Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Apr 25.
Published in final edited form as: Gene. 2014 Feb 21;540(1):62–67. doi: 10.1016/j.gene.2014.02.026

A far-upstream AP-1/Smad binding box regulates human NOX4 promoter activation by transforming growth factor-β

Guangxing Bai 1, Thomas D Hock 1, Naomi Logsdon 1, Yong Zhou 1, Victor J Thannickal 1
PMCID: PMC4009368  NIHMSID: NIHMS572191  PMID: 24560583

Abstract

NADPH oxidase 4 (NOX4) is a member of the NADPH oxidase gene family that regulates cellular differentiation, innate immunity and tissue fibrosis. Transforming growth factor-β (TGF-β1) is known to induce expression of NOX4 mRNA in mesenchymal cells. However, the mechanisms of transcriptional regulation of NOX4 are not well understood. In this study, we examined the transcriptional regulation of NOX4 in human lung fibroblasts by TGF-β1. Five promoter-reporter constructs containing DNA fragments of 0.74 kb, 1.35 kb, 1.84 kb, 3.97 kb and 4.76 kb upstream from the transcriptional start site (TSS) of the human NOX4 gene were generated and their relative responsiveness to TGF-β1 analyzed. TGF-β1-induced NOX4 gene promoter activation requires a region between −3.97 kb and −4.76 kb. Bioinformatics analysis revealed a 15 bp AP-1/Smad binding element in this region. Mutation or deletion of either the AP-1 or the Smad element attenuated TGF-β1 responsiveness of the −4.76 kb NOX4 promoter. Furthermore, insertion of this AP-1/Smad box conferred TGF-β1 inducibility to the non-responsive −3.97 kb NOX4 promoter construct. Chromatin immunoprecipitation analysis indicated phospho-Smad3 and cJun associate with this element in a TGF-β1-inducible manner. These results demonstrate that the AP-1/Smad box located between 3.97 kb and 4.76 kb upstream of the TSS site of the NOX4 promoter is essential for NOX4 gene transcription induced by TGF-β1 in human lung fibroblasts. Our study provides insights into the molecular mechanisms of NOX4 gene expression, informing novel therapeutic approaches to interfere with upregulation of NOX4 in diseases characterized by activation of the TGF-β1/NOX4 pathway.

Keywords: NADPH Oxidase-4, TGF-β1, pulmonary fibrosis

Introduction

The NADPH oxidase (NOX) gene family constitutes seven members that include NOX1-5 and the dual oxidases, DUOX1 and 2 (1). The primary function of NOX enzymes is to generate reactive oxygen species (ROS) which mediate host defense functions and/or signaling events that regulate a number of physiological responses in diverse cell types (2–4). Unlike other NOX family enzymes, NOX4 does not require the assembly of an active enzymatic complex by recruitment of cytoplasmic regulator proteins that are critical for the activation of other NOX family members, NOX1-3, or calcium-dependent activation (NOX5, DUOX1, 2). Thus, NOX4 is a unique member of this enzyme family in that it is regulated primarily at the level of gene expression (5,6), and has thus been termed a “constitutive” enzyme (7). Despite this distinctive property, mechanisms that regulate NOX4 gene expression are not well understood.

Since its cloning and initial characterization in the kidney (8,9), NOX4 has been shown to be ubiquitously expressed in a variety of cell types and tissues (10). In endothelial cells, NOX4 gene expression is upregulated by hypoxia (11) and hyperoxia (12), and is downregulated by cyclic strain (13) or shear stress (14,15). In smooth muscle cells, NOX4 has been reported to be induced by hypoxia (16–18) and interferon-γ (19). In fibroblasts and epithelial cells, the best characterized inducer of NOX4 is transforming growth factor-β1 (TGF-β1) (20–24). Depending on cell type, transcription factors that have been implicated in NOX4 gene regulation include Nrf2 (12), Nrf3 (25), Sp1/3 (26), NF-κB (18,27), HIF-1α (17,28), STAT1/3 (19), and E2F1 (29). Despite a central role for TGF-β1 in NOX4 gene regulation in a variety of cell types, transcriptional mechanisms for its activation have not been well defined.

The molecular mechanism through which TGF-β regulates gene transcription involves the Smad pathway and its interaction with other pathways and transcription factors (30). Upon binding of TGF-β1 to the Type II receptor on the plasma membrane, a cascade of phosphorylation events lead to the formation of a complex containing phosphorylated Smad2/Smad3 and Smad 4, which translocates to the nucleus to regulate target gene transcription (31).

