-6632.2003.tb07446.x. [DOI] [PubMed] [Google Scholar]
  45. Taillardat-Bisch AV, Raoult D, Drancourt M. RNA polymerase b-subunit-based phylogeny of Ehrlichia spp.Anaplasma spp., Neorickettsia spp and Wolbachia pipientis. Int J Syst Evol Microbiol. 2003;53:455–458. doi: 10.1099/ijs.0.02411-0. [DOI] [PubMed] [Google Scholar]
  46. Tate CM, Mead DG, Luttrell MP, Howerth EW, Dugan VG, Munderloh UG, Davidson WR. Experimental infection of white-tailed deer with Anaplasma phagocytophilum, etiologic agent of human granulocytic anaplasmosis. J Clin Microbiol. 2005;43:3595–3601. doi: 10.1128/JCM.43.8.3595-3601.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Varela-Stokes AS. Transmission of bacterial agents from lone star ticks to white-tailed deer. J Med Entomol. 2007;44:478–483. doi: 10.1603/0022-2585(2007)44[478:tobafl]2.0.co;2. [DOI] [PubMed] [Google Scholar]
  48. Walls JJ, Asanovich KM, Bakken JS, Dumler JS. Serologic evidence of a natural infection of white-tailed deer with the agent of human granulocytic ehrlichiosis in Wisconsin and Maryland. Clin Diagn Lab Immunol. 1998;5:762–765. doi: 10.1128/cdli.5.6.762-765.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Woldehiwet Z, Horrocks BK, Scaife H, Ross G, Munderloh UG, Bown K, Edwards SW, Hart CA. Cultivation of an ovine strain of Ehrlichia phagocytophila in tick cell cultures. J Comp Pathol. 2002;127:142–149. doi: 10.1053/jcpa.2002.0574. [DOI] [PubMed] [Google Scholar]
  50. Wong SJ, Brady GS, Dumler JS. Serological responses to Ehrlichia equi, Ehrlichia chaffeensis, and Borrelia burgdorferi in patients from New York State. J Clin Microbiol. 1997;35:2198–2205. doi: 10.1128/jcm.35.9.2198-2205.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Yabsley MJ, Varela AS, Tate CM, Dugan VG, Stallknecht DE, Little SE, Davidson WR. Ehrlichia ewingii infection in white-tailed deer (Odocoileus virginianus) Emerg Infect Dis. 2002;8:668–671. doi: 10.3201/eid0807.020018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Yabsley MJ, Dugan VG, Stallknecht DE, Little SE, Lockhart JM, Dawson JE, Davidson WR. Evaluation of a prototype Ehrlichia chaffeensis surveillance system using white-tailed deer (Odocoileus virginianus) as natural sentinels. Vector Borne Zoonotic Dis. 2003;3:195–207. doi: 10.1089/153036603322662183. [DOI] [PubMed] [Google Scholar]
  53. Yabsley MJ, Davidson WR, Stallknecht DE, Varela AS, Swift PK, Devos JC, Jr, Dubay SA. Evidence of tick-borne organisms in mule deer (Odocoileus hemionus) from the western United States. Vector Borne Zoonotic Dis. 2005;5:351–362. doi: 10.1089/vbz.2005.5.351. [DOI] [PubMed] [Google Scholar]
  54. Yabsley MJ, Loftis AD, Little SE. Natural and experimental infection of white-tailed deer (Odocoileus virginianus) from the United States with an Ehrlichia sp closely related to Ehrlichia ruminantium. J Wildl Dis. 2008a;44:381–387. doi: 10.7589/0090-3558-44.2.381. [DOI] [PubMed] [Google Scholar]
  55. Yabsley MJ, Murphy SM, Luttrell MP, Wilcox BR, Howerth EW, Munderloh UG. Characterization of ‘Candidatus Neoehrlichia lotoris’ (family Anaplasmataceae) from raccoons (Procyon lotor) Int J Syst Evol Microbiol. 2008b;58:2794–2798. doi: 10.1099/ijs.0.65836-0. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES