A Phage Protein Confers Resistance to the Lactococcal Abortive Infection Mechanism AbiP

Abstract

Phage bIL66M1 is sensitive to the lactococcal abortive infection mechanism AbiP. No spontaneous AbiP-resistant variant could be obtained at a frequency of <10⁻¹⁰. However, AbiP-resistant variants were readily obtained during infection with both bIL66M1 and the highly homologous AbiP-resistant phage bIL170. Gain of AbiP resistance was due to the acquisition of the e6 gene from bIL170.

Dairy lactococci have evolved an outstanding panoply of mechanisms enabling them to resist bacteriophage infection. In particular, they frequently possess bacteriophage abortive infection mechanisms (Abi) (4, 6, 15, 28) that interrupt an intracellular step of phage multiplication, leading to death of the infected cell and survival of the bacterial population (23, 27). Functional studies of these mechanisms have revealed a great diversity in their modes of action (14).

Lactococcal phages fall into three prevalent groups of DNA homology (19). Two of these groups (c6A and 936) are composed of virulent phages, and the third (P335) is composed of both temperate and virulent phages (20). In a group of phages, not all individuals are sensitive to a given Abi system. In some instances, sensitive phages have been reported to give rise to resistant variants. P335 phages have been shown to acquire resistance to Abi by either exchange of a DNA segment with a resident prophage or point mutations (4, 5, 12, 13, 22). By contrast, virulent phages of the 936 group, which have no homologous prophage on the host chromosome, evolved resistance to Abi only by point mutations (2-4, 13, 15). The mechanisms by which these variants bypass lactococcal Abis are unknown. It has, however, been established that phage bIL66 most likely activates AbiD1 following infection, whereas mutants resistant to AbiD1 are unable to do so (3).

AbiP has recently been shown to block phage bIL66M1 DNA replication 10 min after infection and to prevent the early transcription switch-off (14). Here we show that the early expressed phage bIL170 e6 gene (e6_bIL170) confers resistance to AbiP (AbiP^r) and is readily transferred to AbiP-sensitive (AbiP^s) phages during coinfection.

AbiP is active on lactococcal phages of the 936 group (19), bIL41, bIL66M1, and sk1 but not on bIL170 (14). Phages of this group share homology over 90 to 92% of their genome length (9). In order to determine the phage region(s) involved in sensitivity or resistance to AbiP, we first tried to isolate spontaneous AbiP^r mutants from phage bIL41, bIL66M1, or sk1. Phages, AbiP⁻ plasmid-free L. lactis strains IL1403 (8) and MG1363 (16), AbiP⁺ derivatives IL1403(pIL2617) and MG1363(pIL2617), and growth conditions were previously described (14). AbiP^s phages form barely visible turbid plaques (typical of the sensitivity to an Abi mechanism), while AbiP^r phages form easily recognizable clear plaques. No mutant was obtained at a frequency of <10⁻¹⁰, suggesting that no single mutation can confer resistance to AbiP. We therefore used a second strategy, aimed at selecting hybrid phages having gained resistance to AbiP by recombination with a highly homologous AbiP^r phage. Comparison of the genome of the hybrids to the genome of the parents would allow identification of the region(s) involved in resistance to AbiP.

In a first experiment, IL1403(pIL1201, pIL352), expressing both AbiB (10, 25) and AbiP (14), was coinfected with phages bIL41 (AbiB^r and AbiP^s) and bIL170 (AbiB^s and AbiP^r). Progeny phages formed plaques on the same strain. Under these conditions, both parental phages formed barely visible turbid plaques. By contrast, hybrid phages resistant to both Abi mechanisms formed clear plaques at a frequency of approximately 10⁻⁴ (24; A. M. Crutz-Le Coq, unpublished observations). Ten phages were isolated from clear plaques and propagated on the AbiB⁺ AbiP⁺ IL1403(pIL1201, pIL352) strain. This purification step was repeated twice. Purified phages demonstrated the same efficiency of plating on IL1403 and on the AbiB⁺ AbiP⁺ strain IL1403(pIL1201, pIL352). The structure of phage genomes was compared to that of the parent phages by restriction analysis. Two phages representative of the population of recombinant phages were further characterized. This was done by amplifying hybrid and parental phage DNAs in seven slightly overlapping PCR fragments covering the whole genome. DNA amplification was carried out as described previously (14). The oligonucleotides used (Table 1) were complementary to bIL170 sequence (11), which was expected to be very homologous to that of bIL41. Each segment was digested separately using the indicated restriction enzymes (Fig. 1). Some segments gave restriction profiles identical to that of bIL170 or bIL41 and were thus recorded as originating from this parent. (This analysis did not exclude the possibility that short sequences had been exchanged.) Other segments gave restriction profiles not entirely identical to that of one or the other parent, indicating that recombination has taken place. The two AbiP^r hybrids had only a 5.6-kb region from the AbiP^r phage bIL170 in common. This region covers a 3′ part of segment F, which is part of the early phage region, and segment G, corresponding to the middle phage region (Fig. 1).

TABLE 1.

Oligonucleotides used in the study

No.	Sequence (5′→3′)a	Complementary to:
		DNA	Accession no.	Coordinates
1	TCCCCCGGGGGAGCTTGGACTGAACGAAGTG	pIL253	AF041239	2481-2499
2	AACTGCAGAACCAATGCATTGGCCTTCTCTGTCGCTATCTG	pIL253	AF041239	3057-3038
3	GCGCGCGAGCTCAAGGAAAGGTAACAGAAAATGAGTG	bIL170	AF009630	27422-27385
4	GCGCGCGAGCTCTTAATAGCTTTGTTTTCGTA	bIL170	AF009630	27182-27201
5	TTAATAGCTTTGTTTTCGTA	bIL170	AF009630	27182-27201
6	ATGAGTGAAAAATATTACGT	bIL170	AF009630	27391-27372
7	CGCGCGCCCGGGCGCGCGCCATTAATAACAGCGTCTAA	bIL170	AF009630	26701-26720
8	TACGAAAACAAAGCTATTAAATGATTAATTACGAAAACAA	bIL170	AF009630	27191-27204
9	GGGCCCCTGCAGGGGCCCGTTATCTTGGATAACCTAATGAC	bIL66M1	AY249139	3415-3437
10	ACGTAATATTTTTCACTCATTTTCTGTTACTTTTCCTTGC	bIL66M1	AY249139	2941-2964
11	TTATGCAAACTCAATGGACG	bIL66M1	AY249139	3288-3269
12	AATGCACGATATAACCAACC	bIL66M1	AY249139	2877-2896
13	GTTCATTTAACGCTCTCAGT	bIL170	AF009630	27205-27224
14	GCTAATGAAATCGAACGCAAACTTAAAGAA	bIL170	AF009630	28734-28705
15	TTTTTGGGCTTTCTCTGCACGTTTAGCAAG	bIL170	AF009630	24021-24050

^aRestriction sites used for cloning experiments are underlined.

FIG. 1.

Genome structure of phage bIL170, phage bIL41, and hybrid phages h1 and h3. Arrows represent temporal transcription units. Boxes A to G correspond to genome segments amplified by long-range PCR. Restriction enzymes used to compare genome segments are indicated. Sequences from bIL170 are marked in black; sequences from bIL41 are marked in white. Regions marked in gray may originate from either parent.

The involvement of the phage middle region in the resistance to AbiP was unlikely, since the adverse effect of AbiP on phage development can be detected before phage middle genes are expressed (14). Therefore, to localize more precisely the region conferring AbiP^r, we modified the experimental procedure by replacing phage bIL41 and AbiB by phage bIL66M1 (2) and AbiD1 (1). The rationale for this change is that the resistance of bIL66M1 to AbiD1 is due to a mutation in one middle expressed gene (2) and that this region would likely be conserved in the hybrid progeny. Another advantage is that the DNA sequence of this region of bIL66M1 is known (2, 14), thus facilitating restriction analysis of the hybrids. The AbiD1⁺ AbiP⁺ strain IL1403(pIL105, pIL352) was coinfected with phages bIL170 (AbiD1^s AbiP^r) and bIL66M1 (AbiD1^r AbiP^s). Clear plaques were formed at a frequency of approximately 10⁻³. Phage purified from 11 independent clear plaques demonstrated the same efficiency of plating on IL-1403 and on the AbiD1⁺ AbiP⁺ strain IL-1403(pIL105, pIL352). Segments G and F of recombinant phage were amplified by long-range PCR. The restriction patterns of segment G from all hybrid phages were similar to that of the AbiP^s phage bIL66M1, confirming that the phage middle operon is not required for resistance to AbiP. By contrast, the restriction patterns of segment F were all different from those of the parents. Thus, the F segments of three representative hybrid phages were compared in more detail. This allowed the identification of one hybrid phage, called h7, which contained less bIL170 DNA than the others. The structure of the F segment of h7is shown in Fig. 2. From these data, h7 is likely to result from two homologous recombination events, leading to the exchange of a 1.5-kb region between bIL66M1 and bIL170. These 1.5-kb regions are very similar in both phages. The most striking difference is the presence of an additional open reading frame in bIL170, e6_bIL170, which has no counterpart in bIL66M1.

FIG. 2.

Genetic structure of the F long-range PCR fragment of phage bIL170, bIL66M1, and hybrid phage h7. Black and white arrows indicate open reading frames from phages bIL170 and bIL66M1, respectively. Open reading frames marked in dark gray may originate from either parent. Light gray boxes indicate highly homologous DNA sequence. Dotted lines indicate regions where homologous recombination has occurred.

To check if the resistance of phage h7 to AbiP is linked to e6_bIL170, this open reading frame was expressed in trans in the AbiP⁺ IL1403(pIL2617) strain. e6_bIL170 was amplified using phage bIL170 DNA as a template and oligonucleotides 3 and 4. The PCR fragment was cloned at the SacI site of plasmid pIL871 (14). The resulting plasmid, pIL5303, was transferred in the AbiP⁺ IL1403(pIL2617) strain (14) using electroporation (18). Plasmids pIL2617 and pIL5303 were derived from pIL253 and pIL871, respectively, and can be maintained in a mixture with similar copy numbers by double antibiotic selection (14). The AbiP^s phages bIL66M1 and bIL41 were enumerated on the AbiP⁺ strain IL1403(pIL2617) in the presence and absence of e6_bIL170 (Table 2). In the presence of e6_bIL170, the plaques formed were still turbid but the efficiency of plating was increased by 4 and 5 orders of magnitude for phages bIL66M1 and bIL41, respectively. Therefore, expression in trans of e6_bIL170 strongly decreases the AbiP efficiency but did not fully restore phage growth. This could result from an inappropriate level or timing of expression of the cloned e6_bIL170 as compared to phage-encoded e6_bIL170. Another explanation would be that an additional undetected phage genome region would be needed to confer full AbiP^r. To discriminate between these possibilities, we performed a directed insertion of e6_bIL170, into the AbiP^s phage bIL66M1. For this, we took advantage of the capacity of Lactococcus lactis phages to recombine readily with a resident plasmid carrying a homologous phage segment (2). Plasmid pIL5304, harboring e6_bIL170 flanked by e6_bIL66M1 and e7_bIL66M1, was constructed using three PCR fragments. e6_bIL170 was amplified using oligonucleotides 5 and 6. e7_bIL66M1 and the 5′ part of e8_bIL66M1 were amplified with oligonucleotides 7 (with an SmaI extension) and 8 (with an extension complementary to the 3′ end of e6_bIL170). e6_bIL66M1 was amplified using oligonucleotides 9 (with a PstI extension) and 10 (with an extension complementary to the 5′ end of e6_bIL170). The three PCR fragments were mixed and used as a template in a PCR with oligonucleotides 7 and 9. The final PCR product was cloned at the SmaI-PstI sites of the plasmid vector pIL253 (26). The recombinant plasmid pIL5304 was transferred in the AbiP⁺ IL1403(pIL2618) strain. pIL2618 was obtained by cloning the abiP gene, amplified from plasmid pIL2617 (14) using oligonucleotides 1 and 2, at the HincII-PstI sites of pIL2608. Plasmid vector pIL2608 (M. C. Chopin and J. Anba, unpublished work) was constructed by ligating a 1.7-kb fragment containing the replication region of the natural lactococcal plasmid pIL105 (17) to a cassette containing the tetM gene of Tn1545 (21). An exponential-phase culture (optical density at 600 nm of 0.4) of the IL-1403(pIL2618, pIL5304) strain was infected with phage bIL66M1 and plated on the AbiP⁺ strain IL1403(pIL2618). Nine clear plaques were observed among 10⁴ turbid plaques. In a control experiment, performed in the absence of pIL5304, no clear plaque was observed. Phages picked up from the nine clear plaques were propagated twice on IL1403(pIL2618). All demonstrated the same efficiency of plating on the AbiP⁻ IL1403 and the AbiP⁺ IL1403(pIL2618) strains. They were thus fully resistant to AbiP. PCR analysis confirmed that e6_bIL170 had been transferred in each genome. Sequencing of relevant regions indicated that e6_bIL170 was present at the expected position in all nine recombinant phage genomes (Fig. 3). These results indicate that e6_bIL170 is the determinant of the AbiP^r phenotype. E6_bIL170 (69 amino acids) shares no significant homology with proteins in the databases, precluding any hypothesis to be made about its function. By contrast to bIL66M1, the AbiP^s phages bIL41 (A. M. Crutz LeCoq, personal communication) and sk1 (7) possess a gene of the same length (encoding 70 and 60 amino acids, respectively), and at the same position that e6_bIL170. Proteins encoded by these genes had some homology in the N- and C-terminal parts, flanking a variable central region. This variable protein might be dispensable in 936 phages, and not all orthologs can confer resistance to AbiP.

TABLE 2.

Effect of the expression of E6_bIL170 in trans on the efficiency of plating of AbiPs phages

Indicator strain	Characteristic(s)	Efficiency of plating ofa:
		bIL66M1	bIL41
IL1403	AbiP−	1	1
IL1403(pIL2617, pIL871)	AbiP+	10−7	10−8
IL1403(pIL2617, pIL5303)	AbiP+, e6bIL170 in trans	10−3	10−3

^aThe efficiency of plating of phages bIL66M1 and bIL41 was determined on IL1403 AbiP⁺ derivatives, in the presence or absence of E6_bIL170 in trans. Shown is the number of PFU per milliliter formed on the indicator strain divided by the number of PFU per milliliter formed on the control strain IL1403.

FIG. 3.

Insertion of e6_bIL170 in bIL66M1 genome. The insertion was designed in order to mimic in bIL66M1(E6) the overlap that exists between e6_bIL66M1 and e7_bIL66M1.

Our results show that virulent lactococcal phages from the 936 group can acquire Abi^r by recombination with a homologous coinfecting phage. Given the high concentration of phages that may occur in a dairy environment, coinfection should not be a rare event and may represent a significant mode of evolution.