In addition to the Smad pathway, other signaling pathways and transcription factors have also been implicated in TGF-β1-mediated regulation of gene expression, some through physical interaction and functional cooperation with the Smad pathway (32,33). In this study, we explored the role of the canonical Smad pathway in TGF-β1 regulation of NOX4 gene transcription. Our studies indicate a tandem AP-1/Smad box in the far upstream region, between −3.97 kb and the −4.76 kb, of the NOX4 promoter that confers responsiveness to TGF-β1. This data provides insight into the molecular mechanisms of NOX4 gene expression and may lead to the development of more effective anti-oxidant and anti-fibrotic therapies for diseases characterized by TGF-β/NOX4 over-expression.

Materials and Methods

Cell culture

Human lung fibroblasts (IMR-90 cells) were purchased from American Type Culture Collection (Manassas, VA). Cells were routinely maintained in DMEM medium (Cellgro, Henden, VA) supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, 100 μg/ml streptomycin in a humidified atmosphere with 5% CO2 at 37°C. Cells were propagated using standard cell culture methods.

RNA isolation, cDNA synthesis and real-time PCR analyses

NOX4 mRNA was quantified by real-time PCR using ABI StepOnePlus real time PCR System (Applied Biosystems, Foster City, CA). Briefly, total RNA was isolated from IMR-90 cells using Amicon RNA isolation kit (Amicon-Millipore, Billerica, MA), and 0.8 μg of the total RNA was used for cDNA synthesis using SuperScript III cDNA Synthesis for qPCR Kit (Invitrogen, Carlsbad, CA). NOX4 TaqMan Gene Expression Assay (Applied Biosystem) was used for real-time PCR analysis of the target gene NOX4; β-actin was used as internal control. PCR reactions were performed for 40 cycles of 95°C for 15 sec and 60°C for 1 min. Relative NOX4 RNA levels were calculated using the ΔΔCt method with β-actin levels as reference for normalization.

NOX4 promoter-reporter construction

DNA fragments of various sizes (−741 bp, −1356 bp, −1848 bp, −3975 bp and −4760 bp) upstream of the putative transcription start site of the NOX4 gene were PCR-amplified using a BAC clone as template with corresponding primers (Table 1). The PCR fragments were purified, digested and cloned into the luciferase vector pGL3-Basic (Promega) with Mlu I and Xho I restriction sites. All constructs were confirmed by sequencing.

Table 1.

Primers used in this study

−741 bp construct F: 5′-CCCACGCGTGTTGCAGTGTCGAATAGGTACCTGGGTCAACTCCACACAC-3′
R: 5′-GGCTCGAGGCTGCCCAGACGCCCAGCGC-3′
−1356 bp construct F: 5′-GGACGCGTCTGCCAATGAACCTCCTGCCCCC-3′
R: 5′-GGCTCGAGGCTGCCCAGACGCCCAGCGC-3′
−1848 bp construct F: 5′-GGACGCGTGGCTCACCGCAACCTCTGCCTC-3′
R: 5′-GGCTCGAGGCTGCCCAGACGCCCAGCGC-3′
−3975 bp construct F: 5′ gcgcACGCGTAGTGTCCTGGTAAGAGAGAGGCAGAGGGTGATTTGACACACACACAG 3′
R: 5′ gcgcCTCGAGGCTGCCCAGACGCCCAGCGCTC
−4760 bp construct F: 5′ GCG CAC GCG TAG GAG CTA ACC CAG CCA TGT GGG TGC ACG GTA GAC 3′
R: 5′ gcgcCTCGAGGCTGCCCAGACGCCCAGCGCTC 3′
AP-1 site mutation F: 5′ GTAGAAATGAGAATGAGTTGCTGTCTGGAACTTGTC 3′
R: 5′ GACAAGTTCCAGACAGCAACTCATTCTCATTTCTAC 3′
Smad site mutation F: 5′ GAAATGAGAATGAGTCACTATGTAGAACTTGTCCCCCGAC 3′
R: 5′ GTCGGGGGACAAGTTCTACATAGTGACTCATTCTCATTTC 3′
AP-1 site deletion F: 5′ TGTGTAGAAATGAGAACTGTCTGGAACTTGTC
R: 5′ GACAAGTTCCAGACAGTTCTCATTTCTACACA 3′
Smad site deletion F: 5′ GAAATGAGAATGAGTCACAACTTGTCCCCCGAC 3′
R: 5′ GTCGGGGGACAAGTTGTGACTCATTCTCATTTC 3′
−3975 bp insertion-1 F: 5′ GAATGTCAGCAGCCACTGGAATGAGTCACTGTCTGGTCTGGAAGAGACAAGGAACAG 3′
R: 5′ CTGTTCCTTGTCTCTTCCAGACCAGACAGTGACTCATTCCAGTGGCTGCTGACATTC 3′
−3975 bp insertion-2 F: 5′ ATGTCAGCAGCCACTGGAAGAATGAGTCACTGTCTGGAACTCTGGAAGAGACAAGGAAC 3′
R: 5′ GTTCCTTGTCTCTTCCAGAGTTCCAGACAGTGACTCATTCTTCCAGTGGCTGCTGACAT 3′
ChIP F: 5′ TGAATCAGATGATGGTCTACACTTG 3′
R: 5′ AGTGGTCCAAAGGCTTAACATTCC 3′
Open in a new tab

Site-directed mutagenesis

Mutations, deletions and insertions of the AP-1 and Smad binding sites were introduced into the wild type constructs (−4760 bp and −3975 bp constructs) using the QuickChange Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA) following manufacturer’s instructions.

Transient transfection, TGF-β induction and luciferase assay

Transfections were conducted using Lipofectamine LTXplus reagent (Invitrogen, Carlsbad, CA) according to manufacturer’s instructions. Briefly, the day before transfection, IMR-90 cells were seeded into 24-well plate at a density of 4 × 104 cells/well in 0.5 ml of complete medium and cultured overnight. Lipofectamine LTXplusReagent-DNA complexes were prepared by incubating Renilla luciferase vector and respective NOX4 promoter-reporter constructs in 100 μl Opti-MEM medium; complexes were subsequently added to each corresponding well for transfection. After 24 h serum-starvation, transfected cells were treated with TGF-β1 (2 ng/ml) or vehicle (0.1%BSA; 4mM HCl) for 16 h; cells were then lysed, and luciferase activity measured using the Dual Luciferase Assay System (Promega, Fitchburg, WI) and the GENE 5 plate reader (BioTek Instruments, Winooski, VT), according to manufacturer’s instructions. The luciferase data of the NOX4 promoter-reporter constructs were calculated and normalized with Renilla luciferase activity. All transfections were carried out in triplicate.

Chromatin immunoprecipitation (ChIP) assays

IMR-90 cells maintained in complete growth medium were serum-starved for 24 h and then treated with TGF-β1 (2ng/ml) or vehicle-only for 2h. ChIP was performed as previously described (34). GAPDH polyclonal antibody (Abcam #9485) was used as a negative control. Fold enrichment was determined using ΔΔCt of the experimental cJun (Abcam #31419) or phospho-Smad3 (Cell Signaling #9520) compared to pull-down with GAPDH control.

Statistical analyses

All the data were analyzed by unpaired Student’s t-test. P values of less than 0.05 were considered statistically significant.

Results

TGF-β1 induces NOX4 mRNA in a time-dependent manner without altering mRNA stability

We first determined the time-course of NOX4 mRNA induction in human lung fibroblasts (IMR-90). IMR-90 cells were treated with TGF-β1 (2 ng/ml) or vehicle control for varying time intervals (Fig. 1A). NOX4 mRNA expression was induced almost 10-fold at 2 h and reached a maximum at 6 h, demonstrating a >20-fold induction over control cells. Extension of TGF-β1 treatment up to 16 hr showed NOX4 mRNA expression at a level similar to 8 h treatment (data not shown). To determine if alterations in mRNA stability accounted, at least in part, for this induction by TGF-β1, IMR-90 cells were treated with actinomycin-D prior to TGF-β1 stimulation and NOX4 mRNA levels assessed at regular time-intervals. We observed no differences in the half-life of NOX4 mRNA under these conditions (Fig. 1B), suggesting that increases in mRNA stability is not the primary mechanism for TGF-β1-induced NOX4 gene expression.

Figure 1. A, TGF-β treatment increases NOX4 mRNA level in human lung fibroblasts.

Figure 1

Open in a new tab

Human lung fibroblasts (IMR-90) cells were serum-starved for 24 h and stimulated with TGF-β (2 ng/ml) or vehicle-only for control. The treated cells were collected at 2 h, 4 h, 6 h and 8 h; total RNA isolated and real time PCR performed for analysis of NOX4 expression. B, NOX4 RNA stability study. IMR-90 cells were treated with actinomycin-D prior to TGF-β1 stimulation or vehicle-only treatment for control and NOX4 mRNA levels assessed at regular time-intervals. Data are expressed as mean ± SD (n=3 in each group).

TGF-β1-responsive elements of human NOX4 promoter are located within a region between −3976 bp and −4760 bp

NOX4 promoter-reporter gene constructs ranging from 4760 bp to 740 bp upstream of the transcription start site were cloned to analyze the regions of promoter responsiveness to TGF-β1 (Fig. 2A). These constructs were transfected into IMR-90 cells and luciferase activities measured and normalized to the control Renilla luciferase activity. Each of the five NOX4 promoter-reporter constructs shown in Fig. 2A was tested and their responsiveness to TGF-β1 examined. Of these, only the −4760 bp promoter fragment displayed TGF-β1 responsive promoter activity (Fig. 3), while the other four constructs did not display any TGF-β1 inducibility (data for the 1356 bp and 741 bp constructs are not shown). This suggested that cis-element(s) involved in TGF-β1 inducibility resides in this 785 bp region (−3976 bp to –4760 bp) of the NOX4 gene promoter.

Figure 2. Schematic representation of the human NOX4 promoter-reporter constructs and the TGF-β1-responsive elements identified in this study.

Figure 2

Open in a new tab

A, Map of the constructs. Various sizes of PCR fragments upstream from the putative transcription start site were cloned into pGL3-Basic luciferase vector and sequence-confirmed. B, TGF-β1-responsive element identified in this study. The underlined sequences represent the binding sites of transcription factors AP-1 and Smad.

Figure 3. TGF-β induces luciferase activity of the −4760 bp NOX4 promoter-reporter construct.

Figure 3

Open in a new tab

IMR-90 cells were co-transfected with the −4760 bp promoter construct and Renilla luciferase plasmids. After 24 h serum starvation, the transfected cells were stimulated with TGF-β (2 ng/ml) or vehicle only for 16 h. Cell lysates were collected, and luciferase activity was measured and normalized with the Renilla luciferase activity. Data are expressed as mean ± SD (n=3 in each group).

An AP-1/Smad binding box is responsible for TGF-β1inducibility of the human NOX4 promoter

A bioinformatics analysis of the 785 bp region responsive to TGF-β1 revealed an AP-1/Smad binding box located at −4653 bp to −4667 bp of the NOX4 promoter (Fig. 2B). Of note, the AP-1 binding site and Smad binding sites are localized in tandem, separated by only one base pair. We then tested the requirement of this AP-1/Smad box in the responsiveness of the promoter to TGF-β1 induction using site-directed mutagenesis. Mutations of AP-1 (2 bp) or Smad (3 bp) sites significantly reduced TGF-β1-induced NOX4 promoter activity of the −4760 bp construct (Fig. 4A). Double mutations of AP-1 and Smad sites completely blocked TGF-β1-induced NOX4 promoter activation (Fig. 4A). Furthermore, deletions of either the AP-1 or Smad site or both of the AP-1 and Smad sites resulted in a similar attenuation or blockade of TGF-β1 inducibility of the NOX4 promoter activity (Fig. 4B).

Figure 4. Mutation or deletion of AP-1 and Smad binding sites reduce TGF-β-induced luciferase activity of the −4760bp NOX4 promoter-reporter construct.

Figure 4

Open in a new tab

IMR-90 cells were co-transfected with the wild type or mutant constructs (A) or deletion constructs (B) and Renilla luciferase vector. After 24 h serum starvation, the transfected cells were stimulated with TGF-β (2ng/ml) or vehicle for 16 h. Luciferase activity was measured and normalized with the Renilla luciferase activity. Data are expressed as mean ± SD (n=3 in each group for both A and B).

We then tested whether insertion of these AP-1/Smad elements could confer TGF-β1 inducibility to the non-responsive −3975 bp NOX4 promoter-reporter construct. The first element tested was a direct insertion (insertion 1) of the element; the second insertion (insertion 2) was identical to insertion 1 with the addition of flanking nucleotides. Both insertions conferred TGF-β1 inducibility to the 3975 bp fragment (Fig. 5). Mutations of single AP-1 or Smad site or both of AP-1 and Smad sites abrogates the ability of insertion-1 to rescue TGF-β1-induced NOX4 promoter activation (Fig. 5). Similar results were observed in insertion 2 with mutations of AP-1 and/or Smad sites (data not shown). Together, these results demonstrate that the AP-1 and Smad sites confer TGF-β1 responsiveness to the NOX4 gene.

Figure 5. The AP-1-Smad box conferred TGF-β inducibility to the non-responsive −3975 bp NOX4 promoter-reporter construct.

Figure 5

Open in a new tab

Luciferase activity was measured in cells transfected with the TGF-β nonresponsive −3975 bp construct mutated to contain the wild-type AP-1/Smad element (insertion-1), or with the same element containing 3 bp of additional flanking sequences at both 5′ and 3′ ends (insertion-2), or insertion-1 with AP-1 mutation, Smad mutation or both AP-1 and Smad mutations. Data are expressed as mean ± SD (n=3 in each group).

Smad3 and cJun associate with the AP-1/Smad box in vivo upon TGF-β1 stimulation

Finally, we performed a ChIP assay to determine if Smad3 and AP-1 bind to the identified AP-1/Smad box in the NOX4 gene promoter. Stimulation with TGF-β1 induced a 7-fold enrichment of cJun (an AP-1 family member) and a 40-fold enrichment of Smad3 binding to this promoter region (Fig. 6). This data further supports the functional activation a TGF-β1 inducible AP-1/Smad binding element in the far upstream region of the human NOX4 promoter.

Figure 6. Chromatin immunoprecipitation analysis of the AP-1/Smad element region.

Figure 6

Open in a new tab

IMR-90 cells were treated with TGF-β for 2 hours and crosslinked chromatin was immunoprecipitated with either cJun antibody, a pSmad3 antibody, or a GAPDH antibody (negative control). Fold enrichment is relative to the GAPDH control immunoprecipitation. Bar graphs represent mean ± SD (n = 3 in each group).

Discussion

In the present study, we demonstrate that TGF-β1-responsiveness of the human NOX4 gene is located in the region between −3.97 kb and −4.76 kb upstream from the putative transcription start site (TSS) of the NOX4 promoter. Using bioinformatics analysis and site-directed mutagenesis approaches, we further identified the cis-acting elements, a 15bp AP-1/Smad binding box, responsible for TGF-β1-induced upregulation of NOX4 promoter activity. Mutation or deletion of either the AP-1 or Smad cis-elements attenuates the activity of the NOX4 promoter in response to TGF-β1, suggestingAP-1 and Smad in the regulation of TGF-β-mediated up-regulation of this promoter. Importantly, insertion of the AP-1/Smad box conferred TGF-β1 inducibility to the non-responsive −3.97 kb NOX4 promoter construct. Chromatin immunoprecipitation (ChIP) studies demonstrate that the binding of Smad3 and c-Jun to the AP-1/Smad box is significantly enriched in TGF-β1-treated cells compared to that in untreated cells. Collectively, these results identify an AP-1/Smad box located between −3.97 kb and −4.76 kb from the TSS site of the NOX4 promoter that is responsible for the transcriptional activation of the NOX4 gene by TGF-β1.

Our findings contrast with others which suggest that the TGF-β-inducible region is located within a −1848bp NOX4 promoter fragment (35). We did not observe any appreciable luciferase induction in our fibroblasts using our nearly equivalent −1848bp fragment. These authors observed a 2–3 fold increase in luciferase activity with TGF-β treatment of hepG2 cells (35), while we observed a much more robust induction (~15-fold) in human lung fibroblasts. It is possible that different cell lines use different Nox4 promoter regulatory sequences to induce Nox4 promoter activation in response to TGF-β1.

NOX4 has been implicated in a number of physiological and pathological processes (1,4). TGF-β1 is well recognized to induce NOX4 gene expression (20–24). Overexpression of TGF-β1 and NOX4 is implicated in pathological tissue remodeling and fibrosis involving diverse organ systems, including the lung (23,36), kidney (37), heart (38,39), and liver (24,40). Additionally, the TGF-β1/NOX4 axis may be critical in the stromal response that promotes carcinogenesis (41,42).

Despite a central role for TGF-β1 and NOX4 in fibrosis and emerging roles in cancer biology, mechanisms regulating NOX4 induction by TGF-β1 are not well understood. Among the NOX/DUOX homologs belonging to this gene family, NOX4 is unique in that it is primarily regulated at the level of gene transcription with the apparent dispensability of cytosolic factors and/or calcium to activate the enzyme (5–7). Thus, uncovering mechanisms that control NOX4 gene transcription are critical to understanding its regulation in health and disease. Although a number of transcription factors have been identified in regulating NOX4 gene transcription in response to various stimuli, this study is the first to implicate an AP-1/Smad binding box in TGF-β1-induced NOX4 gene expression and provides insights into the molecular mechanisms of NOX4 gene expression. Novel therapeutic approaches to interfere with upregulation of NOX4 in diseases characterized by activation of the TGF-β1/NOX4 pathway require further validation of a functional cooperativity between AP-1 and Smad in regulating NOX4 gene expression in vivo

Highlights.

  • TGF-β regulates NOX4 gene expression, at least in part, at the transcriptional level

  • TGF-β induces NOX4 promoter activity far upstream of its TSS (3975–4760bp)

  • A 15bp AP-1/Smad binding box within this region mediates TGF-β-induced NOX4 promoter activation

  • These results inform the design of therapeutics against NOX4-associated diseases

Acknowledgments

This work was supported by NIH grants, HL114470, HL67967 and HL94230 (to VJT).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Bedard K, Krause KH. The NOX family of ROS-generating NADPH oxidases: physiology and pathophysiology. Physiological reviews. 2007;87:245–313. doi: 10.1152/physrev.00044.2005. [DOI] [PubMed] [Google Scholar]
  • 2.Geiszt M, Leto TL. The Nox family of NAD(P)H oxidases: host defense and beyond. The Journal of biological chemistry. 2004;279:51715–51718. doi: 10.1074/jbc.R400024200. [DOI] [PubMed] [Google Scholar]
  • 3.Nauseef WM. Biological roles for the NOX family NADPH oxidases. The Journal of biological chemistry. 2008;283:16961–16965. doi: 10.1074/jbc.R700045200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Aguirre J, Lambeth JD. Nox enzymes from fungus to fly to fish and what they tell us about Nox function in mammals. Free radical biology & medicine. 2010;49:1342–1353. doi: 10.1016/j.freeradbiomed.2010.07.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Martyn KD, Frederick LM, von Loehneysen K, Dinauer MC, Knaus UG. Functional analysis of Nox4 reveals unique characteristics compared to other NADPH oxidases. Cellular signalling. 2006;18:69–82. doi: 10.1016/j.cellsig.2005.03.023. [DOI] [PubMed] [Google Scholar]
  • 6.von Lohneysen K, Noack D, Jesaitis AJ, Dinauer MC, Knaus UG. Mutational analysis reveals distinct features of the Nox4-p22 phox complex. The Journal of biological chemistry. 2008;283:35273–35282. doi: 10.1074/jbc.M804200200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.von Lohneysen K, Noack D, Hayes P, Friedman JS, Knaus UG. Constitutive NADPH oxidase 4 activity resides in the composition of the B-loop and the penultimate C terminus. The Journal of biological chemistry. 2012;287:8737–8745. doi: 10.1074/jbc.M111.332494. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Geiszt M, Kopp JB, Varnai P, Leto TL. Identification of renox, an NAD(P)H oxidase in kidney. Proceedings of the National Academy of Sciences of the United States of America. 2000;97:8010–8014. doi: 10.1073/pnas.130135897. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Shiose A, Kuroda J, Tsuruya K, Hirai M, Hirakata H, Naito S, Hattori M, Sakaki Y, Sumimoto H. A novel superoxide-producing NAD(P)H oxidase in kidney. The Journal of biological chemistry. 2001;276:1417–1423. doi: 10.1074/jbc.M007597200. [DOI] [PubMed] [Google Scholar]
  • 10.Cheng G, Cao Z, Xu X, van Meir EG, Lambeth JD. Homologs of gp91phox: cloning and tissue expression of Nox3, Nox4, and Nox5. Gene. 2001;269:131–140. doi: 10.1016/s0378-1119(01)00449-8. [DOI] [PubMed] [Google Scholar]
  • 11.Craige SM, Chen K, Pei Y, Li C, Huang X, Chen C, Shibata R, Sato K, Walsh K, Keaney JF., Jr NADPH oxidase 4 promotes endothelial angiogenesis through endothelial nitric oxide synthase activation. Circulation. 2011;124:731–740. doi: 10.1161/CIRCULATIONAHA.111.030775. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Pendyala S, Moitra J, Kalari S, Kleeberger SR, Zhao Y, Reddy SP, Garcia JG, Natarajan V. Nrf2 regulates hyperoxia-induced Nox4 expression in human lung endothelium: identification of functional antioxidant response elements on the Nox4 promoter. Free radical biology & medicine. 2011;50:1749–1759. doi: 10.1016/j.freeradbiomed.2011.03.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Goettsch C, Goettsch W, Arsov A, Hofbauer LC, Bornstein SR, Morawietz H. Long-term cyclic strain downregulates endothelial Nox4. Antioxidants & redox signaling. 2009;11:2385–2397. doi: 10.1089/ars.2009.2561. [DOI] [PubMed] [Google Scholar]
  • 14.Goettsch C, Goettsch W, Brux M, Haschke C, Brunssen C, Muller G, Bornstein SR, Duerrschmidt N, Wagner AH, Morawietz H. Arterial flow reduces oxidative stress via an antioxidant response element and Oct-1 binding site within the NADPH oxidase 4 promoter in endothelial cells. Basic research in cardiology. 2011;106:551–561. doi: 10.1007/s00395-011-0170-3. [DOI] [PubMed] [Google Scholar]
  • 15.White SJ, Hayes EM, Lehoux S, Jeremy JY, Horrevoets AJ, Newby AC. Characterization of the differential response of endothelial cells exposed to normal and elevated laminar shear stress. Journal of cellular physiology. 2011;226:2841–2848. doi: 10.1002/jcp.22629. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Bonello S, Zahringer C, BelAiba RS, Djordjevic T, Hess J, Michiels C, Kietzmann T, Gorlach A. Reactive oxygen species activate the HIF-1alpha promoter via a functional NFkappaB site. Arteriosclerosis, thrombosis, and vascular biology. 2007;27:755–761. doi: 10.1161/01.ATV.0000258979.92828.bc. [DOI] [PubMed] [Google Scholar]
  • 17.Diebold I, Petry A, Hess J, Gorlach A. The NADPH oxidase subunit NOX4 is a new target gene of the hypoxia-inducible factor-1. Molecular biology of the cell. 2010;21:2087–2096. doi: 10.1091/mbc.E09-12-1003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Lu X, Murphy TC, Nanes MS, Hart CM. PPAR{gamma} regulates hypoxia-induced Nox4 expression in human pulmonary artery smooth muscle cells through NF-{kappa}B. American journal of physiology. Lung cellular and molecular physiology. 2010;299:L559–566. doi: 10.1152/ajplung.00090.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Manea A, Tanase LI, Raicu M, Simionescu M. Jak/STAT signaling pathway regulates nox1 and nox4-based NADPH oxidase in human aortic smooth muscle cells. Arteriosclerosis, thrombosis, and vascular biology. 2010;30:105–112. doi: 10.1161/ATVBAHA.109.193896. [DOI] [PubMed] [Google Scholar]
  • 20.Cucoranu I, Clempus R, Dikalova A, Phelan PJ, Ariyan S, Dikalov S, Sorescu D. NAD(P)H oxidase 4 mediates transforming growth factor-beta1-induced differentiation of cardiac fibroblasts into myofibroblasts. Circulation research. 2005;97:900–907. doi: 10.1161/01.RES.0000187457.24338.3D. [DOI] [PubMed] [Google Scholar]
  • 21.Carmona-Cuenca I, Herrera B, Ventura JJ, Roncero C, Fernandez M, Fabregat I. EGF blocks NADPH oxidase activation by TGF-beta in fetal rat hepatocytes, impairing oxidative stress, and cell death. Journal of cellular physiology. 2006;207:322–330. doi: 10.1002/jcp.20568. [DOI] [PubMed] [Google Scholar]
  • 22.Haurani MJ, Cifuentes ME, Shepard AD, Pagano PJ. Nox4 oxidase overexpression specifically decreases endogenous Nox4 mRNA and inhibits angiotensin II-induced adventitial myofibroblast migration. Hypertension. 2008;52:143–149. doi: 10.1161/HYPERTENSIONAHA.107.101667. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Hecker L, Vittal R, Jones T, Jagirdar R, Luckhardt TR, Horowitz JC, Pennathur S, Martinez FJ, Thannickal VJ. NADPH oxidase-4 mediates myofibroblast activation and fibrogenic responses to lung injury. Nat Med. 2009;15:1077–1081. doi: 10.1038/nm.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Jiang JX, Chen X, Serizawa N, Szyndralewiez C, Page P, Schroder K, Brandes RP, Devaraj S, Torok NJ. Liver fibrosis and hepatocyte apoptosis are attenuated by GKT137831, a novel NOX4/NOX1 inhibitor in vivo. Free radical biology & medicine. 2012;53:289–296. doi: 10.1016/j.freeradbiomed.2012.05.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Pepe AE, Xiao Q, Zampetaki A, Zhang Z, Kobayashi A, Hu Y, Xu Q. Crucial role of nrf3 in smooth muscle cell differentiation from stem cells. Circulation research. 2010;106:870–879. doi: 10.1161/CIRCRESAHA.109.211417. [DOI] [PubMed] [Google Scholar]
  • 26.Katsuyama M, Hirai H, Iwata K, Ibi M, Matsuno K, Matsumoto M, Yabe-Nishimura C. Sp3 transcription factor is crucial for transcriptional activation of the human NOX4 gene. The FEBS journal. 2011;278:964–972. doi: 10.1111/j.1742-4658.2011.08018.x. [DOI] [PubMed] [Google Scholar]
  • 27.Manea A, Tanase LI, Raicu M, Simionescu M. Transcriptional regulation of NADPH oxidase isoforms, Nox1 and Nox4, by nuclear factor-kappaB in human aortic smooth muscle cells. Biochemical and biophysical research communications. 2010;396:901–907. doi: 10.1016/j.bbrc.2010.05.019. [DOI] [PubMed] [Google Scholar]
  • 28.Mittal M, Roth M, Konig P, Hofmann S, Dony E, Goyal P, Selbitz AC, Schermuly RT, Ghofrani HA, Kwapiszewska G, Kummer W, Klepetko W, Hoda MA, Fink L, Hanze J, Seeger W, Grimminger F, Schmidt HH, Weissmann N. Hypoxia-dependent regulation of nonphagocytic NADPH oxidase subunit NOX4 in the pulmonary vasculature. Circulation research. 2007;101:258–267. doi: 10.1161/CIRCRESAHA.107.148015. [DOI] [PubMed] [Google Scholar]
  • 29.Zhang L, Sheppard OR, Shah AM, Brewer AC. Positive regulation of the NADPH oxidase NOX4 promoter in vascular smooth muscle cells by E2F. Free radical biology & medicine. 2008;45:679–685. doi: 10.1016/j.freeradbiomed.2008.05.019. [DOI] [PubMed] [Google Scholar]
  • 30.Derynck R, Zhang YE. Smad-dependent and Smad-independent pathways in TGF-beta family signalling. Nature. 2003;425:577–584. doi: 10.1038/nature02006. [DOI] [PubMed] [Google Scholar]
  • 31.Shi Y, Massague J. Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell. 2003;113:685–700. doi: 10.1016/s0092-8674(03)00432-x. [DOI] [PubMed] [Google Scholar]
  • 32.Pierrat MJ, Marsaud V, Mauviel A, Javelaud D. Expression of microphthalmia-associated transcription factor (MITF), which is critical for melanoma progression, is inhibited by both transcription factor GLI2 and transforming growth factor-beta. The Journal of biological chemistry. 2012;287:17996–18004. doi: 10.1074/jbc.M112.358341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Bergstrom R, Savary K, Moren A, Guibert S, Heldin CH, Ohlsson R, Moustakas A. Transforming growth factor beta promotes complexes between Smad proteins and the CCCTC-binding factor on the H19 imprinting control region chromatin. The Journal of biological chemistry. 2010;285:19727–19737. doi: 10.1074/jbc.M109.088385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Hock TD, Nick HS, Agarwal A. Upstream stimulatory factors, USF1 and USF2, bind to the human haem oxygenase-1 proximal promoter in vivo and regulate its transcription. The Biochemical journal. 2004;383:209–218. doi: 10.1042/BJ20040794. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Boudreau HE, Emerson SU, Korzeniowska A, Jendrysik MA, Leto TL. Hepatitis C virus (HCV) proteins induce NADPH oxidase 4 expression in a transforming growth factor beta-dependent manner: a new contributor to HCV-induced oxidative stress. J Virol. 2009;83:12934–12946. doi: 10.1128/JVI.01059-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Carnesecchi S, Deffert C, Donati Y, Basset O, Hinz B, Preynat-Seauve O, Guichard C, Arbiser JL, Banfi B, Pache JC, Barazzone-Argiroffo C, Krause KH. A key role for NOX4 in epithelial cell death during development of lung fibrosis. Antioxidants & redox signaling. 2011;15:607–619. doi: 10.1089/ars.2010.3829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Barnes JL, Gorin Y. Myofibroblast differentiation during fibrosis: role of NAD(P)H oxidases. Kidney international. 2011;79:944–956. doi: 10.1038/ki.2010.516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Kuroda J, Ago T, Matsushima S, Zhai P, Schneider MD, Sadoshima J. NADPH oxidase 4 (Nox4) is a major source of oxidative stress in the failing heart. Proceedings of the National Academy of Sciences of the United States of America. 2010;107:15565–15570. doi: 10.1073/pnas.1002178107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Ago T, Kuroda J, Pain J, Fu C, Li H, Sadoshima J. Upregulation of Nox4 by hypertrophic stimuli promotes apoptosis and mitochondrial dysfunction in cardiac myocytes. Circulation research. 2010;106:1253–1264. doi: 10.1161/CIRCRESAHA.109.213116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Aoyama T, Paik YH, Watanabe S, Laleu B, Gaggini F, Fioraso-Cartier L, Molango S, Heitz F, Merlot C, Szyndralewiez C, Page P, DAB Nicotinamide adenine dinucleotide phosphate oxidase (nox) in experimental liver fibrosis: GKT137831 as a novel potential therapeutic agent. Hepatology. 2012 doi: 10.1002/hep.25938. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Sampson N, Koziel R, Zenzmaier C, Bubendorf L, Plas E, Jansen-Durr P, Berger P. ROS signaling by NOX4 drives fibroblast-to-myofibroblast differentiation in the diseased prostatic stroma. Molecular endocrinology. 2011;25:503–515. doi: 10.1210/me.2010-0340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Tobar N, Guerrero J, Smith PC, Martinez J. NOX4-dependent ROS production by stromal mammary cells modulates epithelial MCF-7 cell migration. British journal of cancer. 2010;103:1040–1047. doi: 10.1038/sj.bjc.6605847. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES