Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Apr 1.
Published in final edited form as: Mol Microbiol. 2014 Mar 11;92(2):234–245. doi: 10.1111/mmi.12556

Incorporation of Extracellular Fatty Acids by a Fatty Acid Kinase-Dependent Pathway in Staphylococcus aureus

Joshua B Parsons 1, Matthew W Frank 1, Pamela Jackson 1, Chitra Subramanian 1, Charles O Rock 1,*
PMCID: PMC4007170  NIHMSID: NIHMS571898  PMID: 24673884

Summary

Acyl-CoA and acyl-acyl carrier protein (ACP) synthetases activate exogenous fatty acids for incorporation into phospholipids in Gram-negative bacteria. However, Gram-positive bacteria utilize an acyltransferase pathway for the biogenesis of phosphatidic acid that begins with the acylation of sn-glycerol-3-phosphate by PlsY using an acyl-phosphate (acyl-PO4) intermediate. PlsX generates acyl-PO4 from the acyl-ACP end-products of fatty acid synthesis. The plsX gene of Staphylococcus aureus was inactivated and the resulting strain was both a fatty acid auxotroph and required de novo fatty acid synthesis for growth. Exogenous fatty acids were only incorporated into the 1-position and endogenous acyl groups were channeled into the 2-position of the phospholipids in strain PDJ39 (ΔplsX). Extracellular fatty acids were not elongated. Removal of the exogenous fatty acid supplement led to the rapid accumulation of intracellular acyl-ACP and the abrupt cessation of fatty acid synthesis. Extracts from the ΔplsX strain exhibited an ATP-dependent fatty acid kinase activity, and the acyl-PO4 was converted to acyl-ACP when purified PlsX is added. These data reveal the existence of a novel fatty acid kinase pathway for the incorporation of exogenous fatty acids into S. aureus phospholipids.

Keywords: fatty acid synthesis, PlsX, PlsY, acyl carrier protein, acyl-phosphate, S. aureus

Introduction

Phosphatidic acid (PtdOH) is a universal intermediate in the biosynthesis of membrane phospholipids in eubacteria (Yao and Rock, 2013). In the Escherichia coli model, PtdOH formation is initiated by the acylation of sn-glycerol-3-phosphate (G3P) by PlsB, a G3P acyltransferase. PlsB of E. coli has been extensively characterized and utilizes either acyl-acyl carrier protein (ACP) or acyl-CoA thioesters to acylate the 1-position of G3P (Rock et al., 1981a; Lightner et al., 1980; Green et al., 1981). PlsB is responsible for the selection of fatty acids incorporated into the 1-position of membrane phospholipids and is a key regulatory point in the pathway (Yao and Rock, 2013; Rock et al., 1981b; Cronan, Jr. and Rock, 1996; Heath et al., 1994). However, most bacteria, including important human Gram-positive pathogens such as Streptococcus pneumoniae and Staphylococcus aureus, lack a plsB gene and instead use the PlsX/PlsY pathway for the acylation of G3P (Lu et al., 2006) (Fig. 1). In these systems, the soluble PlsX is an acyl-ACP:PO4 transacylase that converts the acyl-ACP end-products of de novo fatty acid synthesis to their acyl-PO4 derivatives. These activated fatty acids are then used by the integral membrane protein PlsY to acylate G3P (Lu et al., 2006; Lu et al., 2007). A second acyltransferase, PlsC (Coleman, 1992), is universally expressed in bacteria and completes the synthesis of PtdOH by transferring a fatty acid to the 2-position of acyl-G3P. The E. coli PlsC uses either acyl-ACP or acyl-CoA as acyl donors, but the Gram-positive PlsCs use only acyl-ACP as substrate (Lu et al., 2006; Yao and Rock, 2013).

Fig. 1.

Fig. 1

Open in a new tab

Fatty acid metabolism in S. aureus.

Phosphatidic acid (PtdOH) is synthesized by the stepwise acylation of sn-glycerol-3-phosphate by PlsY that transfers a fatty acid to the 1-position from acyl-phosphate (acyl-PO4) followed by PlsC that acylates the 2-position using acyl-ACP. Acyl-ACP is produced by the type II fatty acid biosynthetic pathway (FASII), and PlsX catalyzes the inter-conversion of acyl-ACP and acyl-PO4. Exogenous fatty acids enter the cell and may be activated by either a fatty acid kinase or acyl-ACP synthetase pathway. Our experiments show strain PDJ39 (ΔplsX) requires both exogenous fatty acids and de novo fatty acid synthesis for growth and has fatty acid kinase activity in cell extracts. These data rule out the presence of an acyl-ACP synthetase (Aas, red) and show the presence of a fatty acid kinase (Fak, green) pathway for the incorporation of exogenous fatty acids into phospholipids. The acyl-PO4 may either be used by PlsY or converted by PlsX to acyl-ACP that can either be elongated or utilized by PlsC. The gene(s) encoding Fak are unknown.

Exogenous fatty acids can access these acyltransferase systems after their uptake by the cell and activation. In E. coli, the pathway involves the conversion of the fatty acid to an acyl-CoA thioester by FadD, an acyl-CoA synthetase (Yao and Rock, 2013). E. coli acyltransferases use acyl-CoAs as substrates, but this organism cannot convert fatty acids or acyl-CoAs to acyl-ACP. Thus, there is no elongation of exogenous fatty acids by FASII or incorporation into lipopolysaccharide via the acyl-ACP-specific acyltransferases. However, some bacteria possess an acyl-ACP synthetase that ligates fatty acids to ACP. The expression of this enzyme allows exogenous fatty acids to not only be used by the acyltransferases, but also to enter the fatty acid biosynthetic pathway and be elongated (Jiang et al., 2006; Jiang et al., 2010). Our recent work with Staphylococcus aureus shows that exogenous fatty acids are both used by the acyltransferases and elongated by FASII showing that they are converted to acyl-ACP (Parsons et al., 2011). Experiments with crude extracts showed the formation of acyl-ACP from a labeled fatty acid, ATP and Mg2+, but the gene encoding the putative acyl-ACP synthetase was not identified.

The goal of this study is to determine if exogenous fatty acids are taken up in S. aureus via an acyl-ACP or acyl-PO4 dependent pathway (Fig. 1). The key to distinguishing these two possibilities is the phenotype of a plsX deletion mutant. If fatty acids are activated to acyl-ACPs, then a ΔplsX strain would be non-viable because they would be unable to synthesize acyl-PO4 from either exogenous fatty acids or FASII. However, if a fatty acid kinase pathway is operating, a ΔplsX strain would be able to produce acyl-PO4 from exogenous fatty acids for PlsY and obtain acyl-ACP for PlsC from de novo fatty acid synthesis. PlsX is considered an essential gene based on the growth phenotype of a Bacillus subtilis strain conditionally deficient in plsX expression (Paoletti et al., 2007). However, the media used in these experiments was not supplemented with fatty acids. We find Staphylococcus aureus ΔplsX strains are both fatty acid auxotrophs and require de novo fatty acids synthesis for growth. Exogenous fatty acids are not elongated in PlsX-null S. aureus, and cell extracts exhibit fatty acid kinase activity. Thus, the incorporation of host fatty acids into the phospholipids of Gram-positive pathogens involves a novel fatty acid kinase to activate exogenous fatty acids for incorporation into phospholipids (Fig. 1).

Results

As previously reported (Parsons et al., 2011), we found 100 μM oleate inhibited [14C]acetate incorporation into S. aureus strain RN4220 (Fig. 2A). Oleate was used in most of our experiments as the prototypical exogenous fatty acid because its incorporation and metabolism was easily separated from the FASII-produced saturated branched-chain fatty acids, and oleate is an abundant host fatty acid. The reduction in FASII activity was accompanied by incorporation of the exogenous oleate (18:1Δ9), and its elongation product 20:1Δ11, into phospholipids replacing the normal branched-chain saturated fatty acids. S. aureus lacks the capacity for β-oxidation and there were no [14C]acetate-labeled fatty acids detected in the medium in these experiments. The regulatory effect of exogenous fatty acid was not a unique property of oleate (Fig. 2A). Lauric acid, a mixture of anteiso 15:0/17:0, or 17:0 also reduced the amount of [14C]acetate labeling. Neither exogenous short-chain fatty acids (octanoic acid) nor very-long chain fatty acids (19:0 and 21:0) reduced the rate of acetate incorporation, suggesting the most highly incorporated fatty acids were acyl chains that were normally found in phospholipids. These data suggested that S. aureus was able to spare some energy expended in fatty acid synthesis when exogenous fatty acids are available.

Fig. 2.

Fig. 2

Open in a new tab

Long-chain acyl-CoA does not have a role in S. aureus fatty acid uptake.

A) Inhibition of [14C]acetate incorporation into fatty acid in the presence of exogenous fatty acids. Wild-type strain RN4220 was grown to an A600 = 0.5. Each fatty acid was added to LB medium containing 0.1% Brij-58 to a final concentration of 100 μM, and 30-min later [14C]acetate was added. At the end of a 30 min labeling period, the cells were harvested, extracted and the amount of radioactivity in the lipid fraction determined. The data were normalized to the radiolabel in the untreated, wild-type strain set to 100% (140,000 dpm per 7 × 108 cells). Fatty acids are abbreviated as number of carbon atoms:number of double bonds. The “a” designation refers to an anteiso branched-chain fatty acid.

B) Expression of acyl-CoA synthetase impairs S. aureus growth. The E. coli fadD gene was cloned into the regulated expression plasmid pG164 (empty vector control) to generate pFadD, and transformed into wild-type strain SA178R1. Strains were grown in the presence of 1 mM IPTG to induce fadD expression, and 18:1 was added at a concentration of 200 μM in early log phase as indicated by the arrow.

C) Mass spectrometry analysis of the CoA thioester pool in 18:1Δ9-treated cells. Strain SA178R1 harbored either pG164, the empty control expression plasmid, or pFadD, a pG164 derivative expressing E. coli acyl-CoA synthetase (FadD). Both strains were grown in the presence of 1 mM IPTG either in the presence or absence of 0.2 mM oleate. At an A600 of 1.0, the cells were harvested and processed for mass spectrometry as described (Parsons et al., 2011). Propionyl-CoA was added as an internal standard and the signals for CoA, acetyl-CoA and oleoyl-CoA were normalized to the propionyl-CoA signal.

In E. coli, acyl-CoA synthetase (FadD) plays a key role in the incorporation of exogenous fatty acids by generating the acyl-CoA substrates for the PlsB/PlsC acyltransferases (DiRusso et al., 1999). There was no apparent role for acyl-CoA in phospholipid synthesis in bacteria that employ the acyl-PO4/acyl-ACP-dependent PlsX/PlsY/PlsC acyltransferase system (Lu et al., 2006). We did not detect acyl-CoA synthetase activity in S. aureus extracts (not shown). There were two open reading frames in the S. aureus genome annotated as potential acyl-CoA synthetases, SA0226 and SA0533, which have 23% and 28% identity with FadD, respectively. These two genes were inactivated and the resulting strains did not have a deficiency in exogenous fatty acid incorporation into phospholipids as assessed by [14C]oleate labeling compared to the parent strain RN4220 (not shown). Oleoyl-CoA was not detected in S. aureus stain RN4220 grown in the presence of exogenous oleate using ESI-MS/MS (not shown).

To validate these negative results, we inserted the E. coli fadD gene into plasmid pG164, which together with strain SA178R1, constituted a tightly-regulated S. aureus expression system (D’Elia et al., 2006). Strain SA178R1 was derived from strain RN4220 and have the T7 polymerase and the LacIq repressor genes integrated into the chromosome under the control of the Pspac promoter/operator allowing IPTG-dependent expression from the pG164 plasmid. The addition of 200 μM oleic acid did not affect the growth of strain SA178R1/pG164 either in the presence or absence of inducer (Fig. 2B). When fadD expression was induced by IPTG in strain SA178R1/pJP106(fadD), the presence of oleic acid caused a significant decrease in growth rate, and there was a slight effect on growth in the absence of induction (Fig. 2B). These data suggested that the formation of oleoyl-CoA in the strain expressing FadD had a deleterious effect. We have not explored the basis for the growth inhibition by FadD expression, but it is known that acyl-CoAs are potent inhibitors of the acyl-PO4-dependent PlsY acyltransferase (Lu et al., 2006), and they may have inhibitory effects on other enzymes. Oleoyl-CoA was not detected in IPTG-treated strain SA178R1/pG164 exposed to oleic acid (Fig. 2C), consistent with our preliminary experiments with strain RN4220. In contrast, there was a significant accumulation of oleoyl-CoA detected in extracts from strain SA178R1/pJP106 expressing FadD. These data ruled out the presence of an unknown protein that converts exogenous fatty acids to acyl-CoA in S. aureus, and were consistent with the conclusion that long-chain acyl-CoA has no role in S. aureus fatty acid metabolism.

Strains lacking plsX were fatty acid auxotrophs

The first experiment suggesting that plsX knockout strains were fatty acid auxotrophs came from the analysis of the growth of B. subtilis strain LP39 in the presence and absence of fatty acids. This strain has a chromosomal plsX knockout covered by an integrated xylose-inducible plsX gene (Paoletti et al., 2007). When deprived of the xylose inducer, growth arrest occurred when PlsX levels were depleted below the threshold required for growth (Paoletti et al., 2007). We found that the supplementation of strain LP39 with a mixture of branched-chain fatty acids resulted in the continued growth of the PlsX-depleted strain (Fig. 3A). These data suggested that exogenous fatty acids were able to overcome a blockade at the PlsX step, which appeared to rule out an acyl-ACP synthetase mechanism for fatty acid incorporation into phospholipid. The B. subtilis genetic system was complex and did not allow for the study of strains that were completely devoid of PlsX. Therefore, we constructed S. aureus strain PDJ39 (ΔplsX) that inactivated the plsX gene by the insertion of a group II intron at amino acid 122 of the PlsX sequence into the parent strain SA178R1 (Fig. 3B, inset). Because we anticipated the ΔplsX strain to be a fatty acid auxotroph, the selection steps were performed in the presence of a fatty acid supplement consisting of a mixture of anteiso 15:0/17:0 fatty acids (Parsons et al., 2011). Stain PDJ39 (ΔplsX) was indeed a strict fatty acid auxotroph (Fig. 3B). Complementation of the fatty acid-dependent growth phenotype of ΔplsX strain with plasmid pPlsX expressing the plsX gene showed that that the deficiency in PlsX was both necessary and sufficient for the growth phenotype (Fig. 3C). AFN-1252 specifically inhibits the enoyl-ACP reductase (FabI) step in the elongation cycle of FASII (Kaplan et al., 2012). Although strain PDJ39 (ΔplsX) was a fatty acid auxotroph (Fig. 3B), the strain remained as sensitive to AFN-1252 as the wild-type parent strain SA178R1 (Fig. 3D). Strain PDJ38 (ΔaccD) cannot produce malonyl-CoA, does not carry out FASII, and ΔaccD strains were characterized as a fatty acid and lipoate auxotrophs (Parsons et al., 2011; Parsons et al., 2013). Because FASII was not operational in strain PDJ38, AFN-1252 had no effect on its growth. Thus, strain PDJ39 (ΔplsX) required both endogenous fatty acid synthesis from FASII and an exogenous fatty acid supplement for growth.

Fig. 3.

Fig. 3

Open in a new tab

Growth phenotypes of PlsX-null strains.

A) B. subtilis strain LP39 was constructed to allow conditional expression of PlsX from a xylose-dependent promoter (Paoletti et al., 2007). In the absence of xylose, growth arrest occurs, which was attenuated by the addition of exogenous fatty acids (FA; a 1 mM mixture of anteiso branched-chain 15:0/17:0 in 10 mg/ml fatty acid free bovine serum albumin plus lipoate (0.1 μg/ml)).

B) S. aureus strain PDJ39 (ΔplsX), a derivative of the wild-type strain SA178R1, was a fatty acid auxotroph. The strains were grown in LB medium plus 10 mg/ml fatty acid free bovine serum albumin either with or without a 1 mM oleate supplement. The inset shows a multiplex PCR genotyping result for the disrupted plsX gene in the ΔplsX strain compared to the wild-type gene in strain SA178R1. The wild-type allele gives a 509 bp band and the mutant plsX allele gives a 305 bp product.

C) The strain PDJ39 (ΔplsX) growth phenotype was complemented by the presence of pPlsX, a plasmid derived from pG164 that expresses the plsX gene. The control plasmid was the empty pG164, and both strains were grown without fatty acids.

D) Minimum inhibitory concentration for AFN-1252 in strains SA178R1 (wild-type), PDJ39 (ΔplsX), and PDJ38 (ΔaccD). AFN-1252 is a potent inhibitor of S. aureus enoyl-ACP reductase and effectively blocks de novo fatty acid synthesis (Kaplan et al., 2012). All strains were grown on LB medium with S. aureus branched-chain fatty acids (1 mM of a mixture of anteiso 15:0/17:0 in 10 mg/ml fatty acid free bovine serum albumin). Control strain PDJ38(ΔaccD) was a fatty acid auxotroph that cannot make any endogenous fatty acids, depends on exogenous fatty acids for acyl-PO4 and acyl-ACP formation, and was completely refractory to AFN-1252 growth inhibition (Parsons et al., 2011; Parsons et al., 2013).

Fatty acid composition and phospholipid structure in strain PDJ39 (ΔplsX)

Our previous study on exogenous fatty acid metabolism in S. aureus showed that exogenous 18:1Δ9 was elongated to 20:1Δ11 by FASII, and both 18:1 and 20:1 were incorporated into the 1-position of PtdGro (Parsons et al., 2011). These data showed that exogenous fatty acids were converted to acyl-ACP for elongation by FASII and to acyl-PO4 for utilization by PlsY. Phosphatidylglycerol (PtdGro) was the most abundant phospholipid in S. aureus, and the predominant PtdGro molecular species in wild-type cells consisted of 17:0 in the 1-position and 15:0 in the 2-position (Fig. 4A). The most striking aspect PtdGro structure in S. aureus was that 15:0 was almost exclusively found in the 2-position of PtdGro (Parsons et al., 2011), illustrating the high selectivity of PlsC for the 15-carbon acyl-ACP. In wild-type strain SA178R1, there were two major PtdGro molecular species detected in cells grown with 18:1Δ9 corresponding to 18:1/15:0 and 20:1/15:0 (Fig. 4B). However, in strain PDJ39 (ΔplsX) only a single prominent PtdGro molecular species was detected consisting of 18:1 paired with 15:0 (Fig. 4C). About 50% of the 18:1 was elongated by FASII before incorporation in PtdGro in the wild-type strain, but there was no elongation of 18:1Δ9 to 20:1Δ11 in PlsX-null cells. One aspect of these experiments was that 18:1 was normally channeled to the 1-position in wild-type cells due to the substrate specificity of PlsC (Parsons et al., 2011); however, incorporation of 15:0 into the 1-position can occur as evidenced from the existence of the 30-carbon PtdGro molecular species in strain SA178R1 (Fig. 4A). To corroborate the conclusion that exogenous fatty acids were funneled to the 1-position in ΔplsX strain, it was grown with an anteiso 15:0 supplement and the PtdGro composition determined by mass spectrometry. Only a single molecular species consisting 15:0/15:0 PtdGro was detected in strain PDJ39 (ΔplsX) confirming exogenous fatty acids were channeled into the 1-position of the phospholipids and were not elongated (Fig. 4D). These data rule out the existence of an acyl-ACP synthetase-dependent pathway for fatty acid metabolism and suggested the existence of a fatty acid kinase that converted fatty acids to acyl-PO4, which were subsequently either converted to acyl-ACP by PlsX for elongation by FASII or used for acylation of the 1-position of G3P by PlsY.

Fig. 4.

Fig. 4

Open in a new tab

Phosphatidylglycerol (PtdGro) molecular species synthesized from exogenous fatty acids in wild-type strain SA178R1 and its ΔplsX derivative, strain PDJ39 (ΔplsX).

A) PtdGro molecular species synthesized by wild-type S. aureus strain SA178R1 grown in LB plus 10 mg/ml fatty acid free bovine serum medium without a fatty acid supplement. The species are labeled with the 1-position acyl chain over the 2-position acyl chain. The most abundant PtdGro molecular species consisted of 17:0 in the 1-position and 15:0 in the 2-position. These identifications were based on a more detailed analysis of PtdGro structure (Parsons et al., 2011), which showed that 15-carbon fatty acids were almost exclusively localized to the 2-position of S. aureus PtdGro.

B) Wild-type strain SA178R1 both incorporated 18:1Δ9 into phospholipid and elongated it to 20:1Δ11. This resulted in two prominent molecular species containing an unsaturated fatty acid (either 18:1 or 20:1) derived from the medium and a 15-carbon branched-chain fatty acid from de novo biosynthesis.

C) Strain PDJ39 (ΔplsX) did not elongate 18:1Δ9 to 20:1Δ11 resulting in a single molecular species of PtdGro consisting of 18:1 and a 15-carbon branched-chain fatty acid.

D) PtdGro molecular species derived from strain PDJ39 (ΔplsX) grown in the presence of anteiso 15:0 (0.25 mM in 10 mg/ml bovine serum medium). Only a single PtdGro molecular species was detected consisting of two 15:0 fatty acids.

The channeling of exogenous fatty acids to the 1-position and endogenously synthesized fatty acids to the 2-position was corroborated with metabolic labeling experiments followed by the digestion of the labeled PtdGro with phospholipase A2 to determine the positional distrubtion of the label (Fig. 5). Strains SA178R1 and PDJ39 (ΔplsX) were labeled with [14C]acetate and the [14C]PtdGro isolated by thin-layer chromatography. As expected, the acetate label was distributed between the 1- and 2-positions in the wild-type strain SA178R1 (Fig. 5A). However, [14C]acetate was only incorporated into the 2-position of the PtdGro isolated from the ΔplsX strain (Fig. 5B). These data show that FASII only provided acyl chains for the 2-position acyltransferase (PlsC) in the PlsX-null strain. Taken together, the data in this section showed that ΔplsX cells required exogenous fatty acids to acylate the 1-position of G3P and FASII to acylate the 2-position.

Fig. 5.

Fig. 5

Open in a new tab

Positional distribution of labeled precursors incorporated into PtdGro.

Strain PDJ39 (ΔplsX) was grown in the presence of 0.5 mM oleate, 10 mg/ml BSA. At an A600 = 0.05, 5 μCi/ml of [14C]acetate was added and the cells grown for 7 hours. Strain SA178R1 was grown and labeled in the same manner using media without a fatty acid supplement. The lipids were extracted, [14C]PtdGro was isolated by thin-layer chromatography, and digested with phospholipase A2. The samples were then separated by thin-layer chromatography, and the distributions of label between the 1- and 2-positions was indicated by the ratio of labeled lysoPtdGro (1-position) to FA (2-position) using the Bioscan Imaging Detector.

A) Positional distribution of [14C]acetate-labeled PtdGro derived from wild-type strain SA178R1. The incomplete digestion shows the location of the substrate (PtdGro) and the two products, 1-acyl-glycerophosphoglycerol (LysoPtdGro) and fatty acid (FA).

B) Positional distribution of [14C]acetate-labeled PtdGro derived from strain PDJ39 (ΔplsX).

Analysis of FASII activity in PlsX-null strains

We next examined FASII activity in strain PDJ39 (ΔplsX) following the removal of the exogenous fatty acid supplement. The removal of the required fatty acid supplement from the ΔplsX strain in early logarithmic growth led to the cessation of growth (Fig. 6A). Initially, there was little difference between the growth of the supplemented and non-supplemented strains, but within an hour there was no increase in the optical density of the culture without fatty acid. Exogenous fatty acids were required for de novo fatty acid synthesis in strain PDJ39 (ΔplsX). The ΔplsX strain was grown to early log phase in the presence of fatty acids, the cells harvested, the fatty acid supplement removed and the cells resuspended in medium either with or without fatty acid as illustrated in Fig. 6A. The cultures were then labeled with [14C]acetate and the incorporation of label into lipids monitored for 20 min (Fig. 6B). The incorporation of acetate into lipids was reduced >98% in the absence of exogenous fatty acids showing that endogenous FASII was tightly coupled to the acquisition of extracellular fatty acids in the PlsX-null strain. Samples from the ΔplsX strain grown in the presence of fatty acid and 30-min after the removal of fatty acids from the medium were isolated and the ACP pool composition was determined by conformationally-sensitive gel electrophoresis followed by visualization of the ACP species by immunoblotting with anti-ACP antibodies (Fig. 6C). Normally, the ACP pool in S. aureus consisted primarily of non-esterified ACP (Parsons et al., 2011), and only non-esterified ACP was detected in the ΔplsX samples grown with fatty acids. Following the removal of the fatty acid supplement, long-chain acyl-ACP accumulated in the ΔplsX strain (Fig. 6C). These data were consistent with the model that acyl-ACP utilization depended on the formation of acyl-G3P by the PlsY reaction. However, not all of the ACP was converted to acyl-ACP showing that FASII ceased before all of the ACP was depleted. This was in contrast to the conversion of all the ACP to short-chain acyl-ACP intermediates in S. aureus treated with the FabI inhibitor AFN-1252 (Parsons et al., 2011). The accumulation of long-chain acyl-ACP correlated with the cessation of FASII, suggesting that acyl-ACP may play a regulatory role in S. aureus similar to the acyl-ACP regulation of FabH and acetyl-CoA carboxylase in E. coli (Heath and Rock, 1996; Davis and Cronan, Jr., 2001).

Fig. 6.

Fig. 6

Open in a new tab

Coupling of fatty acid and phospholipid synthesis in strain PDJ39 (ΔplsX).

A) Growth of strain PDJ39 (ΔplsX) halts abruptly following removal of the required fatty acid supplement. The strain was grown to an A600 of 0.5 in LB medium containing 1 mM oleate plus 10 mg/ml bovine serum albumin. The culture was then split and the oleate supplement removed by centrifugation and the cells re-suspended in media either with or without the fatty acid supplement and growth monitored.

B) Fatty acid synthesis requires exogenous fatty acids in strain PDJ39 (ΔplsX). The ΔplsX strain was grown to an A600 of 0.5, and the oleate supplement removed. The cells were resuspended in media either with or without the oleate supplement and 30 min later, 5 μCi/ml of [14C]acetate was added to both cultures. At the indicated times, the cells were harvested and the amount of label incorporated into the lipid fraction was determined.

C) A representative example of the ACP pool composition under different growth conditions determined by conformationally-sensitive gel electrophoresis and immunoblotting with anti-ACP antibody. Lane 1, strain PDJ39 (ΔplsX) following the removal of the exogenous 18:1Δ9 supplement for 30 min; Lane 2, strain PDJ39 grown with the oleate supplement; and Lane 3, anteiso 17:0-ACP standard.

Metabolism of fatty acids in cell extracts

Previously, we reported that extracts from S. aureus formed acyl-ACP that was identified by gel electrophoresis from fatty acids, ATP and Mg2+ (Parsons et al., 2011). These data indicated an acyl-ACP synthetase may be present; however, the analysis of PlsX-null cell extracts revealed that acyl-ACP formation required the presence of PlsX (Fig. 7A). The location of acyl-ACP and acyl-PO4 in the thin-layer chromatography analysis was determined by preparing [14C]oleoyl-ACP and partially converting it to [14C]acyl-PO4 using purified PlsX. Extracts from strain PDJ39 (ΔplsX) did not produce [14C]acyl-ACP from [14C]oleate, ACP, ATP and Mg2+, but rather the fatty acid was converted to a product that co-migrated with the acyl-PO4 standard. The addition of purified PlsX to the (ΔplsX) extract resulted in the formation of [14C]acyl-ACP, and [14C]acyl-PO4 was not detected. Thus, acyl-ACP was not formed by the direct acylation of ACP by a synthetase as described in other systems (Jiang et al., 2006; Jiang et al., 2010), but rather through the initial formation of acyl-PO4 followed by its transacylation to ACP via PlsX. These results showed the presence of a fatty acid kinase activity in the S. aureus cell extracts. Also, the experiments showed that acyl-PO4 was rapidly converted to acyl-ACP by PlsX accounting for primarily detecting acyl-ACP in similar reactions performed previously with wild-type cell extracts (Parsons et al., 2011). A filter disc assay was developed to measure fatty acid kinase activity, which was linear with the protein concentration in the PlsX-null extract (Fig. 7B). Fatty acid kinase activity required ATP plus Mg2+. In addition the reaction was significantly stimulated by presenting the fatty acid substrate in Triton X-100 micelles (Fig. 7C), as are many other lipid-utilizing enzymes (Carman et al., 1995). There is a single acetate kinase (ackA) homolog in S. aureus. S. aureus strain KB8000 (ΔackA) (Sadykov et al., 2013) was not defective in [14C]oleate uptake (not shown), ruling out a dual function for acetate kinase. These data detected the presence of a fatty acid kinase activity in S. aureus that was responsible for the formation of acyl-PO4 from exogenous fatty acids in PlsX-null cells.

Fig. 7.

Fig. 7

Open in a new tab

Acyl-PO4 and acyl-ACP synthesis in cell-free extracts.

A) Thin-layer chromatographic analysis of the reaction products formed from the incubation of cell lysates prepared from strain PDJ39 (ΔplsX) containing ATP, Mg2+, ACP, Triton X-100 and [14C]oleate as detailed in the methods. The reaction mixtures were separated on Silica Gel G layers developed with chloroform:methanol:acetic acid (90/10/10) and the distribution of radioactivity determined with a Bioscan Imaging detector. The top trace shows the conversion of [14C]oleoyl-ACP to [14C]acyl-PO4 by purified PlsX. The middle trace is the reaction products formed by cell-free extracts of strain PDJ39 (ΔplsX) spiked with purified PlsX along with ATP, Mg2+ and [14C]oleate. The bottom trace is the same ΔplsX extract in the absence of added PlsX.

B) A filter disc assay for fatty acid kinase was performed using the cell extracts from strain PDJ39 (ΔplsX) containing ATP, Mg2+, Triton X-100 and [14C]oleate as detailed in the methods.

C) Maximal fatty acid kinase activity required ATP, Mg2+ and Triton X-100. The enzyme source was the cytosol from the ΔplsX strain (300 μg protein).

Discussion

This work reveals the existence of a fatty acid kinase pathway for the incorporation of exogenous fatty acids into the phospholipids of S. aureus (Fig. 1). The key intermediate in phospholipid synthesis, PtdOH, is formed by the acylation of the 1-position by PlsY followed by the acyl-ACP-dependent acylation of the 2-position by PlsC. Exogenous fatty acids access the acyltransferase system by first translocating across the bacterial cell membrane. Protonated fatty acids are known to rapidly and spontaneously flip across a phospholipid bilayer (Garlid et al., 1996). This property provides a plausible mechanism for fatty acid entry into cells because there is no evidence for a protein-mediated cytoplasmic membrane transporter in any bacteria. Once the fatty acids are accessible to the cytosol, they are converted to acyl-PO4 by an ATP/Mg2+-dependent fatty acid kinase (Fak). The acyl-PO4 may then be used for the acylation of the 1-position of G3P by PlsY, or converted to acyl-ACP by PlsX. The acyl-ACP may either be elongated by FASII or utilized to acylate the 2-position via PlsC. S. aureus PlsC has a high selectivity for 15-carbon branched-chain fatty acids which means that exogenous fatty acids with chain lengths greater than 15 carbons are almost exclusively found in the 1-position of PtdGro. The genetic inactivation of PlsX prevents the inter-conversion of acyl-PO4 and acyl-ACP. Thus, PlsX-null strains are not able to elongate extracellular fatty acids and require both a fatty acid supplement to supply acyl-PO4 via fatty acid kinase (Fak) to PlsY and de novo FASII to supply the acyl-ACP to PlsC. The next important step in this area of research will be the identification of the gene(s) encoding the fatty acid kinase catalytic activity.

The fatty acid kinase pathway represents a new paradigm for the assimilation of extracellular fatty acids in bacteria, and stands in contrast to the pathway for exogenous fatty acid metabolism in Gram-negative bacteria. E. coli has been the classical model for extracellular fatty acid metabolism, and other Gram-negative bacteria possess a similar set of genes required for the activation of fatty acids derived from the environment to acyl-CoAs by acyl-CoA synthetase (FadD). Also, E. coli uses exogenous fatty acids as a carbon source via β-oxidation (Black and DiRusso, 1994). Many Gram-negative bacteria use fatty acids as a carbon source, and the ligation of exogenous fatty acids to CoA, rather than ACP, prevents β-oxidation intermediates from becoming intermingled with FASII intermediates. Our experiments rule out a role for acyl-CoA in S. aureus fatty acid metabolism (Fig. 2). This finding is consistent with the important differences in the acyl donor specificities between the E. coli PlsB/PlsC acyltransferase system and the PlsX/PlsY/PlsC pathway. E. coli PlsB and PlsC utilize either acyl-ACP or acyl-CoA, whereas S. aureus PlsY uses only acyl-PO4 and PlsC uses only acyl-ACP. Some bacteria possess an acyl-ACP synthetase that belongs to the same AMP-binding protein superfamily as acyl-CoA synthetase (Jiang et al., 2006); however, our experiments with PlsX-null strains rule out acyl-ACP synthetase involvement in phospholipid synthesis from extracellular fatty acids in S. aureus. How wide-spread the fatty acid kinase pathway for exogenous fatty acid metabolism is remains to be determined, but it seems likely that it would be present in those Gram-positive pathogens that utilize the PlsX/PlsY/PlsC pathway for phospholipid synthesis, and are able to scavenge fatty acids from the environment.

Experimental procedures

Strains, plasmids and materials

S. aureus strain RN4220 was obtained from Richard Novick (Kreiswirth et al., 1983). S. aureus strain SA178R1 and shuttle vector pG164 were obtained from Merck (D’Elia et al., 2006). B. subtilis strain LP39 that expresses plsX only in the presence of xylose was described previously (Paoletti et al., 2007). Strain PDJ39 (ΔplsX) was constructed from strain SA178R1 by the insertion of a group II intron 366 bp into the plsX gene using the primer design software and plasmid system provided in the Targetron Gene Knockout Kit (Sigma-Aldrich) (Zhong et al., 2003). Genotyping was performed using a multiplex PCR reaction containing a primer specific for the intron (5′-CGAAATTAGAAACTTGCGTTCAGTAAAC and two plsX gene-specific primers 280F, 5′-CAGCAGGTAATACTGGTGCTTTAATGTCAG and 789R, 5′-ATCTTTCTTCAATATTGCACCTGC. The wild-type plsX gene gave a 509 bp product and the knockout allele gave a 305 bp product. Strains PDJ23 (ΔSA0226) and PDJ25 (ΔSA0533) were constructed by insertion of a group II intron at bp 306 and bp 93 of the SA0226 and SA0533 genes respectively in strain RN4220, and verified by PCR using primers outside the intron insertion site. Strain PDJ38 (ΔaccD) was generated using methods and plasmid used to generate the same knockout in RN4220 (Parsons et al., 2011). The E. coli fadD gene was cloned into the BamHI/EcoRI sites of pG164 with a C-terminal FLAG tag using primers 5′-GGATCCATGAAGAAGGTTTGGCTTAACCGTTATCCCGCGGAC and 5′-TTATTTATCATCATCATCTTTATAATCTATGGCTTTATTGTCCACTTTGCCGCGCGCTTC. S. aureus plsX gene was amplified using primers 5′-ATCGCATATGAAAAAAATCGCAGTAGATGCCATGG and 5′-CGATAAGCTTTTAGTGGTGGTGGTGGTGGTGTTCTCCTGAAAATTCACGCGCAGTC and ligated into the NdeI and HindIII sites of pET28a to generate pJY010. In order to ligate plsX into pG164, plsX gene was amplified using primers 5′-AAATGTCATATGATAAGCGAGGATAAAATTATGG and 5′-TTGCTGGGATCCTCATTTGATTCACCTACAGTCTCTTTC and ligated into TOPO PCR2.1 cloning vector. An internal NdeI site was identified and removed by site-directed mutagenesis using primers 5′-GCTAAAGGTAATAGTTTAACGAAAAAATCTTATGAGTTATTAAATCATGATCATTCATT and 5′-AATGAATGATCATGATTTAATAACTCATAAGATTTTTTCGTTAAACTATTACCTTTAGC. The plsX gene was subsequently ligated into the NdeI and BamHI sites of pPJ131 and restricted with NheI and BlpI to allow ligation into pG164. Growth media used was either Luria Broth (LB), LB supplemented with 10 mg/ml bovine serum albumin or LB supplemented with 0.1% Brij 58 plus 500 μM exogenous fatty acid. [1-14C]Acetic acid (55 mCi/mmol) and [1-14C]oleic acid (55 mCi/mmol) were purchased from American Radiolabelled Chemicals and Perkin-Elmer, respectively. Affinity-purified anti-rabbit ACP antibody was described previously (Jackowski and Rock, 1983). Fatty acid free bovine serum albumin and Brij-58 were from Sigma-Aldrich. Fatty acids were from Larodan Fine Chemicals or Sigma-Aldrich.

[1-14C]Acetate incorporation in fatty acid-treated cells

S. aureus strain RN4220 was cultured in LB medium containing 0.1% Brij-58 until A600 = 0.5 when the culture was divided into 10 ml aliquots. Indicated amounts of fatty acid in a volume of 10 μl DMSO were added to the cultures and then were incubated at 37°C with vigorous shaking. After 30 minutes, 50 μCi of [1-14C]acetate was added to each culture which were returned to the 37°C incubator for 30 minutes. [1-14C]Acetate incorporation in DMSO-treated cells represented 100% incorporation. The cells were harvested by centrifugation, washed two times with PBS. The cell pellet was suspended in 100 μl water and lipids extracted with 360 μl chloroform:methanol:hydrochloric acid (1:2:0.02). Phases were separated after addition of 120 μl chloroform and 120 μl 2 M potassium chloride. Radiolabelled lipids were quantified by scintillation counting.

Minimal inhibitory concentration

The minimal inhibitory concentrations (MICs) for AFN-1252 against strains SA178R1, PDJ38 and PDJ39 were determined using a broth microdilution method in LB medium supplemented with 10 mg/ml bovine serum albumin and 1 mM mixture of 15:0/17:0 anteiso branched-chain fatty acids. S. aureus cultures were grown to A600 = 1.0 and diluted 30,000-fold in medium. A 10 μl aliquot of diluted cells was added to each well of a U-bottomed, 96-well plate containing 100 μl of medium with indicated AFN-1252 concentration. A fatty acid concentration of 1 mM was used because this concentration supported normal growth of S. aureus fatty acid auxotrophs (ΔaccD) (Parsons et al., 2013). The plate was incubated at 37°C for 20 h and read using a Fusion plate reader at 600 nm.

Lipodomics

PtdGro molecular species were obtained from lipid extracts from 50 ml cultures of strains SA178R1 and PDJ39 (ΔplsX) grown in LB plus 10 mg/ml bovine serum albumin with or without 1 mM 18:1 or 0.2 mM anteiso 15:0 supplements. Lipid extraction and mass spectrometry was performed as described previously (Parsons et al., 2011). Fatty acid methyl esters prepared and quantified using a Hewlett-Packard 5890 gas chromatograph as described previously (Zhang et al., 2002).

The positional distribution of labeled precursors was determined by labeling strains in 10 ml cultures grown in LB medium plus 10 mg/ml bovine serum albumin containing either 5 μCi/ml [1-14C] acetate or 0.5 μCi/ml [1-14C]oleic acid and grown to A600 = 2.0. Cells were pelleted, washed 2 × 10 ml LB containing 10 mg/ml bovine serum albumin and 2 × 10 ml H2O. The cell pellet was suspended in 100 μl water and lipids extracted with 360 μl chloroform:methanol:hydrochloric acid (1:2:0.02). Phases were separated after addition of 120 μl chloroform and 120 μl 2 M potassium chloride. [14C]PtdGro was isolated by preparative thin-layer chromatography on Silica Gel H layers with chloroform:methanol:acetic acid (55/20/5, v/v/v). The [14C]PtdGro was digested with Naja naja snake venom phospholipase A2 (Parsons et al., 2011). After 3 hours, the lipids were extracted and applied to a Silica Gel H layer developed in chloroform:methanol:acetic acid (55/20/5, v/v/v) and the plate imaged with a Bioscan Imaging detector to determine the extent of digestion and the distribution of label between the 1- and 2-positions.

ACP immunoblotting

A 40 ml culture of S. aureus was grown to an A600 = 0.7, the cells were harvested by centrifugation and washed twice with LB medium containing 10 mg/ml bovine serum albumin. The cell pellet was split between medium either with or without oleate and grown for an additional 30 min. Cells from 20 ml cultures were centrifuged at 4000 × g, for 10 minutes and pellets resuspended in 110 μl phosphate-buffered saline containing 1 mg/ml lysostaphin, 0.1 mg/ml DNase I and protease inhibitor cocktail before incubation on ice for three hours. The extracts were centrifuged at 20,000 × g for 15 minutes and the supernatant removed and protein quantified using Bradford assay (Bradford, 1976). Cell lysates (30 μg) and 100 ng of 17:0-ACP were loaded onto a 2.5 M urea, 15% acrylamide conformationally sensitive gel. The separated proteins were transferred to a polyvinylidene difluoride membrane by electroblotting. The primary anti-ACP antibiody was used at 1:500 dilution and secondary anti-rabbit IgG conjugated with alkaline phosphatase at a 1:5,000 dilution. The blot was developed using the ECF substrate and the fluorescent signal recorded using a Typhoon PhosphoImager 9500.

PlsX purification

Plasmid pJY010 expressing His-tagged PlsX was transformed into BL21(DE3) Tuner cells and used to inoculate a 1 L culture of LB which was grown at 37 °C with vigorous shaking. The culture was grown until A600 = 0.7 when protein expression was induced by the addition of 1 mM IPTG. After 3 hours, the cells were harvested by centrifugation and resuspended in binding buffer (20 mM Tris-HCl, pH 8.0, 0.5 M NaCl). The cells were lysed using a microfluidizer and debris removed by centrifugation at 36,000 × g for 15 minutes. The supernatant was applied to a Ni-NTA column and washed with increasing concentrations of imidazole. Purified PlsX was eluted in 400 mM imidazole and was subsequently dialyzed overnight against 20 mM Tris-HCl (pH 7.5), 5 mM EDTA, 100 mM NaCl and 1 mM DTT (Lu et al., 2006).

Fatty acid kinase biochemical assay

Extracts for measuring fatty acid kinase activity were generated from 10 ml cultures of strain PDJ39 (ΔplsX) grown in LB/BSA with 1 mM oleic acid until A600 = 1.0. Cells were centrifuged and resuspended in 110 μl phosphate-buffer saline containing 1 mg/ml lysostaphin, 0.1 mg/ml DNase I and protease inhibitor cocktail before incubation on ice for three hours. The extracts were centrifuged at 20,000 × g for 15 minutes and the supernatant removed. The radiochemical assay contained 0.1 M Tris-HCl, pH 7.5, 20 mM MgCl2, 10 mM ATP, 1% Triton X-100, 0.1 μCi [1-14C] oleic acid and indicated amount of cell extract in a volume of 60 μl. Assays were incubated at 37°C for 20 minutes before analysis. For the filter disc assay, 50 μl of reaction mixture was spotted onto a DE81 filter disc and subsequently washed 3-times for 30 minutes with 1% acetic acid in ethanol. The discs were dried and analyzed by scintillation counting. Thin-layer chromatography was performed using 20 μl of reaction mixture spotted onto a Silica Gel G layer, developed in chloroform:methanol:acetic acid (90/10/10) and analyzed with a Bioscan Imaging detector. The counting efficiency of the Bioscan with our Silica Gel G plates was 2%. [1-14C]18:1-ACP was generated using [1-14C]oleic acid, S. aureus ACP and the Vibrio harveyi acyl-ACP synthetase enzyme (Fice et al., 1993). [1-14C]oleoyl-phosphate standard was generated using [1-14C]18:1-ACP and PlsX as described previously (Lu et al., 2006).

Acknowledgments

We thank Nachum Kaplan for his gift of AFN-1252 and Kenneth Bayles for strain KB8000. This research was supported by National Institutes of Health Grant GM034496 (C.O.R.), Cancer Center Support Grant CA21765 and the American Lebanese Syrian Associated Charities. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institute of General Medical Sciences or the National Institutes of Health.

References

  1. Black PN, DiRusso CC. Molecular and biochemical analyses of fatty acid transport, metabolism, and gene regulation in Escherichia coli. Biochim Biophys Acta. 1994;1210:123–145. doi: 10.1016/0005-2760(94)90113-9. [DOI] [PubMed] [Google Scholar]
  2. Bradford MM. A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–254. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
  3. Carman GM, Deems RA, Dennis EA. Lipid signaling enzymes and surface dilution kinetics. J Biol Chem. 1995;270:18711–18714. doi: 10.1074/jbc.270.32.18711. [DOI] [PubMed] [Google Scholar]
  4. Coleman J. Characterization of the Escherichia coli gene for 1-acyl-sn-glycerol-3-phosphate acyltransferase (plsC) Mol Gen Genet. 1992;232:295–303. doi: 10.1007/BF00280009. [DOI] [PubMed] [Google Scholar]
  5. Cronan JE, Jr, Rock CO. Biosynthesis of membrane lipids. In: Neidhardt FC, Curtis R, Gross CA, Ingraham JL, Lin ECC, Low KB, et al., editors. Escherichia coli and Salmonella typhimurium: cellular and molecular biology. Washington, D.C.: American Society for Microbiology; 1996. pp. 612–636. [Google Scholar]
  6. D’Elia MA, Pereira MP, Chung YS, Zhao W, Chau A, Kenney TJ, et al. Lesions in teichoic acid biosynthesis in Staphylococcus aureus lead to a lethal gain of function in the otherwise dispensable pathway. J Bacteriol. 2006;188:4183–4189. doi: 10.1128/JB.00197-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Davis MS, Cronan JE., Jr Inhibition of Escherichia coli acetyl coenzyme A carboxylase by acyl-acyl carrier protein. J Bacteriol. 2001;183:1499–1503. doi: 10.1128/JB.183.4.1499-1503.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. DiRusso CC, Black PN, Weimar JD. Molecular inroads into the regulation and metabolism of fatty acids, lessons from bacteria. Prog Lipid Res. 1999;38:129–197. doi: 10.1016/s0163-7827(98)00022-8. [DOI] [PubMed] [Google Scholar]
  9. Fice D, Shen Z, Byers DM. Purification and characterization of fatty acyl-acyl carrier protein synthetase from Vibrio harveyi. J Bacteriol. 1993;175:1865–1870. doi: 10.1128/jb.175.7.1865-1870.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Garlid KD, Orosz DE, Modriansky M, Vassanelli S, Jezek P. On the mechanism of fatty acid-induced proton transport by mitochondrial uncoupling protein. J Biol Chem. 1996;271:2615–2620. doi: 10.1074/jbc.271.5.2615. [DOI] [PubMed] [Google Scholar]
  11. Green PR, Merrill AH, Jr, Bell RM. Membrane phospholipid synthesis in Escherichia coli: Purification, reconstitution, and characterization of sn-glycerol-3-phosphate acyltransferase. J Biol Chem. 1981;256:11151–11159. [PubMed] [Google Scholar]
  12. Heath RJ, Jackowski S, Rock CO. Guanosine tetraphosphate inhibition of fatty acid and phospholipid synthesis in Escherichia coli is relieved by overexpression of glycerol-3-phosphate acyltransferase (plsB) J Biol Chem. 1994;269:26584–26590. [PubMed] [Google Scholar]
  13. Heath RJ, Rock CO. Inhibition of β-ketoacyl-acyl carrier protein synthase III (FabH) by acyl-acyl carrier protein in Escherichia coli. J Biol Chem. 1996;271:10996–11000. doi: 10.1074/jbc.271.18.10996. [DOI] [PubMed] [Google Scholar]
  14. Jackowski S, Rock CO. Ratio of active to inactive forms of acyl carrier protein in Escherichia coli. J Biol Chem. 1983;258:15186–15191. [PubMed] [Google Scholar]
  15. Jiang Y, Chan CH, Cronan JE. The soluble acyl-acyl carrier protein synthetase of Vibrio harveyi B392 is a member of the medium chain acyl-CoA synthetase family. Biochemistry. 2006;45:10008–10019. doi: 10.1021/bi060842w. [DOI] [PubMed] [Google Scholar]
  16. Jiang Y, Morgan-Kiss RM, Campbell JW, Chan CH, Cronan JE. Expression of Vibrio harveyi acyl-ACP synthetase allows efficient entry of exogenous fatty acids into the Escherichia coli fatty acid and lipid A synthetic pathways. Biochemistry. 2010;49:718–726. doi: 10.1021/bi901890a. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kaplan N, Albert M, Awrey D, Bardouniotis E, Berman J, Clarke T, et al. Mode of action, in vitro activity, and in vivo efficacy of AFN-1252, a selective antistaphylococcal FabI inhibitor. Antimicrob Agents Chemother. 2012;56:5865–5874. doi: 10.1128/AAC.01411-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kreiswirth BN, Lofdahl S, Betley MJ, O’Reilly M, Schlievert PM, Bergdoll MS, Novick RP. The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature (London) 1983;305:709–712. doi: 10.1038/305709a0. [DOI] [PubMed] [Google Scholar]
  19. Lightner VA, Larson TJ, Tailleur P, Kantor GD, Raetz CRH, Bell RM, Modrich P. Membrane phospholipid synthesis in Escherichia coli: Cloning of a structural gene (plsB) of the sn-glycerol-3-phosphate acyltransferase. J Biol Chem. 1980;255:9413–9420. [PubMed] [Google Scholar]
  20. Lu Y-J, Zhang F, Grimes KD, Lee RE, Rock CO. Topology and active site of PlsY: the bacterial acylphosphate:glycerol-3-phosphate acyltransferase. J Biol Chem. 2007;282:11339–11346. doi: 10.1074/jbc.M700374200. [DOI] [PubMed] [Google Scholar]
  21. Lu Y-J, Zhang Y-M, Grimes KD, Qi J, Lee RE, Rock CO. Acyl-phosphates initiate membrane phospholipid synthesis in gram-positive pathogens. Molec Cell. 2006;23:765–772. doi: 10.1016/j.molcel.2006.06.030. [DOI] [PubMed] [Google Scholar]
  22. Paoletti L, Lu Y-J, Schujman GE, de Mendoza D, Rock CO. Coupling of fatty acid and phospholipid synthesis in Bacillus subtilis. J Bacteriol. 2007;189:5816–5824. doi: 10.1128/JB.00602-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Parsons JB, Frank MW, Rosch JW, Rock CO. Staphylococcus aureus fatty acid auxotrophs do not proliferate in mice. Antimicrob Agents Chemother. 2013;57:5729–5732. doi: 10.1128/AAC.01038-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Parsons JB, Frank MW, Subramanian C, Saenkham P, Rock CO. Metabolic basis for the differential susceptibility of Gram-positive pathogens to fatty acid synthesis inhibitors. Proc Natl Acad Sci U S A. 2011;108:15378–15383. doi: 10.1073/pnas.1109208108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Rock CO, Goelz SE, Cronan JE., Jr Phospholipid synthesis in Escherichia coli. Characteristics of fatty acid transfer from acyl-acyl carrier protein to sn-glycerol-3-phosphate. J Biol Chem. 1981a;256:736–742. [PubMed] [Google Scholar]
  26. Rock CO, Goelz SE, Cronan JE., Jr Phospholipid synthesis in Escherichia coli. Characteristics of fatty acid transfer from acyl-acyl carrier protein to sn-glycerol-3-phosphate. J Biol Chem. 1981b;256:736–742. [PubMed] [Google Scholar]
  27. Sadykov MR, Thomas VC, Marshall DD, Wenstrom CJ, Moormeier DE, Widhelm TJ, et al. Inactivation of the Pta-AckA pathway causes cell death in Staphylococcus aureus. J Bacteriol. 2013;195:3035–3044. doi: 10.1128/JB.00042-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Yao J, Rock CO. Phosphatidic acid synthesis in bacteria. Biochim Biophys Acta. 2013;1831:495–502. doi: 10.1016/j.bbalip.2012.08.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Zhang Y-M, Marrakchi H, Rock CO. The FabR (YijC) transcription factor regulates unsaturated fatty acid biosynthesis in Escherichia coli. J Biol Chem. 2002;277:15558–15565. doi: 10.1074/jbc.M201399200. [DOI] [PubMed] [Google Scholar]
  30. Zhong J, Karberg M, Lambowitz AM. Targeted and random bacterial gene disruption using a group II intron (targetron) vector containing a retrotransposition-activated selectable marker. Nucleic Acids Res. 2003;31:1656–1664. doi: 10.1093/nar/gkg248. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES