Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2004 May;186(10):3160–3172. doi: 10.1128/JB.186.10.3160-3172.2004

Organization and Expression of the Polynucleotide Phosphorylase Gene (pnp) of Streptomyces: Processing of pnp Transcripts in Streptomyces antibioticus

Patricia Bralley 1,*, George H Jones 1
PMCID: PMC400608  PMID: 15126478

Abstract

We have examined the expression of pnp encoding the 3′-5′-exoribonuclease, polynucleotide phosphorylase, in Streptomyces antibioticus. We show that the rpsO-pnp operon is transcribed from at least two promoters, the first producing a readthrough transcript that includes both pnp and the gene for ribosomal protein S15 (rpsO) and a second, Ppnp, located in the rpsO-pnp intergenic region. Unlike the situation in Escherichia coli, where observation of the readthrough transcript requires mutants lacking RNase III, we detect readthrough transcripts in wild-type S. antibioticus mycelia. The Ppnp transcriptional start point was mapped by primer extension and confirmed by RNA ligase-mediated reverse transcription-PCR, a technique which discriminates between 5′ ends created by transcription initiation and those produced by posttranscriptional processing. Promoter probe analysis demonstrated the presence of a functional promoter in the intergenic region. The Ppnp sequence is similar to a group of promoters recognized by the extracytoplasmic function sigma factors, sigma-R and sigma-E. We note a number of other differences in rspO-pnp structure and function between S. antibioticus and E. coli. In E. coli, pnp autoregulation and cold shock adaptation are dependent upon RNase III cleavage of an rpsO-pnp intergenic hairpin. Computer modeling of the secondary structure of the S. antibioticus readthrough transcript predicts a stem-loop structure analogous to that in E. coli. However, our analysis suggests that while the readthrough transcript observed in S. antibioticus may be processed by an RNase III-like activity, transcripts originating from Ppnp are not. Furthermore, the S. antibioticus rpsO-pnp intergenic region contains two open reading frames. The larger of these, orfA, may be a pseudogene. The smaller open reading frame, orfX, also observed in Streptomyces coelicolor and Streptomyces avermitilis, may be translationally coupled to pnp and the gene downstream from pnp, a putative protease.


Polynucleotide phosphorylase (PNPase) is a 3′-5′-exoribonuclease that catalyzes the phosphorolytic degradation of RNAs in Escherichia coli and other bacteria (14, 15, 35). PNPase is also a component of the RNA degradosome in E. coli (9, 40, 41). More recently, it has been shown that PNPase also functions as an alternative poly(A) polymerase in E. coli, where under appropriate conditions it can either degrade RNA or synthesize poly(A) tails, also incorporating C and U residues at low frequency in wild-type cells (34). It has further been argued that PNPase serves as perhaps the sole poly(A) polymerase in streptomycetes (7, 8), spinach chloroplasts (53), and Synechocystis sp. (46), synthesizing heteropolymeric rather than homopolymeric 3′-RNA tails in each of these systems.

In E. coli, pnp is coexpressed with the gene for ribosomal protein S15 as part of the rpsO-pnp operon. Two promoters have been identified in the operon: P1, situated upstream of rpsO, and P2, located in the intergenic region between rpsO and pnp (44). The rpsO-pnp intergenic region also encodes two structural motifs important for pnp expression and mRNA processing (20, 44). At the 3′ end of rpsO is a Rho-independent terminator, and downstream of the intergenic pnp promoter is a second hairpin which contains a processing site recognized by the double-strand-specific endoribonuclease RNase III (38, 44). Cleavage of this hairpin in transcripts originating from either P1 or P2 creates a duplex structure with a 3′ tail that is degraded by PNPase, resulting in destabilization of the pnp mRNA. Thus, PNPase autoregulates its synthesis posttranscriptionally in an RNase III-dependent manner (25, 45). Since the rpsO-pnp intergenic regions of Yersinia enterocolitica and Photorhabdus sp. possess identical stem-loop structures to that of E. coli that are also processed at the same RNase III-like site, Jarrige and coworkers (25) hypothesized that PNPase expression is autoregulated by the same mechanism in all three organisms. Jarrige et al. (25) have further argued that at temperatures significantly below 37°C, the increased stability of the duplex produced by RNase III processing reduces PNPase-mediated degradation of its transcript and thus accounts for the observation that cold shock induces PNPase production (5, 21, 32).

We have recently begun to characterize PNPase and its gene in the genus Streptomyces. These gram-positive, filamentous soil-dwelling bacteria display a spore-forming developmental cycle and are an important source of the world's antibiotics (30). PNPase activity and the polyadenylation of RNA molecules have recently been characterized in Streptomyces antibioticus and Streptomyces coelicolor (6, 7, 26). The crystal structure of the S. antibioticus PNPase has been determined, and structure-based sequence analysis has identified domains putatively involved in the binding of inorganic phosphate and RNA (49). The S. antibioticus PNPase appears to be a bifunctional enzyme that possesses not only PNPase activity but also a guanosine pentaphosphate synthetase activity that is not observed for the E. coli PNPase (26).

Given the novel aspects of PNPase functions in Streptomyces, the critical role that PNPase plays in RNA degradation, the potential role of PNPase in the regulation of antibiotic production, and the fact that very little is known about the mechanism and regulation of RNA degradation in streptomycetes, we have undertaken an examination of the organization, expression, and regulation of the pnp gene in S. antibioticus. We show that pnp is a part of an rpsO-pnp operon in S. antibioticus and that the gene is transcribed from an intergenic promoter and from a second promoter located either upstream of or within rpsO. We identified several additional features of the rpsO-pnp intergenic region, including two open reading frames, one of which extends into pnp. Characterization of several putative processing sites for the pnp transcripts is also described below. We also describe the adaptation of a straightforward technique for distinguishing between primary and processed transcripts in bacterial systems and for identifying transcription start points.

MATERIALS AND METHODS

Strains and media.

S. antibioticus IMRU 3720 was grown on NZ-amine and galactose-glutamic acid (GGA) media as described by Gallo and Katz (18).

Sequence analysis.

Sequencing of clones pJSE303 and pJSE304, carrying the ca. 4-kb insert of the pnp region of S. antibioticus (26), was performed manually using the TaqTrack sequencing system (Promega Corp.) and with automated sequencing by the Emory University DNA Sequencing Core Facility. The Core Facility also sequenced all cDNA clones. Pertinent S. coelicolor sequences were obtained from the Sanger Centre S. coelicolor genome sequencing project (www.sanger.ac.uk/projects/S_coelicolor) and are deposited in GenBank under accession number AL031231. Streptomyces avermitilis sequences were obtained from the Genome Project of S. avermitilis (http://avermitilis.ls.kitasato-u.ac.jp/).

The GeneQuest RNA fold program (DNASTAR Inc., Madison, Wis.) was used to model the rpsO terminator and intergenic hairpin of S. antibioticus and S. coelicolor. Folding results were compared for similarity to those generated by mfold, version 3.1 (54) and were submitted to the mfold server (www.bioinfo.rpi.edu/applications/mfold/old/rna/). mfold version 3.1 was used to model folding of transcripts initiated from the Ppnp transcription start point (TSP).

The S. antibioticus, S. avermitilis, and S. coelicolor intergenic regions were analyzed for open reading frames and codon preference using FramePlot 2.3.2 (24) and the FramePlot server at the website www.nih.go.jp/∼jun/cgi-bin/frameplot.pl. The protein homology search for short nearly exact matches was performed using the BLAST server at the National Center for Biotechnology Information website (www.ncbi.nlm.nih.gov/BLAST/).

Construction of pJSE1439.

An ∼230-bp fragment of the rpsO-pnp intergenic region was amplified by PCR using the plasmid pJSE303 as template and the primers PP3, 5′-GCA CGC ACC CCT CTA GAC AAG CAC, and PP4, 5′-GCG GGT GCC GAA GGA TCC GTT GTC. The amplified insert was digested with XbaI and BamHI and cloned into the promoter probe vector pIJ486 (51). This vector allows promoter detection through the expression of the aminoglycoside phosphotransferase gene, which confers kanamycin resistance. Ligation mixtures were transformed into S. antibioticus protoplasts following the rapid small-scale procedure of Kieser et al. (30). Thiostrepton-resistant transformants were replica plated to R2YE plates containing kanamycin for initial screening. Insertion of the expected fragment was verified through restriction enzyme analysis and sequencing. Relative promoter strength was determined by plate assays of kanamycin resistance.

Primer extension.

Total mycelial RNA was isolated as previously described (22), except that mycelium was collected by centrifugation at 2,500 × g in a clinical centrifuge for 5 min. The quantity and quality of RNA were checked by spectrophotometry and agarose gel electrophoresis.

Experiments with wild-type RNA used the primers +45R, 5′-GGT GCG GGT GCC GAA GGC GCC GTT GTC GAT, and +16R, 5′-TCG GCG TAG TGG GTC TCG TTC, which were complementary to sequences centered approximately 45 and 16 bp downstream from the pnp translation start codon. Experiments with RNA isolated from S. antibioticus(pJSE1439) used primers complementary to sequences in the multicloning site of pIJ486: primer 486A, AAT TCG AGC TCG GTA CCC GGG, and primer 486C, CGA TCC TCA TCC TGT CTC TTG.

Primers were 5′-end labeled with T4 polynucleotide kinase and [γ-32P]ATP (3,000 Ci mmol−1; Amersham Pharmacia Biotech). Five micrograms of total RNA and 2 pmol of end-labeled primer were heated at 78°C for 10 min and then quickly chilled on ice. One microliter of actinomycin D (500 μg ml−1), 2 μl of 5× First-Strand buffer (GIBCO BRL), 1 μl of 100 mM dithiothreitol, and 0.5 μl of 10 mM deoxynucleoside triphosphate mix (containing 7-deaza dGTP) were added, and the 10-μl reaction mix was incubated at 42°C for 2 min to anneal the primer. One hundred units of SuperScript II (GIBCO BRL) was added, and products were extended for 1 h at 42°C. The reaction was inactivated by incubation at 78°C for 15 min. Primer extension products were analyzed by electrophoresis on a 6.5% polyacrylamide gel followed by autoradiography. Sequencing reactions, primed with the oligonucleotide used in primer extension, were performed using the TaqTrack sequencing system (Promega Corp.) following the manufacturer's protocol.

Semiquantitative RT-PCR.

Five micrograms of total RNA, corresponding to each time point, was reverse transcribed using Superscript II and 200 ng of random hexamer primers (Amersham Pharmacia Biotech) following the extension protocol of the manufacturer (GIBCO BRL). PCR was performed with 5 μl of reverse transcription (RT) reaction mix and 20 pmol of each primer. For pnp-hrdB assays, multiplex PCR was carried out with four primers: gps56F, 5′-CCG CAC CAT CCG CTT CGA GAC, and gps840R, 5′-ATC CGC CAC GAC GTC GTA CAG GTG, to amplify pnp cDNAs; and hrdF2, 5′-TCT GTC ATG GCG CTC ATT GAG C, and hrdR3, 5′-ACG TTG TTG ATG ACC TCG ACC ATG, to amplify hrdB cDNA. The hrdB primers were designed from conserved sequences of streptomycete HrdB protein and the S. coelicolor nucleotide sequences (33, 47). Multiplex PCR for the rpsO-pnp readthrough assays used three primers: gps56F, gps840R, and rps1, 5′-CAC AAG CAC GAC CAC CAC TCC. Typically, the PCR consisted of an incubation at 94°C for 1 min, followed by 30 cycles of 90°C for 30 s, 50°C for 1 min, and 72°C for 1 min, ending with one cycle at 72°C for 10 min. Twelve microliters of PCR amplification product was loaded onto a 0.7% agarose gel with incorporated ethidium bromide. Reaction products were visualized by UV transillumination. The results were recorded by a video camera connected to a computer-based data analysis system. Densitometry measurements were quantitated using Scion Image for Windows software.

Specificity of the primers was checked by amplifying plasmid and S. coelicolor genomic DNA to produce products of predicted sizes that corresponded with RT-PCR products. RT-PCR bands were isolated from the gels and further characterized by restriction enzyme digestion. hrdB products were digested as expected with both BamHI and KpnI, while pnp products were digested as expected with NcoI. rpsO-pnp readthrough products were digested with SalI. PCRs performed without RT served as controls to indicate the absence of contaminating DNA in the RT reaction mixtures. A water blank was used as a negative control. PCR was performed with up to 100-fold dilutions of template to ensure that the assay was in the linear range. Reproducibility was assessed by performing at least two independent RT reactions for each time point and at least three PCRs using each of these templates.

RLM-RT-PCR.

To generate cDNA clones of primary and processed transcripts, we employed the RNA ligase-mediated RT-PCR (RLM-RT-PCR) strategy described by Bensing et al. (3) using the reaction conditions and reagents supplied in the FirstChoice RLM-RACE kit (Ambion, Inc.). Five micrograms of RNA was treated with 2 μl of tobacco acid pyrophosphatase (TAP) following the manufacturer's protocol in a 10-μl volume (while a duplicate sample was left untreated). The RNA in 4 μl of TAP-treated or untreated reaction mix was then incubated with 0.6 μg of 5′-RACE adapter (5′-GCU GAU GGC GAU GAA UGA ACA CUG CGU UUG CUG GCU UUG AUG AAA) and 5 U of T4 RNA ligase for 1 h at 37°C. RT followed the manufacturer's protocol using random decamers and Moloney murine leukemia virus reverse transcriptase and incubation at 48°C for 1 h.

The first round of nested PCR used 2 μl of reverse-transcribed RNA as template for a 100-μl reaction mixture as described above. The 5′ primers were from the Ambion 5′-RACE kit: outer primer, GCT GAT GGC GAT GAA TGA ACA CTG, and inner primer, CGC GGA TCC GAA CAC TGC GTT TGC TGG CTT TGA TG, for the first and second rounds of PCR, respectively. The reverse primers for studies on wild-type RNA were gps840R and pnp750R (AGG CAG GTG AGG ATG GCG TCC). Gene-specific primers used for amplification of 1439 RNA were 486C and 486A.

PCR products were then cloned into E. coli using the TOPO-TA cloning vector pCR2.1-TOPO and following the manufacturer's protocol (Invitrogen Corp.). Clones were screened by restriction enzyme analysis for the presence of an ∼500-bp insert (the predicted size of Ppnp and processed transcripts) and then sequenced.

Nucleotide sequence accession number.

The S. antibioticus sequence shown below in Fig. 1 has been assigned GenBank accession number U19858.

FIG. 1.

FIG. 1.

The pnp region of S. antibioticus. (A) Physical map of the insert of pJSE303. Primers used in RT-PCR and primer extension experiments (not drawn to scale) are shown as arrows, from left to right, as follows: rps1, gps56F, +16R, +45R, pnp750R, gps840R. Restriction sites: B, BamHI; G, BglII; S, SalI; N, NcoI. (B) Sequence comparison of the S. antibioticus, S. avermitilis, and S. coelicolor intergenic regions. The inverted repeat is in bold and underlined. The direct repeat is overlined by arrows. The intergenic pnp transcription start site is identified in bold, underlined, and with an asterisk. The rpsO translation stop and pnp start codons are identified in bold underline. Putative orfX and orfA start codons are in bold. The putative pnp −35 and −10 regions are labeled in bold and underlined. The pnp ribosome binding sites are shaded, as are the orfX stop codons. The sequence that is predicted to form the intergenic hairpin is also demarcated by shading. The 5′ ends identified in cDNA clones from wild-type RNA and from S. antibioticus(pJSE1439) RNA are indicated by gray and black dots, respectively. The dots corresponding to the pnp TSP are grouped together within a circle with an arrow. Other dots correspond to the 5′ end of the relevant RNA. Xba indicates the location of the XbaI site in primer PP3 used in subcloning Ppnp.

RESULTS

Sequence analysis of the rpsO-pnp operon in Streptomyces.

An rpsO-pnp operon has been conserved in several bacterial species, including E. coli and Bacillus subtilis (33). To determine if this organization also occurred in S. antibioticus, two plasmids, pJSE303 and pJSE304 (26), each carrying a ca. 4-kb insert representing the S. antibioticus pnp region, were sequenced. This sequence was compared to the S. coelicolor and S. avermitilis genome sequences. An rpsO homolog was found upstream of pnp (Fig. 1A) in all organisms. In the same orientation and immediately downstream of pnp is a gene encoding a putative protease (Fig. 1A). Annotation of the S. coelicolor and S. avermitilis genes indicated that the TGA stop codon of the pnp genes overlaps the GTG start codon of the protease.

Comparison of the rpsO-pnp intergenic regions revealed significant variations in length: 385 bp in S. antibioticus, 347 bp in S. avermitilis, and 285 bp in S. coelicolor. Despite this variation, three conserved subregions were identified (Fig. 1B). (i) An ∼50-bp sequence at the 3′ end of rpsO contains an inverted repeat and the first half of a direct repeat (CCCTTTG). By analogy with E. coli, the inverted repeat immediately downstream of rpsO presumably encodes an rpsO terminator. (ii) Further downstream is a conserved 39-bp sequence which contains the second half of the direct repeat. (iii) A 170-bp sequence directly upstream of the pnp start codon contains the S. antibioticus promoter (defined below).

Determination of the intergenic transcription start site and identification of the promoter for pnp transcription.

Primer extension analysis was used to identify the TSP of the pnp gene within the rpsO-pnp intergenic region. S. antibioticus total RNA was used as template. To ensure primer binding specifically to the pnp mRNA and not to another transcript with a similar sequence, the experiment was performed with two different primers that corresponded to adjacent sequences in the pnp transcript. All other bands observed in primer extension analyses were regarded as artifacts unless their endpoints were later identified by the independent method described below. Only one extension product was detected by both primers +45R and + 16R. This product identified a thymine residue 125 bases upstream from the pnp translation start codon as the TSP (Fig. 2 and also 1B). The variance in band intensities produced by the two primers probably reflected differences in the efficiency with which the primers were bound to the template and extended by RT, a phenomenon commonly seen with GC-rich Streptomyces RNA.

FIG. 2.

FIG. 2.

Primer extension mapping of the pnp transcription start site. The T labeled with an asterisk indicates extension products corresponding to the pnp TSP. The sequence ladder to the left of each reaction lane was generated by the oligonucleotide used in primer extension, either +45R or +16R, as indicated by the lane labels. The numbers to the left of the sequence ladder for +45R and to the right of the lane for +16R correspond to those of the cDNA clones obtained by RLM-RT-PCR (see Table 3 and Fig. 4A).

A number of promoters in S. coelicolor and S. antibioticus have been shown to be transcribed in vitro by RNA polymerase holoenzymes reconstituted with either of the extracytoplasmic function (ECF) sigma factors, sigma-R and sigma-E (28, 36). Comparison of the sequence upstream of the putative TSP with these promoters revealed intriguing similarities (Table 1). A purine-rich sequence, GAGAAG, aligns well to the −35 regions of promoters transcribed by both sigma-E and sigma-R. The sequence GTCCT is identical to the −10 region of the whiBp1 promoter and similar to other −10 regions recognized by ECF sigma factors. Thus, we speculate that the putative rpsO-pnp intergenic promoter, Ppnp, is recognized by an ECF sigma factor. However, pnp expression from this promoter was detected in an S. antibioticus strain lacking sigma-E (see below).

TABLE 1.

Comparision of Ppnp to ECF promotersa

Promoter Sequence
Promoters recognized by σR
    actIIIpx2 GGACTG CGGACGACGCTGAAGGAGTTGCGGGAGGCG
    glnR-p2 GGGCAG AGGACTCGGGCAACGTAGCCCCCGGGTCCT
    sigR-p2 GGGAATGACCGGCGGACGGCCACTGTTGTGCCGTTC
    hrdD-p2 GGGAATTCTGTCCGGATTCCAGTCGTTGTTTCCATCG
Ppnp GAGAAGCGCACCCCACCGCCGCCGGTCCTCGGTAGT
Promoters recognized by σE
    whiB-p1 CGGAACGGGATCGATCGCCGGGGCGTCCTTCCTGGT
    phsA-p GGGAACGCGCGAGGGGCGCCGGGCGTCTCATGGGGCAA
    hrdD-p1 GGCAACCCTCAGGCGGTACGGGCCGTCTTCAGGGT
    dagA-p2 CGGAACTTTTTGCACGCACGCGAGCTCTCGAATTTT
a

Comparison of the pnp promoter with other promoters transcribed in vitro by sigma-R and sigma-E holoenzymes. The −35 and −10 sequences of various promoters are in bold and overlined. Italics indicate nucleotides common to both pnp and the σR and σE promoters. Nucleotides in bold and underlined represent transcription start points. The sigR-p2 sequence is from Paget et al. (24). All other sequences are from Kang et al. (28).

To verify the presence of a functional promoter within the rpsO-pnp intergenic region, a 230-bp fragment beginning just upstream of the putative −35 region was cloned into the streptomycete promoter probe vector pIJ486 (54) to create plasmid pJSE1439. Relative promoter strength was determined by demonstration of kanamycin resistance. Both S. antibioticus(pIJ486) and S. antibioticus(pIJ1439) grew well on GGA plates with 15 μg of thiostrepton ml−1. S. antibioticus (pIJ486), however, could not grow on plates containing 50 μg of kanamycin ml−1. By contrast, strains carrying pJSE1439 grew vigorously on both 50- and 100-μg/ml kanamycin plates. In other experiments, varying the Pi concentration of GGA medium over a 10-fold range had no effect upon the strength of Ppnp expression as reflected by kanamycin resistance.

Analysis of the rpsO-pnp intergenic region for open reading frames.

Careful inspection of the S. antibioticus and S. coelicolor intergenic regions suggested the possibility that they might contain open reading frames. To test this possibility, we examined these regions using FramePlot (24). This program is specifically designed to identify open reading frames in organisms whose genomes are GC-rich through adherence to the rule that protein-coding regions from such species, e.g., Streptomyces, possess an average codon third-letter GC (GC3) content of 92%.

Using this program, we identified an open reading frame, designated orfX, that begins upstream of the pnp translation start site (Fig. 1B). This putative open reading frame would consist of 105 bp initiating at the GTG beginning at base 284 (Fig. 1B) and could encode 33 amino acids. Similar open reading frames encoding 36 amino acids are also present in S. coelicolor and S. avermitilis. All three of these open reading frames would terminate with the stop codon TAG overlapping the start codon of their respective pnp open reading frames (Fig. 1B). The S. antibioticus sequence also has a purine-rich GAAAGAG sequence 6 bases upstream from the putative start codon, suggesting the presence of a Shine-Dalgarno site, but this sequence is not conserved in the other two organisms. While the GC3 of the S. antibioticus orfX is only 82%, this figure is still significantly higher than the value of 67% GC content of the intergenic region. By contrast, the S. avermitilis and S. coelicolor orfX GC3s are 70 and 65%, respectively, in intergenic regions of ∼65% GC composition. Alignment of the putative orfX peptides produced an approximate 60% identity (Table 2). A BLAST search revealed no significant homology to any known peptide or protein.

TABLE 2.

Sequences of hypothetical peptides encoded in the rpsO-pnp intergenic regiona

graphic file with name zjb01004366800t2.jpg
a

Amino acid sequences of the hypothetical proteins from orfX. Residues in boldface are identical in two organisms. Lines represent identities in all three organisms. Plus signs represent similarities.

We also identified a 504-bp orfA, beginning upstream of Ppnp, in the middle of the intergenic sequence unique to S. antibioticus (Fig. 1B). orfA overlaps and extends 216 bp into the pnp open reading frame but is out of frame with it. The GC3 for orfA is only 54%, while the entire pnp sequence has an overall GC content of 70%. orfA has the capacity to encode a protein of 168 amino acids notably rich in arginine (42 residues) and proline (26 residues). The high arginine content creates a positively charged molecule with an isoelectric point of 12.45. This high positive charge would be ideal for binding of the putative protein to the phosphate backbone of nucleic acids. A BLAST search identified seven eukaryotic proteins involved in RNA or DNA binding with expect values of 10−6 to 10−3 (data not shown).

Time course of pnp expression and detection of an rpsO readthrough transcript.

Semiquantitative RT-PCR was used to assess the time course of expression of pnp. As an internal standard, hrdB was amplified in parallel. hrdB encodes the sigma factor of the RNA polymerase holoenzyme used in vegetative growth, and its transcript has been used as a standard in previous studies in S. coelicolor (29). Total RNA isolated from cultures at different time points was reversed transcribed and used as template in a four-primer multiplex PCR amplification. One set of primers (gps56F and gps840R) was designed to amplify a 358-bp pnp cDNA product. The second set of primers (hrdF2 and hrdR3) produced a hrdB product that migrated on agarose gels as slightly less than 1,000 bp in size. Bands of the predicted sizes were detected at time points of 6 to 96 h postinoculation of GGA medium (Fig. 3A). Densitometric analysis showed that within the range of experimental error, the pnp/hrdB ratio remained essentially constant from 6 to 96 h postinoculation of GGA medium.

FIG. 3.

FIG. 3.

Time course of pnp expression. (A) Multiplex RT-PCR products showing pnp and hrdB products using total RNA preparations from mycelia grown in GGA medium for the indicated times. Std, pnp and hrdB size standards, produced from the PCR of pJSE303 or RT-PCR of hrdB with either primer set gps56F with gps840R or hrdF2 with hrdR3, respectively. All four primers were used in the multiplex PCR. This expression pattern was quite reproducible over four independent experiments. (B) Detection by RT-PCR of an rpsO-pnp readthrough transcription product (rps-pnpRT) in 6- to 96-h S. antibioticus total RNA samples. Lanes labeled pnp and RT (readthrough) are size standards produced by PCR of pJSE303 with primer set gps56F and gps840R and the set rps1 and gps840R, respectively. All three primers were used in the RT-PCR. Std, lambda DNA PstI size standard. This same pattern was seen in three independent experiments. (C) Detection of a pnp RT-PCR product in the sigE-deficient strain, S. antibioticus J2134. wt, wild type. PCR products corresponding to pnp and rpsO-pnp fragments amplified from pJSE303 were combined to create the standard (std).

To detect the presence of a readthrough transcript from rpsO, RT-PCR was performed using primers gps56F and gps840R. In addition a third primer, rps1, centered on sequences ∼133 bp upstream from the rpsO stop codon (Fig. 1A), was included in the RT-PCR. Two bands, coinciding in size to the predicted 877-bp rpsO-pnp readthrough product and the smaller pnp fragment, were seen at the 6- to 96-h time points (Fig. 3B). Given that primer gps56F is complementary to bases downstream of the Ppnp TSP, the smaller band presumably represented amplification products from transcripts generated by both readthrough transcription and by transcription from Ppnp and is thus referred to as total pnp. Densitometric analysis indicated that from 24 to 96 h the readthrough/total pnp transcript ratio remained essentially constant. At the 6-h time point, the ratio was sixfold lower. A third band, running below the pnp product, was an artifact produced in the three-primer multiplex PCR. It was absent from the control PCRs performed with pJSE303 plasmid DNA and a set of two primers, either rps1 and gps840R or gps56F and gps840R (Fig. 3B). These results demonstrate that in S. antibioticus, as in E. coli, a readthrough transcript is produced from a promoter upstream of (or within) rpsO. However, unlike the situation in E. coli, detection of this transcript does not require a null mutation in rnc, the RNase III gene.

To test for σE-dependent Ppnp expression, RT-PCR was performed on 25-h total RNA isolated from the S. antibioticus sigE null mutant, J2134 (27). The same protocol and primers used for detecting an rpsO-pnp readthrough transcript were employed. There was no significant difference in the RT-PCR products obtained from RNA extracted from either wild-type or mutant strains, indicating that the pnp promoter and the promoter upstream of rpsO were still expressed in the mutant (Fig. 3C).

Computer modeling of the rpsO-pnp intergenic region.

In E. coli the rpsO-pnp intergenic region encodes two structural motifs important for gene expression and mRNA processing (20, 44). There is a Rho-independent terminator at the 3′ end of rpsO that is cleaved within the single-stranded region upstream and downstream of the hairpin by RNase E. Downstream from the pnp promoter (P2) is a second hairpin that contains an RNase III binding and cleavage site. We analyzed the S. antibioticus and S. coelicolor rpsO-pnp intergenic regions for analogous structures using the GeneQuest RNA folding program.

A putative transcription terminator (free energy of formation, −28.9 kcal mol−1) was predicted 6 nucleotides downstream from the rpsO stop codon in S. antibioticus. This structure encompasses both the inverted repeat and the first direct repeat sequence conserved in S. antibioticus and S. coelicolor (Fig. 1B and 4A). A second hairpin (free energy of formation, −29.4 kcal mol−1) was predicted in the promoter region, −80 to −150 nucleotides upstream of the pnp translation start codon. Mapping the TSP determined by primer extension (Fig. 2) to the predicted hairpin revealed that both the putative −10 region of Ppnp and the transcription start point lie within the hairpin region (Fig. 4A). This result contrasts with the situation in E. coli, where P2 lies upstream of the hairpin and RNase III cleavage site (Fig. 4B and C).

FIG. 4.

FIG. 4.

Computer-predicted secondary structures in the intergenic regions (nontemplate DNA strand) of the S. antibioticus and E. coli rpsO-pnp operons. (A) Putative S. antibioticus rpsO terminator sequence followed by a hairpin, −150 to −80 nucleotides upstream of the pnp translation start site. The pnp promoter −10 region is in bold, underlined italics. The TSP is in bold underline marked by an asterisk. The rpsO stop codon (TAA) is in bold. Arrows and numbers refer to clones identifying primary transcripts or putative processing sites. Numbers in bold are clones derived from wild-type RNA. Plain numbers indicate clones derived from RNA isolated from S. antibioticus containing pJSE1439. (B) E. coli intergenic region, adapted from Régnier and Portier (44). The pnp promoter (P2) is located between the rpsO terminator and the RNase III processing site, −130 to −70 nucleotides upstream from the pnp start codon. Cleavage occurs on each strand between the bold nucleotides indicated by arrows. (C) Comparison of the intergenic regions. Right-angle arrows indicate promoters. Arrows labeled III indicate RNase III cleavage sites in E. coli. Dark lines represent the primary transcripts produced in each operon.

The RNA species with the greatest mobility in the +16R primer extension reaction shown in Fig. 2 was actually a doublet whose lower band was significantly more intense than the upper. These bands identify bases (TC) that map to an RNase III-like site within the stem of the hairpin shown in Fig. 4A and are labeled 291/295, 296, and 315 in Fig. 2. While this site corresponds to faint bands in the +45R reaction shown in Fig. 2, its presence in other reactions performed using primer +45R (data not shown) makes us confident of its existence. In addition, the +45R reaction produced another band, labeled 319 in Fig. 2, that was absent in the +16R reaction. We discuss these bands in greater detail below.

RLM-RT-PCR cloning of pnp transcripts.

Having detected a putative TSP and a functional promoter in the rpsO-pnp intergenic region, as well as a readthrough transcript, we wanted to (i) confirm the TSP by an independent method and (ii) examine processing of transcripts expressed from Ppnp and via readthrough transcription from the upstream promoter. We used the strategy of RLM-RT-PCR described by Bensing et al. (3) to discriminate between the 5′ end of primary transcripts and the 5′ ends of processed RNAs.

In these experiments, one sample of S. antibioticus total RNA was treated with TAP, while a duplicate sample was not so treated. TAP converts the 5′-triphosphate of primary transcripts to a monophosphate. The RNA samples were then incubated with a 45-base RNA adapter and T4 RNA ligase. This ligation reaction favors 5′-monophosphates and is blocked by the triphosphates of primary transcripts. The RNAs were then reverse transcribed, and the cDNAs were amplified by nested PCR. The 5′ primers corresponded to adapter sequences. The 3′ primers were pnp specific. PCR products were then cloned, screened for inserts of a length predicted to be roughly equivalent to that expected for amplified primary and processed Ppnp transcripts, and then sequenced at the adapter-RNA junction to determine the 5′ terminus of the mRNA.

Our expectations were that cDNA clones derived from TAP+ reactions would include products from both primary and processed transcripts. By contrast, TAP− reactions would generate clones from only processed transcripts. Consistent with these expectations, 7 of 11 TAP+ cDNA clones possessed 5′ ends mapping to the Ppnp TSP site identified by primer extension experiments, while only 1 clone (number 315) mapped within the stem of the large intergenic hairpin (Table 3 and Fig. 4B). By contrast, only one of the TAP− clones (299) mapped to the Ppnp TSP site, while three of five clones mapped to the intergenic hairpin. One of these TAP− clones, 291, identified a site 1 base upstream of the two other clones (295 and 296). Thus, these last three clones correspond to the doublet band seen in primer extension experiments with primer +16R (Fig. 2).

TABLE 3.

RLM-RT-PCR cDNA clones from S. antibioticus and S. antibioticus(pJSE1439)legend

Clone no.
cDNA 5′-end sequence Detected by PX
With TAP Without TAP S. antibioticus S. antibioticus(pJSE1439)
S. antibioticus
    290 TGGC...22...TGCTTCGATCGAAGACCG Yes Yes
    305 TGGC...22...TGCTTCGATCGAAGACCG
    310 TGGC...22...TGCTTCGATCGAAGACCG
    311 TGGC...22...TGCTTCGATCGAAGACCG
    312 TGGC...22...TGCTTCGATCGAAGACCG
    320 TGGC...22...TGCTTCGATCGAAGACCG
    316 TGGC...22...TGCTTCGATCGAAGACCG
299 TGGC...22...TGCTTCGATCGAAGACCG
    319 CTTCGATCGAAGACCG Yes No
291 TCGAAGACCG Yes No
    315 CGAAGACCG Yes No
295 CGAAGACCG
296 CGAAGACCG
    300 333 Internal to pnp ORF ND
    332 Upstream of TSP ND
S. antibioticus(pJSE1439)
    345 TGGC...22...TGCTTCGATCGAAGACCG Yes Yes
    346 TGGC...22...TGCTTCGATCGAAGACCG
    354 TGGC...22...TGCTTCGATCGAAGACCG
    350 CGATCGAAGACCG No Yes
    351 CGATCGAAGACCG
    349 GATCGAAGACCG No No
    348 ACCG No Yes
    344 Upstream of pnp start ND
legend

Numbers in the first and second column identify cDNA clones obtained from RLM-RT-PCR analyses of RNAs from S. antibioticus or S. antibioticus(pJSE1439). “With TAP” and “Without TAP” indicate whether the RNA was treated or not treated with TAP prior to RLM-RT-PCR. The cDNA sequence of the leader region of the pnp transcript, beginning with the 5′ end, is shown in the third column of the table. Whether the 5′ end identified from RLM-RT-PCR was confirmed by primer extension (PX) with RNA isolated from S. antibioticus or S. antibioticus(pJSE1439) is indicated in column 4. ND, not determined. See Fig. 1 for the location of these clones on the 5′ sequence of pnp.

One cDNA clone, 319, from the TAP+ reaction revealed a site also seen in primer extension experiments with primer +45R (Fig. 2). This 5′ end mapped 6 bases upstream of the group of processing sites described above and presumably represents another processing site. In addition, TAP+ clone 332 mapped to a site too far upstream from the Ppnp TSP to be seen in the primer extension experiments and probably represents a processing site of readthrough transcripts.

Two clones, 300 and 333 from TAP+ and TAP− reactions, respectively, mapped to sites internal to the pnp open reading frame, revealing that degradation of mRNA proceeds with net 5′→3′ directionality. The transcripts from these two clones were not seen in primer extension experiments, since their 5′ ends lie downstream from primers +45R and +16R.

Transcriptional analysis of S. antibioticus(pJSE1439).

While the above results indicate that transcripts are processed at sites within the predicted intergenic hairpin, they do not show whether processing occurs in both the readthrough and Ppnp transcripts or in only one of these mRNAs. To differentiate between these two possibilities, we repeated RLM-RT-PCR and primer extension experiments using total RNA isolated from S. antibioticus(pJSE1439). In these experiments, by using 3′ primers that were complementary to sequences within the reporter gene of the promoter probe vector we could specifically examine transcripts originating from Ppnp only. Results are summarized in Table 3.

Eight independent clones were isolated from TAP-treated RLM-RT-PCRs. Of these eight clones, three mapped to the TSP site identified previously in wild-type mycelia. Five clones identified four putative processing sites of the Ppnp transcript, none of which had been found previously. Primer extension studies also identified bands that mapped to the majority of these processing sites as well as the TSP. Primer extension failed to produce any bands that aligned to bases identified earlier as potential processing sites within the intergenic hairpin. This observation may indicate the absence of processing of the transcript from Ppnp by an RNase III-like enzyme.

Computer modeling of a transcript originating from the TSP of Ppnp revealed a cloverleaf-like structure lacking the long hairpin found in modeling of the entire intergenic region (Fig. 5). Five bases identified as processing sites, as well as the TSP, are mapped to this predicted cloverleaf structure in Fig. 5. Four of five cDNA clones (344, 348, 350, and 351) at three of four processing sites mapped to predicted single-stranded regions. The fourth processing site (represented by clone 349) mapped to the top of a stem in a stem-loop. This pattern of sites suggests that an RNase E-like enzyme is responsible for cleavage of the transcript from Ppnp. Also shown in Fig. 5 are the processing sites identified in clones from wild-type mycelia (319, 291, 295, 296, and 315). Curiously, these sites appear located almost as a mirror image of the processing sites observed for RNA from S. antibioticus(pJSE1439). As before, four of five cDNA clones mapped to predicted single-stranded regions. All sites were within or directly adjacent to a 6-base inverted repeat (CUUCGA) that forms a stem-loop structure (Fig. 5).

FIG. 5.

FIG. 5.

Computer-predicted secondary structure of the Ppnp transcript: mfold model of the RNA starting from the Ppnp TSP (in bold letters). Processing sites identified in cDNA clones are numbered and paired with a star to indicate whether they were derived from wild-type RNA (black) or from S. antibioticus(pJSE1439) RNA (white).

DISCUSSION

We have shown that the S. antibioticus rpsO-pnp operon shares a number of similarities with the corresponding operon of E. coli. More importantly, there are also a number of significant differences.

(i) While computer modeling of the readthrough transcripts predicts the presence of a large hairpin analogous to that in E. coli, transcripts originating from the S. antibioticus Ppnp are not predicted to fold into such a structure (compare Fig. 4 and 5). Processing sites on the Ppnp transcript map to single-stranded RNA sequences more typical of RNase E than RNase III cleavage sites.

(ii) An rpsO readthrough transcript was easily detected in the wild-type strain of S. antibioticus, and detection did not require the use of an rnc null mutant as in E. coli. The slower doubling time of S. antibioticus compared to that of E. coli may well lead to a greater half-life of mRNAs in the former organism. Increased stability of the pnp mRNA would facilitate its detection, as would the greater sensitivity of RT-PCR compared to the nuclease protection technique used in E. coli studies (44). Our detection of a readthrough transcript is also consistent with the possibility that RNase III processing plays a different role in pnp expression in S. antibioticus than in E. coli.

(iii) The S. antibioticus Ppnp appears to be similar to promoters recognized by ECF sigma factors. Sequencing of the S. coelicolor genome has identified some 45 ECF sigma factors that allow the organism to respond to a variety of environmental stresses directly at the level of transcription (4, 43). The possibility of transcriptional regulation of pnp has been largely ignored in E. coli, despite the fact that the sequence of the −35 region of the P2 promoter (ACGGCA) suggests utilization of a regulatory protein or alternative sigma factor (44). The presence of cold shock motifs adjacent to the pnp promoters in Photorhabdus sp. and Y. enterocolitica (10, 19) suggests the interesting possibility that cold shock adaptation is transcriptionally regulated in those species.

(iv) The rpsO-pnp intergenic region contains two open reading frames. orfX has a GC composition close to that of streptomycete proteins and a potential ribosome binding site. It is possible that orfX, pnp, and the next downstream gene, a putative protease homologous to a mitochondrial processing peptidase, are translationally coupled. It is also noteworthy that orfX was observed in three streptomycete species. orfA may encode a pseudogene, since it lacks an obvious ribosome binding site and displays an atypical GC3.

Promoter probing studies demonstrated that the S. antibioticus rpsO-pnp intergenic region contains a functional promoter, and RLM-RT-PCR with wild-type RNA independently confirmed the TSP identified through primer extension. The majority of clones derived from the TAP-treated reaction mapped to the primer extension TSP site. By contrast, only one cDNA derived from the untreated RNA identified this site (Table 3). This clone, while unexpected, may have resulted from the activity of a cellular phosphatase. While no dedicated 5′-triphosphatase has been identified in E. coli, PNPase has been reported to have that activity (48), and one might expect some 5′-monophosphorylated primary transcripts to exist in the mRNA pool.

Recent studies of overexpression patterns of pnp in S. antibioticus suggest that pnp expression is autoregulated in a manner dependent upon the presence of the rpsO-pnp intergenic region (8). It also appears that during cold shock pnp is induced to levels similar to those in E. coli (unpublished data). Thus, to what extent is pnp expression regulated in a manner similar to that seen in E. coli? The data presented here suggest the possible action of two additional modes of regulation: RNase E-like processing of the Ppnp transcript, and promoter expression regulated by an ECF-sigma factor. The homology between Ppnp and the sequences of promoters expressed from sigma-E and sigma-R argues strongly for its recognition by an ECF sigma factor, albeit one that has yet to be identified. Alternatively, the failure of RT-PCR to demonstrate sigma-E dependence may be due to sigma factor redundancy, which has been shown to occur frequently with ECF promoters (23, 28).

Our results are consistent with the hypothesis that transcripts originating from Ppnp may be processed by an RNase E-like enzyme. Mapping the processing sites identified from S. antibioticus(pJSE1439) to the predicted structure of Ppnp transcripts cast doubt upon the occurrence of an RNase III-like processing of this transcript (Table 3 and Fig. 5), since the processing sites lie in predicted single-stranded regions, like those cleaved by RNase E (12, 13). Such cleavage could create the dangling 3′ ends required by PNPase for binding and thus retain a means of autoregulation. Further studies will be needed to establish if the curious distribution of sites in RNAs from the wild-type strain and from S. antibioticus(pJSE1439) around a 6-base inverted repeat in the cloverleaf structure is significant.

Although the studies performed with RNA from S. antibioticus(pJSE1439) suggest that a single-strand-specific endoribonuclease like RNase E is involved in processing the transcripts originating from Ppnp, these studies do not rule out a role for RNase III-like processing of the readthrough transcript. A subset of the processing sites identified by the RLM-RT-PCR from wild-type RNA (291, 295, 296, and 315) mapped to the intergenic hairpin structure and are located at bases analogous to those cleaved by RNase III in E. coli (Fig. 4). That primer extension of transcripts arising from pJSE1439 failed to identify any of these sites suggests that they may indeed represent processing of readthrough transcripts. It should be noted that the absB gene of S. coelicolor encodes an RNase III homolog (39). We are currently characterizing the product of this gene biochemically.

The argument that the readthrough transcript and the transcript from Ppnp may be processed by different routes does not in and of itself explain the observation that none of the putative processing sites observed using RNA from wild-type cultures was observed with RNA obtained from S. antibioticus(pJSE1439) and vice versa. We believe this observation may reflect differences in the relative stabilities of the readthrough transcript and the transcript from Ppnp in wild-type mycelia, and/or the relative abundance of the Ppnp transcript in the pool from S. antibioticus(pJSE1439) compared with the wild-type system. We note in the latter regard that pJSE1439 is a high-copy-number plasmid (51). We note, further, that there may be processing sites for both the readthrough and Ppnp transcripts that we have not yet detected. Experiments are in progress to examine these possibilities. The in vitro reconstitution of the rpsO-pnp processing system using RNase E (31) and RNase III (39) may be the best way to determine the processing mechanisms for the readthrough transcript and the transcript from Ppnp in S. antibioticus.

Streptomycete open reading frames with a low GC3 percentage are presumed to be pseudogenes, especially if they are not homologous to any known protein (52). Thus, both orfX and orfA may be pseudogenes. However, in S. coelicolor, S. avermitilis, and S. antibioticus the orfX stop codon (TGA) overlaps the pnp start codon (GTG). Similarly, the stop codon of pnp overlaps the start codon of the downstream protease. Thus, there is the formal possibility that the streptomycete pnp is translationally coupled to orfX and/or the protease.

The proximity of orfX to pnp and the size of the peptide that it could encode (33 to 36 amino acids) suggest an additional interpretation. The nuclear-encoded human, mouse, fruit fly, and nematode PNPases have an extended N terminus of 33 to 51 amino acids compared to bacterial PNPases (37, 42). These residues appear to encode a mitochondrial targeting sequence (42), and localization of human PNPase to HeLa cell mitochondria is dependent upon the presence of the N-terminal 52 amino acids (37). In eukaryotes, the mitochondrial targeting sequence is removed from most imported precursor polypeptides by mitochondrial processing peptidase (17). We used four computer programs (iPSORT [17], Predotar [www.inra.fr /predotar/], MitoProt II 1.0a4 [11], and TargetP version 1.0 [2, 16]) to analyze the hypothetical S. antibioticus orfX peptide. All four programs identified the 33-amino-acid peptide as a putative mitochondrial targeting sequence when it was input alone or fused to the S. antibioticus PNPase N-terminal sequence. By contrast, when comparable lengths of PNPase N-terminal residues were used as input, no mitochondrial localization was predicted.

There is another rather intriguing potential regulatory mechanism for the rpsO-pnp operon that has yet not been examined in any detail. In E. coli, encoded on the complementary strand of the rpsO-pnp intergenic region is an antisense RNA, sraG (1). Originally predicted through computer analysis, sraG overlaps both the RNase III sites and rpsO terminator and as yet has no known function. SraG is expressed as a ca. 170-nucleotide transcript during late logarithmic phase and is specifically processed to a 146-nucleotide product. Steady-state levels of sraG are markedly increased by cold shock (1). The Rfam database (www.sanger.ac.uk/Software/Rfam) annotates a family of sraG genes conserved in five Enterobacteriaceae. While we could not employ the algorithms used by Aragaman et al. (1), preliminary computer analysis of the rpsO-pnp intergenic regions of S. antibioticus, S. coelicolor, S. avermitilis, and Mycobacterium leprae suggests also that these high-GC gram-positive organisms may also contain an sraG gene. Further studies are planned to assess sraG expression in Streptomyces.

The identification of heteropolymeric poly(A) tails in streptomycetes, chloroplasts, and cyanobacteria has already shown that PNPase plays a role in these organisms that is different from that in E. coli and has raised questions regarding the ancestral role of PNPase in the evolution of polyadenylating enzymes (8, 46). The crystal structure of the S. antibioticus PNPase has been used to model the structure of the bacterial degradosome and the human exosome (42), as well as the chloroplast exosome (50).

Further studies of pnp promise to shed additional light on eubacterial and eukaryotic physiology and evolution.

Acknowledgments

This work was supported by research grants from the National Science Foundation (MCB-0133520) and from Emory University to G.H.J.

REFERENCES

  • 1.Argaman, L., R. Hershberg, J. Vogel, G. Bejerano, E. G. H. Wagner, H. Margalit, and S. Altuvia. 2001. Novel small RNA-encoding genes in the intergenic regions of Escherichia coli. Curr. Biol. 11:941-950. [DOI] [PubMed] [Google Scholar]
  • 2.Bannai, H., Y. Tamada, O. Maruyama, K. Nakai, and S. Miyano. 2002. Extensive feature detection of N-terminal protein sorting signals. Bioinformatics 18:298-305. [DOI] [PubMed] [Google Scholar]
  • 3.Bensing, B. A., B. J. Meyer, and G. M. Dunny. 1996. Sensitive detection of bacterial transcription initiation sites and differentiation from RNA processing sites in the pheromone-induced plasmid transfer system of Enterococcus faecalis. Proc. Natl. Acad. Sci. USA 93:7794-7799. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bentley, S. D., K. F. Chater, A.-M. Cerdeño-Tárrage, G. L. Challis, N. R. Thomson, K. D. James, et al. 2002. Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2). Nature 417:141-147. [DOI] [PubMed] [Google Scholar]
  • 5.Beran, K., and R. W. Simons. 2001. Cold-temperature induction of Escherichia coli polynucleotide phosphorylase occurs by reversal of its autoregulation. Mol. Microbiol. 39:112-125. [DOI] [PubMed] [Google Scholar]
  • 6.Bralley, P., and G. H. Jones. 2001. Poly(A) polymerase activity and RNA polyadenylation in Streptomyces coelicolor. Mol. Microbiol. 40:1155-1164. [DOI] [PubMed] [Google Scholar]
  • 7.Bralley, P., and G. H. Jones. 2002. cDNA cloning confirms the polyadenylation of RNA decay intermediates in Streptomyces coelicolor. Microbiology 148:1421-1425. [DOI] [PubMed] [Google Scholar]
  • 8.Bralley, P., and G. H. Jones. 2003. Overexpression of the polynucleotide phosphorylase gene (pnp) of Streptomyces antibioticus affects mRNA stability and poly(A) tail length but not ppGpp levels. Microbiology 149:2173-2182. [DOI] [PubMed] [Google Scholar]
  • 9.Carpousis, A. J., N. F. Vanzo, and L. C. Raynal. 1999. mRNA degradation: a tale of poly(A) and multiprotein machines. Trends Genet. 15:24-28. [DOI] [PubMed] [Google Scholar]
  • 10.Clarke, D. J., and B. C. A. Dowds. 1994. The gene coding for polynucleotide phosphorylase in Photorhabdus sp. strain K122 is induced at low temperatures. J. Bacteriol. 176:3775-3784. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Claros, M. G., and P. Vincens. 1996. Computational method to predict mitochondrially imported proteins and their targeting sequences. Eur. J. Biochem. 241:770-786. [DOI] [PubMed] [Google Scholar]
  • 12.Coburn, G. A., and G. A. Mackie. 1999. Degradation of mRNA in Escherichia coli: an old problem with some new twists. Prog. Nucleic Acids Res. Mol. Biol. 62:55-108. [DOI] [PubMed] [Google Scholar]
  • 13.Cohen, S. N., and K. J. McDowall. 1997. RNase E: still a wonderfully mysterious enzyme. Mol. Microbiol. 23:1099-1106. [DOI] [PubMed] [Google Scholar]
  • 14.Deutscher, M. P., and N. B. Reuven. 1991. Enzymatic basis for hydrolytic versus phosphorolytic mRNA degradation in Escherichia coli and Bacillus subtilis. Proc. Natl. Acad. Sci. USA 88:3277-3280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Donovan, W. P., and S. R. Kushner. 1986. Polynucleotide phosphorylase and ribonuclease II are required for cell viability and mRNA turnover in Escherichia coli K12. Proc. Natl. Acad. Sci. USA 83:120-124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Emanuelsson, O., H. Nielsen, S. Brunak, and G. von Heijne. 2000. Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. J. Mol. Biol. 300:1005-1016. [DOI] [PubMed] [Google Scholar]
  • 17.Gakh, O., P. Cavadini, and G. Isaya. 2002. Mitochondrial processing peptidases. Biochem. Biophys. Acta 1592:63-77. [DOI] [PubMed] [Google Scholar]
  • 18.Gallo, M., and E. Katz. 1972. Regulation of secondary metabolite biosynthesis: catabolite repression of phenoxazinone synthetase and actinomycin formation by glucose. J. Bacteriol. 109:659-667. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Goverde, R. L. S., J. H. J. Huis in't Veld, J. G. Kusters, and F. R. Mooi. 1998. The psychrotrophic bacterium Yersinia enterocolitica requires expression of pnp, the gene for polynucleotide phosphorylase, for growth at low temperature (5°C). Mol. Microbiol. 28:555-569. [DOI] [PubMed] [Google Scholar]
  • 20.Hajnsdorf, E., O. Steier, L. Coscoy, L. Teysset, and P. Regnier. 1994. Roles of RNase E, RNase II and PNPase in the degradation of the rpsO transcripts of Escherichia coli: stabilizing function of RNase II and evidence for efficient degradation in an ams pnp rnb mutant. EMBO J. 13:3368-3377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Herendeen, S. L., R. A. van Bogelen, and F. C. Neidhardt. 1979. Levels of major proteins of Escherichia coli during growth at different temperatures. J. Bacteriol. 139:185-194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Hsieh, C.-J., and G. H. Jones. 1995. Nucleotide sequence, transcriptional analysis, and glucose regulation of the phenoxazinone synthase gene (phsA) from Streptomyces antibioticus. J. Bacteriol. 177:5740-5747. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Huang, X., and J. D. Helmann. 1998. Identification of target promoters for the Bacillus subtilis σX factor using a consensus-directed search. J. Mol. Biol. 279:165-173. [DOI] [PubMed] [Google Scholar]
  • 24.Ishikawa, J., and K. Hotta. 1999. FramePlot: a new implementation of the frame analysis for predicting protein-coding regions in bacterial DNA with a high G + C content. FEMS Microbiol. Lett. 174:251-253. [DOI] [PubMed] [Google Scholar]
  • 25.Jarrige, A.-C., N. Mathy, and C. Portier. 2001. PNPase autocontrols its expression by degrading a double-stranded structure in the pnp mRNA leader. EMBO J. 20:6845-6855. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Jones, G. H., and M. J. Bibb. 1996. Guanosine pentaphosphate synthetase from Streptomyces antibioticus is also a polynucleotide phosphorylase. J. Bacteriol. 178:4281-4288. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Jones, G. H., M. S. B. Paget, L. Chamblerin, and M. J. Buttner. 1997. Sigma-E is required for the production of the antibiotic actinomycin in Streptomyces antibioticus. Mol. Microbiol. 23:169-178. [DOI] [PubMed] [Google Scholar]
  • 28.Kang, J.-G., M.-Y. Hahn, A. Ishihama, and J.-H. Roe. 1997. Identification of sigma factors for growth phase-related promoter selectivity of RNA polymerase from Streptomyces coelicolor A3(2). Nucleic Acids Res. 25:2566-2573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Kelemen, G. H., G. L. Brown, J. Kormanec, L. Potúcková, K. F. Chater, and M. J. Buttner. 1996. The positions of the sigma-factor genes, whiG and sigF, in the hierarchy controlling the development of spore chains in the aerial hyphae of Streptomyces coelicolor A3(2). Mol. Microbiol. 21:593-603. [DOI] [PubMed] [Google Scholar]
  • 30.Kieser, T., M. J. Bibb, M. J. Buttner, K. F. Chater, and D. A. Hopwood. 2000. Practical Streptomyces genetics, p. 10-11 and 234-235. The John Innes Foundation, Norwich, United Kingdom.
  • 31.Lee, K., and S. N. Cohen. 2003. A Streptomyces coelicolor functional orthologue of Escherichia coli RNase E shows shuffling of catalytic and PNPase-binding domains. Mol. Microbiol. 48:349-360. [DOI] [PubMed] [Google Scholar]
  • 32.Mathy, N., A. C. Jarrige, M. Robert-Le Meur, and C. Portier. 2001. Increased expression of Escherichia coli and polynucleotide phosphorylase at low temperatures is linked to a decrease in the efficiency of autocontrol. J. Bacteriol. 183:3848-3854. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Mitra, S., K. Hue, and D. H. Bechhofer. 1996. In vitro processing of Bacillus subtilis polynucleotide phosphorylase. Mol. Microbiol. 19:329-342. [DOI] [PubMed] [Google Scholar]
  • 34.Mohanty, B. K., and S. R. Kushner. 2000. Polynucleotide phosphorylase functions as both a 3′-5′-exonuclease and a poly(A) polymerase in Escherichia coli. Proc. Natl. Acad. Sci. USA 97:11966-11971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Nierlich, D. P., and G. J. Murakawa. 1996. The decay of bacterial messenger RNA. Prog. Nucleic Acid Res. Mol. Biol. 52:153-216. [DOI] [PubMed] [Google Scholar]
  • 36.Paget, M. S., J. G. Kang, J. H. Roe, and M. J. Buttner. 1998. SigmaR, an RNA polymerase sigma factor that modulates expression of the thioredoxin system in response to oxidative stress in Streptomyces coelicolor A3(2). EMBO J. 17:5776-5782. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Piwowarski, J., P. Grzechnik, A. Dziembowski, A. Dmochowska, M. Minczuk, and P. P. Stepien. 2003. Human polynucleotide phosphorylase, hPNPase, is localized in mitochondria. J. Mol. Biol. 329:853-857. [DOI] [PubMed] [Google Scholar]
  • 38.Portier, C., L. Dondon, M. Grunberg-Manago, and P. Regnier. 1987. The first step in the functional inactivation of the E. coli polynucleotide phosphorylase messenger is a ribonuclease III processing at the 5′ end. EMBO J. 6:2165-2170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Price, B., T. Adamis, and W. Champness. 1999. A Streptomyces coelicolor antibiotic regulatory gene, absB, encodes an RNase III homolog. J. Bacteriol. 181:6142-6151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Py, B., C. F. Causton, E. A. Mudd, and C. F. Higgins. 1994. A protein complex that mediates mRNA degradation in Escherichia coli. Mol. Microbiol. 14:717-729. [DOI] [PubMed] [Google Scholar]
  • 41.Py, B., C. F. Higgins, H. M. Krisch, and A. J. Carpousis. 1996. A DEAD-box RNA helicase in the Escherichia coli RNA degradosome. Nature 381:169-172. [DOI] [PubMed] [Google Scholar]
  • 42.Raijmakers, R., W. V. Egberts, W. J. van Venrooij, and G. J. M. Pruijn. 2002. Protein-protein interactions between human exosome components support the assembly of RNase PH-type subunits into a six-membered PNPase-like ring. J. Mol. Biol. 323:653-663. [DOI] [PubMed] [Google Scholar]
  • 43.Rainia, T. L., and T. J. Silhavy. 2001. Periplasmic stress and ECF sigma factors. Annu. Rev. Microbiol. 55:591-624. [DOI] [PubMed] [Google Scholar]
  • 44.Régnier, P., and C. Portier. 1986. Initiation, attenuation and RNase III processing of transcripts from the Escherichia coli operon encoding ribosomal protein S15 and polynucleotide phosphorylase. J. Mol. Biol. 187:23-32. [DOI] [PubMed] [Google Scholar]
  • 45.Robert-LeMeur, M., and C. Portier. 1994. Polynucleotide phosphorylase of Escherichia coli induces the degradation of its RNase III processed messenger by preventing its translation. Nucleic Acids Res. 22:397-403. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Rott, R., G. Zipor, V. Portnoy, V. Liveanu, and G. Schuster. 2003. RNA polyadenylation and degradation in cyanobacteria are similar to the chloroplast and different from Escherichia coli. J. Biol. Chem. 278:15771-15777. [DOI] [PubMed] [Google Scholar]
  • 47.Shiina, T., K. Tanaka, and H. Takahashi. 1991. Sequence of hrdB, an essential gene encoding a sigma-like transcription factor of Streptomyces coelicolor A3(2): homology to principle sigma factors. Gene 107:145-148. [DOI] [PubMed] [Google Scholar]
  • 48.Sulewski, M., S. P. Marchese-Ragona, K. A. Johns, and S. J. Benkovic. 1989. Mechanism of polynucleotide phosphorylase. Biochemistry 28:5855-5858. [DOI] [PubMed] [Google Scholar]
  • 49.Symmons, M. F., G. H. Jones, and B. F. Luisi. 2000. A duplicated fold is the structural basis for polynucleotide phosphorylase catalytic activity, processivity, and regulation. Struct. Fold Des. 15:1215-1226. [DOI] [PubMed] [Google Scholar]
  • 50.Symmons, M. F., M. G. Williams, B. F. Luisi, G. H. Jones, and A. J. Carpousis. 2002. Running rings around RNA: a superfamily of phosphate-dependent RNases. Trends Biochem. Sci. 27:11-18. [DOI] [PubMed] [Google Scholar]
  • 51.Ward, J. M., G. R. Janssen, T. Kieser, M. J. Bibb, M. J. Buttner, and M. J. Bibb. 1986. Construction and characterization of a series of multi-copy promoter-probe plasmid vectors from Streptomyces using the aminoglycoside phosphotransferase gene from Tn5 as indicator. Mol. Gen. Genet. 203:468-478. [DOI] [PubMed] [Google Scholar]
  • 52.Yang, C.-C., H.-H. Huang, C.-Y. Li, Y.-G. Tsay, S.-C. Lee, and C. W. Chen. 2000. The terminal proteins of linear Streptomyces chromosomes and plastids: a novel class of replication priming proteins. Mol. Microbiol. 43:297-305. [PubMed] [Google Scholar]
  • 53.Yehudai-Resheff, S., M. Hirsh, and G. Schuster. 2001. Polynucleotide phosphorylase functions as both an exonuclease and a poly(A) polymerase is spinach chloroplasts. Mol. Cell. Biol. 21:5408-5416. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Zucker, M. 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31:1-10. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES