Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Jan 1.
Published in final edited form as: Microbiol Immunol. 2014 Jan;58(1):51–60. doi: 10.1111/1348-0421.12129

Activation of Toll-like receptor 9 inhibits LPS-induced receptor activator of NF-κB ligand expression in rat B lymphocytes

Xiaoqian Yu 1,2, Jiang Lin 1,3, Qing Yu 1, Toshihisa Kawai 1, Martin A Taubman 1, Xiaozhe Han 1,*
PMCID: PMC4010952  NIHMSID: NIHMS544735  PMID: 24661200

Abstract

B lymphocytes express multiple Toll-like receptors (TLRs) that regulate cytokine production by these B cells. We investigated the effect of TLR4 and TLR9 activation on receptor activator of NF-κB ligand (RANKL) expression by rat spleen B cells. Splenocytes or purified spleen B cells from Rowett rats were cultured with TLR4 ligand E. coli LPS and/or TLR9 ligand CpG-oligodeoxynucleotide (CpG-ODN) for 2 days. RANKL mRNA expressions and the percentage of RANKL-positive B cells were increased in rat splenocytes challenged by E. coli LPS alone. Such increase was diminished when cells were treated with both CpG-ODN and E. coli LPS. Microarray results revealed that expressions of multiple cyclin-dependent kinase (CDK) pathway-related genes were up-regulated only in cells treated with both E. coli LPS and CpG-ODN. This study suggests that CpG-ODN inhibit LPS-induced RANKL expression in rat B cells via regulation of CDK pathway.

Keywords: RANKL, B lymphocytes, Immune response, Toll-like receptor

1. Introduction

Immune responses to gram-negative bacterial infections including periodontitis involve activated B lymphocytes, not only in immune defense against microbial insults, but also in bone pathogenesis (1–3). Our studies and others have demonstrated that B lymphocytes produce receptor activator of NF-κB ligand (RANKL) in the bone resorptive lesion of periodontal disease (3–5), and excess RANKL shifts the balance of bone metabolism towards catabolism and causes pathological bone resorption (6). It is essential to obtain knowledge of mechanistic control of B-cell associated bone pathogenesis in order to design interventional strategies targeting such populations for the amelioration of bone resorption. While Toll-like receptor (TLR) signaling pathways play an important role in regulating B cell functions (7, 8), including cytokine production, phagocytosis, and apoptosis (9), little is known about TLR signaling in the control of B cell-mediated bone pathogenesis.

Although RANKL up-regulation was usually considered to be induced by pro-inflammatory cytokines, LPS from Gram-negative bacteria could also directly increase RANKL mRNA level in osteoblast- and osteoclast-lineage cells (10, 11). Studies have demonstrated that activation of TLR2 or TLR4 results in RANKL-dependent osteoclastogenesis in rheumatoid arthritis synovium (12, 13). It is also indicated that CpG-ODN, upon TLR9 ligation, induces osteoblasts osteoclastogenic activity (14). However, other studies showed that activation of TLRs (specifically TLR4 and TLR9) in early osteoclast precursors results in inhibition of RANKL-induced osteoclast differentiation via IL-12 (15). In human osteoclast precursor cell culture models, TLR ligands inhibit RANK expression by down-regulating cell surface expression of the M-CSF receptor c-Fms, thereby suppress osteoclastogenesis (16). These paradoxes suggest that the role of TLRs in the regulation of RANKL expression need to be investigated and interpreted according to cell types, developmental stages, and environmental encounters.

Lymphocytes infiltration is a typical characteristic of progressive diseased lesion (17, 18). Our previous studies demonstrated T and B lymphocytes are the primary cellular sources of RANKL in the diseased lesions (5). However, there have been limited studies to determine the relationship of multiple TLR activation and RANKL expression in B lymphocytes. As components of gram-negative bacteria, LPS and CpG-ODN trigger TLR4 and TLR9 respectively at the site of infection although the predominance of the two components may change during different stages of infection. Knowledge about the interaction between TLR4 and TLR9 signaling on RANKL expression by B cells provide useful information to understand the pathogenesis of bone resorptive diseases and to develop potentially new treatment methods. In the current study, we investigated the effects of co-activation of TLR4 and TLR9 on RANKL production in rat spleen B cells and examined the underlying signaling pathways involved in such effects.

Materials and Methods

2.1 Rat strain and culture of splenocytes

Experiments were performed with inbred heterozygous normal Rowett rats (Rnu/+, female, 2–3 month old) maintained under pathogen-free conditions in laminar flow cabinets. Experiments using these animals were approved by the Forsyth Institute's Internal Animal Care and Use Committee. Rats were euthanized in a CO2 chamber and single-cell suspensions of splenocytes were obtained by dispersing spleen tissues through a 60-gauge stainless steel screen. Erythrocytes were removed by ACK lysing buffer (Lonza, MA). Isolated splenocytes were adjusted to 1.0×106 /ml and were added into either 96-well plates (200µl/well) or 6-well plates (4ml/well) in RPMI complete medium containing 10% FCS, 100 U/ml penicillin, 100 mg/ml streptomycin, 2 mM L-glutamine, 2.5µg/ml Amphotericin B (Hyclone, Thermo Fisher Scientific, IL) and 50 µM 2-ME. Cells were cultured at 37°C in a humidified incubator with 5% CO2. E. coli LPS (strain O55:B5, Sigma-Aldrich) were used as TLR4 agonist and rat stimulatory CpG-ODN (5’-GAGAACGCTCGACCTTCGAT-3’) were used as TLR9 agonist. This ODN was prepared and tested for purity by polyacrylamide gel electrophoresis (Ransom Hill Bioscience, Ramona, CA). A non-stimulatory scrambled ODN (5’-GAGACCATGACCCTGTCAGT-3’) was used as control. Both ODNs were tested previously in an athymic rat lymph node cell stimulation assay and only addition of the CpG-ODN resulted in stimulation of B cells (19). Cultured splenocytes were treated with various concentrations of E. coli LPS and/or CpG-ODN for indicated time and then were collected for further analysis.

2.2 RT-PCR

Total RNA was extracted from the cultured cells using a Purelink RNA mini kit (Life Technology, Carlsbad, CA) following manufacturer’s instructions. Isolated mRNA (0.1µg each) was reverse transcribed into cDNA using the SuperScriptII reverse transcription system in the presence of random primers (Invitrogen). The resultant cDNA was amplified by PCR using gene-specific primer pairs with Taq DNA polymerase (Life Technology) as described by the manufacturer. The primer sequences used for the amplification were as follows: TLR4: forward 5’-ggaatacctggactttcagcac-3’ and reverse 5’-tgttgcagtattcctttggatg-3’ (423 bp); TLR9: forward 5'-aacaagctggacctgtaccatt-3' and reverse 5'-gatgaatcaggcttctcaggtc-3' (307 bp); RANKL: forward 5'-tggagagcgaagacacagaa-3' and reverse 5'-tgatggtgaggtgagcaaac-3' (201bp); GAPDH: forward 5’- tcactgccactcagaagactgt-3’ and reverse 5’- ttcagctctgggatgacctt -3’ (133bp). PCR conditions were 30 cycles of 94°C, 30 seconds; 55°C, 15 seconds; 72°C, 30 seconds. Amplification of the GAPDH gene was used as an internal control.

2.3 Real-time PCR

Real-time PCR was carried out in a 25µl reaction system using SuperScript III Platinum SYBR Green One-Step qRT-PCR Kit (Life Technology) in a Roche LightCycler 480 (Roche Diagnostics, Indianapolis, IN). Each RNA sample was loaded in duplicate into the plate with a template amount of 10ng. The primers used were as follows: TLR4: forward 5’-catggcattgttcctttcct-3’ and reverse 5’-tgtcatgagggattttgctg-3’ (116bp); TLR9: forward 5’-agcactcccgtctcaaagaa-3’ and reverse 5’-tgacgaacatctctggcttg-3’ (106bp); OPG: forward 5’-aatggtcactgggctgtttc-3’ and reverse 5’-gaggatcttcattcccacca-3’ (120bp). The primers used for RANKL and GAPDH are the same as in RT-PCR. The real-time PCR conditions were: 50°C for 3 minutes, 95°C for 5 minutes, followed by 40 cycles of 95°C for 15seconds and 60°C for 30 seconds. Results were presented as fold changes relative to GAPDH reference.

2.4 Flow cytometry

At the termination of cell culture, splenocytes in the 96-well plates were washed with PBS followed by incubation with fluorescence conjugated antibodies. FITC-conjugated mouse anti-rat CD45RA antibody (clone OX-33, BD Biosciences) was used to isolate B lymphocytes. For the detection of RANKL-positive cells, cultured cells were stained with human OPG-Fc (a fusion protein kindly provided by Dr. Colin Dunstan from Amgen Inc., Thousand Oaks, CA) followed by PE-conjugated goat anti-human IgG (Sigma, Saint Louis, MO). At least 20,000 cells were counted for each sample. Splenocytes in the 6-well plates were used for cell sorting. After stained with FITC-conjugated anti-rat CD45RA antibody, B lymphocytes were isolated individually using BD FACSAria III cell sorter/flow cytometer (BD Biosciences). The purity of the isolated B cells is routinely examined to be > 98% at all times. For apoptotic cell detection, PE-conjugated Annexin V and 7-Amino-actinomycin D (7-AAD, BD Biosciences) were added to cultured cells after indicated time to determine cell viability. Early apoptotic cells were evaluated by the percentage of AnnexinV+/7-AAD− cells. At least 800,000 cells were collected in each treatment group.

2.5 Focused Oligo cDNA array for gene expression profiling

The Oligo GEArray® Rat Signal Transduction PathwayFinder™ Microarray (SA Biosciences) was used to profile the expression of 95 genes representative of 18 signal transduction pathways. Biotin-UTP labeled cRNA was synthesized from total RNA and hybridized with the array membrane. After washing, the membrane was incubated with alkline phosphatase (AP)-conjugated streptavidin followed by CDP-Star chemiluminescent substrate. Images were analysed by GEArray Analyzer software (SA Biosciences).

2.6 Statistics

Results are presented as means ± standard errors (SE). Paired Student’s t-test was used to analyze differences among groups. Results with probability values of less than 0.05 are considered statistically significant.

3. Results

3.1 Increased TLR expressions in rat splenocytes after stimulation with respective agonists

To determine the TLR gene expression in rat splenocytes after stimulation by E. coli LPS and CpG-ODN respectively, mRNA transcript levels of TLR4 and TLR9 were measured using RT-PCR. As expected, the results showed that E. coli LPS specifically elevated TLR4 expression, whereas CpG-ODN specifically elevated TLR9 expression, in a dose-dependent manner (Fig. 1A, 1B). However, neither change in TLR4 expression was observed when cells were treated with CpG-ODN, nor in TLR9 expression when cells were treated with E. coli LPS (Fig. 1C, 1D). LPS-stimulated TLR4 expression was most eminent at 48 hrs, whereas TLR9 expression was not affected (Fig. 1C). On the other hand, TLR9 expression was dramatically increased 48 hours after 2.5µM CpG ODN stimulation whereas TLR4 was undetectable through the observation period (Fig. 1D). The results also confirmed the optimal time (48 hrs) and dosage (LPS, 2µg/mL; CpG-ODN, 2.5µM) to activate TLR4 and TLR9 expression, which were used in all the subsequent experiments.

Fig. 1. TLR4 and TLR9 expressions in rat splenocytes after stimulation with respective TLR ligands.

Fig. 1

Fig. 1

Fig. 1

Fig. 1

Open in a new tab

Rat splenocytes were cultured in the presence or absence of indicated concentrations of CpG ODN and/or E. coli LPS, and TLR4 and TLR9 mRNA levels were detected at various time points using RT-PCR. (A) Cells were incubated with various concentrations of CpG ODN (0 – 10µM) or scrambled ODN (0.5 – 10µM) for 48 hours and TLR9 mRNA levels in cells were measured by RT-PCR. (B) Cells were incubated with 2.5µM CpG ODN for indicated times (12, 24, 48, 72 hrs) and both TLR4 and TLR9 mRNA levels in cells were measured by RT-PCR. (C) Cells were incubated with various concentrations of E. coli LPS (0 – 20µg/ml) for 48 hrs and TLR4 mRNA level in cells were measured by RT-PCR. (D) Cells were incubated with 2µg/ml of E. coli LPS for indicated times (12, 24, 48, 72 hrs) and both TLR4 and TLR9 mRNA levels in cells were measured by RT-PCR. Samples were quantified by densitometry scanning, and the level of each gene relative to control GAPDH is depicted. The results are representative of at least three independent experiments in duplicates. Data are presented as Mean ± SEM.

3.2 RANKL expressions in rat splenocytes after stimulation with TLR agonists

To determine the overall expression level of RANKL in cultured splenocytes, we first examined the mRNA transcript levels of RANKL in cultured rat splenocytes by real time PCR. The results demonstrated that RANKL mRNA level was not changed in cells treated with CpG-ODN, but was significantly increased in cells treated with E. coli LPS (Fig. 2A). This increase was diminished after cells were treated with both CpG-ODN and E. coli LPS as compared to those treated with E. coli LPS alone (Fig. 2A). Flow cytometry results showed that the percentage of RANKL-positive splenocytes were much higher in E. coli LPS-treated groups compared to control groups. However, CpG-ODN in addition to E. coli LPS decreased the percentage of RANKL-positive splenocytes as compared to those treated with E. coli LPS alone (Fig. 2B). These results suggest that CpG-ODN effectively blocked E. coli LPS-induced RANKL expression and RANKL-positive cell production in cultured rat splenocytes.

Fig. 2. RANKL expressions in rat splenocytes after stimulation with CpG ODN and LPS.

Fig. 2

Fig. 2

Open in a new tab

Rat splenocytes were cultured for 48 hrs in the presence or absence of 2.5µM CpG ODN and/or 2µg/ml E. coli LPS, and (A) RANKL mRNA levels were detected using real time PCR, or (B) the percentage of RANKL-positive cells in the cultured splenocytes were detected using flow cytometry. CpG, 2.5µM CpG ODN; LPS, 2µg/ml E. coli LPS. Data are presented as Mean ± SEM, n=6. Student t-test, *P < 0.05, **P < 0.01.

3.3 TLR expressions in rat spleen B cells after stimulation with TLR agonists

In order to determine the direct effects of TLR agonist on B cell RANKL expression and exclude the potential involvements of other cellular components, rat spleen B cells were isolated from splenocytes by staining with FITC-conjugated anti-CD45RA (clone OX33) followed by flow cytometry cell sorting. Purified B cells were cultured with CpG-ODN and/or E. coli LPS and the mRNA transcript levels of TLR4 and TLR9 were detected by real-time PCR. As shown in Fig. 3, TLR4 mRNA transcripts were increased only in E. coli LPS-treated cells, whereas TLR9 mRNA transcripts were increased only in CpG-ODN-treated cells, indicating their respective ligand specificity. Although not statistically significant, addition of E. coli LPS appeared to attenuate the CpG-ODN-induced TLR9 expression (Fig. 3), suggesting a potential interaction between TLR4 and TLR9 signaling.

Fig. 3. TLR4 and TLR9 expressions in cultured rat spleen B cells after stimulation with respective TLR ligands.

Fig. 3

Open in a new tab

Rat splenocytes were labeled with mouse anti-rat CD45RA antibody and B lymphocytes were sorted from splenocytes using flow cytometry cell sorting. Sorted B cells were cultured for 48 hrs in the presence or absence of 2.5µM CpG ODN and/or 2µg/ml E. coli LPS. TLR4 and TLR9 mRNA levels in cultured B lymphocytes were detected by real time PCR. CpG, 2.5µM CpG ODN; LPS, 2µg/ml E. coli LPS. Data are presented as Mean ± SEM, n=6. Student t-test, *P < 0.05, **P < 0.01.

3.4 RANKL expressions in rat spleen B cells after stimulation with TLR agonists

RANKL expressions in purified spleen B cells were further determined using real-time PCR and flow cytometry. The results showed that E. coli LPS, but not CpG-ODN, strongly induced RANKL mRNA transcript level in cultured spleen B cells. Such effect of E. coli LPS in the stimulation of RANKL expression was abolished by the addition of CpG-ODN when compared with cells treated with E. coli LPS alone (Fig. 4A). Flow cytometry showed similar results demonstrating a significant reduction of the percentage of RANKL-positive B cells when cells were treated with both CpG-ODN and E. coli LPS as compared with cells treated with E. coli LPS alone (Fig. 4B). Cells treated with CpG-ODN alone did not show a significant reduction of the percentage of RANKL-positive cells (Fig. 4B). Since the ratio of RANKL and osteoprotegrin (OPG) production in rat lymphocytes is considered an important marker in inflammatory bone resorption in experimental periodontal disease (20), the levels of OPG gene expression in cultured cells were also examined. The results showed that splenic B cells exhibited low OPG expression in the present study and were not affected under LPS or CpG-ODN challenge (Fig. 4C).

Fig. 4. RANKL expressions in cultured rat spleen B cells after stimulation with CpG ODN and LPS.

Fig. 4

Fig. 4

Fig. 4

Open in a new tab

Sorted rat spleen B cells were cultured for 48 hrs in the presence or absence of 2.5µM CpG ODN and/or 2µg/ml E. coli LPS, and (A) RANKL mRNA levels in cultured B cells were detected using real time PCR, (B) the percentage of RANKL-positive cells in the cultured total B cells were detected using flow cytometry. (C) OPG mRNA levels in cultured B cells were detected using real time PCR. CpG, 2.5µM CpG ODN; LPS, 2µg/ml E. coli LPS. Data are presented as Mean ± SEM, n=6. Student t-test, *P < 0.05, **P < 0.01.

3.5 Signal transduction pathway analysis

To identify mechanisms underlying the antagonistic effect of TLR9 (which is activated by CpG ODN) on the TLR4-mediated RANKL production (which is activated by E. coli LPS), 95 genes involved in 18 signal transduction pathways was examined using Oligo DNA array. Compared to cells treated with CpG ODN or E. coli LPS alone, cells treated with E. coli LPS and CpG ODN demonstrated a unique pattern of gene expression (Fig. 5A). Three cyclin dependent kinase inhibitors (CDKIs) 1c, 2a and 2b were up-regulated (2.54-, 2.67- and 2.40-fold respectively), together with an up-regulation of epidermal growth factor receptor (EGFR, 2.39-fold). On the other hand, tumor necrosis factor superfamily, member 6 (TNFSF6, also known as Fas ligand) and protein kinase C, alpha (PKCα) were down-regulated by 2.38-fold and 2.33-fold respectively. All these genes were not changed in LPS-treated or CpG ODN-treated groups (less than 2-fold change). These results suggest that the inhibition of CDK pathway may contribute to the observed RANKL suppression in B cells (Fig. 5B).

Fig. 5. Microarray to detect signaling molecules regulated in cultured rat spleen B cells that are treated with both CpG ODN and LPS.

Fig. 5

Fig. 5

Fig. 5

Fig. 5

Open in a new tab

The expression of 95 genes representative of the 18 signal transduction pathways were studied. Genes that are differentially expressed (up- or down-regulated) by at least two-fold compared to controls were analyzed. Only genes differentially expressed in cells treated with both CpG ODN and LPS, but not with CpG or LPS alone were selected. (A) A representative array image showing the intensity of cDNA probes hybridized with the array membrane (in quadruplets) as a reflection of individual mRNA levels in each cell sample after different treatments. (B) Samples were quantified by densitometry scanning, and the ratio of the expression level of each gene in treated cells compared to non-treated cells is calculated. Only genes differentially expressed in cells treated with both CpG ODN and LPS are depicted here. The results are representative of three independent experiments. (C) Early cell apoptosis under different treatments were analyzed by flow cytometry. Apoptotic cells were presented as the percentage of AnnexinV+/7-AAD− cells. Data are presented as Mean ± SEM, n=6. Student t-test, **P < 0.01. (D) Schematic model illustrating the regulation of CDK pathway by TLR4/9 co-activations leading to the reduction of RANKL expression by rat spleen B cells.

3.6 Evaluation of cell viability

To determine the cell viability after different treatments, cultured B cells were stained with PE-conjugated Annexin V and 7-AAD followed by flow cytometry analysis. The results showed that 24 hours after treatments, the percentage of AnnexinV+/7-AAD− cells were significantly increased in B cells treated with CpG ODN and E. coli LPS compared to controls (Fig. 5C), indicating an increased number of early apoptotic cells. Such increase was not observed in B cells treated with CpG ODN or E. coli LPS alone.

Discussion

In general, periodontitis is characterized as alveolar bone destructive diseases associated with gram-negative bacterial infection. Since RANKL was first identified as a cytokine that regulates osteoclast differentiation and activation (21), studies related to periodontal bone resorption were initially focused on RANKL expressions of periodontal tissues, including osteoclasts, osteoblasts, and periodontal ligament cells (22, 23). However, our previous findings indicated that lymphocytes are key participants in RANKL-mediated bone resorption using gingival tissues from periodontitis patients (5) and demonstrated a higher percentage of RANKL-positive cells in B lymphocytes compared to T lymphocytes (5). While various B cell subsets express multiple TLRs, including TLR4 and TLR9, the role of TLR signaling on B cell-mediated bone resorption is entirely unclear. Understanding of such role is important, because it provides us new knowledge about interactions between innate and adaptive arms of host immune response in bone pathogenesis.

Using a cell culture system, we tested RANKL expressions in B cells under the challenge of different TLR ligands. As expected, our results showed TLR4 ligation with bacterial surface component LPS could induce increased RANKL positive cells and RANKL mRNA productivity in B cells. LPS-stimulated RANKL synthesis in T cells has also been reported previously by others in gingival tissues of chronic periodontitis patients (24). As bacterial infection and host immune responses advance, many cells breakdown and release nuclear substances before they were engulfed by macrophages. This provides a stage where the host immune system can interact with the bacterial DNA substances. Different from mammalian cells in which the rate of CpG motifs is low and 80% are methylated (25), prokaryotic cells, such as bacteria, are characterized by enriched unmethylated CpG motifs which are the structural bases of host immune cell recognition by TLR9 (26). Engulfed by immune cells, bacterial DNA fragments containing CpG motifs are delivered to endoplasmic reticulum eliciting responses through TLR9, which is predominantly expressed on plasmacytoid dendritic cells and B cells (27). This gives rise to the question whether TLR9 ligation through CpG affects the increased RANKL expression by TLR4 activation through LPS in B cells. Interestingly, both RANKL positive cell percentage and quantitative mRNA data demonstrated that the LPS induced increase in RANKL expression was completely abolished by simultaneous CpG stimulation (Fig. 2, 4). Considering our previous data from an in vivo study which demonstrated a greater level of RANKL expression and osteoclastogenesis effect of B cells in an T-independent manner after A. actinomycetemcomitans (a gram negative periodontal pathogen) immunization (3), the RANKL suppressing effect of CpG-ODN is potentially significant in ameliorating B cell-mediated inflammatory bone resorption.

We have demonstrated that TLR4 mRNA transcripts were increased only in E. coli LPS-treated B cells, whereas TLR9 mRNA transcripts were increased only in CpG-ODN-treated B cells (Fig. 3). It is noted that the levels of TLR up-regulations in purified B cells was not so strongly elevated as those observed in splenocytes (Fig. 1). This suggests that there could be simultaneous up-regulations of TLR expressions by non-B cells (such as T cells) in cultured splenoctyes after treatments. Very interestingly, the binding of CpG to TLR9 resulted in not only activation of the TLR9 signaling but also the induction of TLR9 mRNA expression. These results indicate that activation of TLR9 signaling could be mainly achieved by CpG-induced TLR9 up-regulation in an autocrine manner.

As TLR4 expression on activated B cells from peripheral blood was reported up-regulated after CpG-ODN treatment in a human study (28), our results demonstrated that TLR4 expression was unchanged after stimulation with CpG-ODN in naïve rat spleen B cells. This could be derived from the difference of TLR expressions, the interaction between TLRs and the B cell activation status in human and rat B cells. Indeed, interdependence of multiple TLR expression has been identified and studies have also shown that TLR expression follows a specific timeline that may be dependent on the nature of the pathogen (29).

Our results demonstrated that CpG-ODN dramatically inhibited LPS-induced RANKL production in B cells. However, CpG alone did not inhibit RANKL expression or RANKL-positive cell formation. These results indicated that the reciprocal nature of TLR4 and TLR9 signaling within B cells may play a role in the innate immune responses to the infectious diseases. This has been demonstrated by the studies showing that activation of TLR9 with CpG-DNA inhibited LPS-mediated TLR4 signaling in enterocytes in a mechanism dependent upon the inhibitory molecule IRAK-M (30). Interestingly, recent studies demonstrated that following IRAK inhibition, LTA-stimulated increases of RANKL production were significantly reduced in periodontal ligament fibroblasts (31). It remains to be determined whether TLR9-derived RANKL production inhibition in B cells observed in our study is IRAK-dependent.

Our microarray analysis revealed EGFR expression was only up-regulated in cells treated with LPS and CpG-ODN but not in cells treated with LPS or CpG alone (Fig. 5B). It has been demonstrated that EGFR suppresses TNFSF6 activity (32–34) and enhancement of CDK inhibitors (35, 36). Furthermore, combined TLR4 and TLR9 activation also down-regulated PKCα activity, which inhibits MAP Kinase-mediated CDK activities (37, 38). Since CDK pathway is a master control of cell cycle and apoptosis (39, 40), we evaluated the cell viability by detecting early apoptotic cells after treatments. The percentage of AnnexinV+/7-AAD− cells was significantly increased in B cells treated with CpG ODN and E. coli LPS compared to control (Fig. 5C). These results suggested that the inhibitory effect of CpG-ODN on LPS-induced RANKL expression could be mediated partially by the inhibition of CDK pathway, leading to the reduction of RANKL-positive B cells through cell apoptosis (Fig. 5D).

Interestingly, both CDKI and IRAK-M have been implicated as a negative regulator of TLR signaling (41, 42). Previous studies have also demonstrated that different bacterial components regulate RANKL expression via different signaling pathways. LPS regulated RANKL expression via prostaglandin E(2) in bone marrow stromal cells (43) and cysteine proteases induced RANKL expression in osteoblasts through activator protein 1 (AP-1) signaling pathways (44). Further studies are warranted to fully delineate such specific pathway(s) in the control of RANKL-producing B cells. Therapeutic strategies based on control of RANKL-producing B cells, therefore, inhibition of B cell-mediated osteoclastogenesis, may be effective in preventing and/or reducing pathological bone resorption.

Acknowledgments

Human OPG-Fc fusion protein is kindly provided by Dr. Colin Dunstan from Amgen Inc., Thousand Oaks, CA. This work was supported by NIH Grant DE-003420 and DE-021837 from the National Institute of Dental and Craniofacial Research.

Abbreviations

TLR

toll-like receptor

CpG-ODN

CpG-oligodeoxynucleotide

LPS

lipopolysaccharide

RANKL

receptor activator of NF-κB ligand

CDK

cyclin-dependent kinase

CDKI

cyclin-dependent kinase inhibitor

EGFR

epidermal growth factor receptor

TNFSF6

tumor necrosis factor superfamily, member 6

PKCα

protein kinase C, alpha

Footnotes

Disclosure

The authors have no financial conflict of interest.

References

  • 1.Tew J, Engel D, Mangan D. Polyclonal B-cell activation in periodontitis. J Periodontal Res. 1989;24:225–241. doi: 10.1111/j.1600-0765.1989.tb01787.x. [DOI] [PubMed] [Google Scholar]
  • 2.Baker PJ, Evans RT, Roopenian DC. Oral infection with Porphyromonas gingivalis and induced alveolar bone loss in immunocompetent and severe combined immunodeficient mice. Arch Oral Biol. 1994;39:1035–1040. doi: 10.1016/0003-9969(94)90055-8. [DOI] [PubMed] [Google Scholar]
  • 3.Han X, Kawai T, Eastcott JW, Taubman MA. Bacterial-responsive B lymphocytes induce periodontal bone resorption. J Immunol. 2006;176:625–631. doi: 10.4049/jimmunol.176.1.625. [DOI] [PubMed] [Google Scholar]
  • 4.Choi Y, Woo KM, Ko SH, Lee YJ, Park SJ, Kim HM, Kwon BS. Osteoclastogenesis is enhanced by activated B cells but suppressed by activated CD8(+) T cells. Eur J Immunol. 2001;31:2179–2188. doi: 10.1002/1521-4141(200107)31:7<2179::aid-immu2179>3.0.co;2-x. [DOI] [PubMed] [Google Scholar]
  • 5.Kawai T, Matsuyama T, Hosokawa Y, Makihira S, Seki M, Karimbux NY, Goncalves RB, Valverde P, Dibart S, Li YP, Miranda LA, Ernst CW, Izumi Y, Taubman MA. B and T lymphocytes are the primary sources of RANKL in the bone resorptive lesion of periodontal disease. Am J Pathol. 2006;169:987–998. doi: 10.2353/ajpath.2006.060180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Onal M, Xiong J, Chen X, Thostenson JD, Almeida M, Manolagas SC, O'Brien CA. Receptor activator of nuclear factor kappaB ligand (RANKL) protein expression by B lymphocytes contributes to ovariectomy-induced bone loss. J Biol Chem. 2012;287:29851–29860. doi: 10.1074/jbc.M112.377945. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Pasare C, Medzhitov R. Control of B-cell responses by Toll-like receptors. Nature. 2005;438:364–368. doi: 10.1038/nature04267. [DOI] [PubMed] [Google Scholar]
  • 8.Pasare C, Medzhitov R. Toll-like receptors: linking innate and adaptive immunity. Adv Exp Med Biol. 2005;560:11–18. doi: 10.1007/0-387-24180-9_2. [DOI] [PubMed] [Google Scholar]
  • 9.Mauri C, Bosma A. Immune regulatory function of B cells. Annu Rev Immunol. 2012;30:221–241. doi: 10.1146/annurev-immunol-020711-074934. [DOI] [PubMed] [Google Scholar]
  • 10.Takeshita S, Arai S, Kudo A. Identification and characterization of mouse bone marrow stromal cell lines immortalized by temperature-sensitive SV40 T antigen: supportive activity for osteoclast differentiation. Bone. 2001;29:236–241. doi: 10.1016/s8756-3282(01)00505-1. [DOI] [PubMed] [Google Scholar]
  • 11.Xing Q, de Vos P, Faas MM, Ye Q, Ren Y. LPS promotes pre-osteoclast activity by up-regulating CXCR4 via TLR-4. J Dent Res. 2011;90:157–162. doi: 10.1177/0022034510379019. [DOI] [PubMed] [Google Scholar]
  • 12.Jung YO, Cho ML, Kang CM, Jhun JY, Park JS, Oh HJ, Min JK, Park SH, Kim HY. Toll-like receptor 2 and 4 combination engagement upregulate IL-15 synergistically in human rheumatoid synovial fibroblasts. Immunol Lett. 2007;109:21–27. doi: 10.1016/j.imlet.2006.12.006. [DOI] [PubMed] [Google Scholar]
  • 13.Kim KW, Cho ML, Lee SH, Oh HJ, Kang CM, Ju JH, Min SY, Cho YG, Park SH, Kim HY. Human rheumatoid synovial fibroblasts promote osteoclastogenic activity by activating RANKL via TLR-2 and TLR-4 activation. Immunol Lett. 2007;110:54–64. doi: 10.1016/j.imlet.2007.03.004. [DOI] [PubMed] [Google Scholar]
  • 14.Zou W, Amcheslavsky A, Bar-Shavit Z. CpG oligodeoxynucleotides modulate the osteoclastogenic activity of osteoblasts via Toll-like receptor 9. J Biol Chem. 2003;278:16732–16740. doi: 10.1074/jbc.M212473200. [DOI] [PubMed] [Google Scholar]
  • 15.Amcheslavsky A, Bar-Shavit Z. Interleukin (IL)-12 mediates the anti-osteoclastogenic activity of CpG-oligodeoxynucleotides. J Cell Physiol. 2006;207:244–250. doi: 10.1002/jcp.20563. [DOI] [PubMed] [Google Scholar]
  • 16.Ji JD, Park-Min KH, Shen Z, Fajardo RJ, Goldring SR, McHugh KP, Ivashkiv LB. Inhibition of RANK expression and osteoclastogenesis by TLRs and IFN-gamma in human osteoclast precursors. J Immunol. 2009;183:7223–7233. doi: 10.4049/jimmunol.0900072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Celenligil H, Kansu E, Ruacan S, Eratalay K, Caglayan G. Immunohistological analysis of gingival lymphocytes in adult periodontitis. J Clin Periodontol. 1990;17:542–548. [PubMed] [Google Scholar]
  • 18.Fanali S, Perrotti V, Riccardi L, Piattelli A, Piccirilli M, Ricci L, Artese L. Inflammatory infiltrate, microvessel density, vascular endothelial growth factor, nitric oxide synthase, and proliferative activity in soft tissues below intraorally welded titanium bars. J Periodontol. 2010;81:748–757. doi: 10.1902/jop.2010.090541. [DOI] [PubMed] [Google Scholar]
  • 19.Eastcott JW, Holmberg CJ, Dewhirst FE, Esch TR, Smith DJ, Taubman MA. Oligonucleotide containing CpG motifs enhances immune response to mucosally or systemically administered tetanus toxoid. Vaccine. 2001;19:1636–1642. doi: 10.1016/s0264-410x(00)00422-9. [DOI] [PubMed] [Google Scholar]
  • 20.Valverde P, Kawai T, Taubman MA. Selective blockade of voltage-gated potassium channels reduces inflammatory bone resorption in experimental periodontal disease. J Bone Miner Res. 2004;19:155–164. doi: 10.1359/JBMR.0301213. [DOI] [PubMed] [Google Scholar]
  • 21.Lacey DL, Timms E, Tan HL, Kelley MJ, Dunstan CR, Burgess T, Elliott R, Colombero A, Elliott G, Scully S, Hsu H, Sullivan J, Hawkins N, Davy E, Capparelli C, Eli A, Qian YX, Kaufman S, Sarosi I, Shalhoub V, Senaldi G, Guo J, Delaney J, Boyle WJ. Osteoprotegerin ligand is a cytokine that regulates osteoclast differentiation and activation. Cell. 1998;93:165–176. doi: 10.1016/s0092-8674(00)81569-x. [DOI] [PubMed] [Google Scholar]
  • 22.Ogasawara T, Yoshimine Y, Kiyoshima T, Kobayashi I, Matsuo K, Akamine A, Sakai H. In situ expression of RANKL, RANK, osteoprotegerin and cytokines in osteoclasts of rat periodontal tissue. J Periodontal Res. 2004;39:42–49. doi: 10.1111/j.1600-0765.2004.00699.x. [DOI] [PubMed] [Google Scholar]
  • 23.Shiotani A, Shibasaki Y, Sasaki T. Localization of receptor activator of NFkappaB ligand, RANKL, in periodontal tissues during experimental movement of rat molars. J Electron Microsc (Tokyo) 2001;50:365–369. doi: 10.1093/jmicro/50.4.365. [DOI] [PubMed] [Google Scholar]
  • 24.Vernal R, Dutzan N, Hernandez M, Chandia S, Puente J, Leon R, Garcia L, Del Valle I, Silva A, Gamonal J. High expression levels of receptor activator of nuclear factor-kappa B ligand associated with human chronic periodontitis are mainly secreted by CD4+ T lymphocytes. J Periodontol. 2006;77:1772–1780. doi: 10.1902/jop.2006.050376. [DOI] [PubMed] [Google Scholar]
  • 25.Jabbari K, Bernardi G. Cytosine methylation and CpG, TpG (CpA) and TpA frequencies. Gene. 2004;333:143–149. doi: 10.1016/j.gene.2004.02.043. [DOI] [PubMed] [Google Scholar]
  • 26.Weighardt H, Feterowski C, Veit M, Rump M, Wagner H, Holzmann B. Increased resistance against acute polymicrobial sepsis in mice challenged with immunostimulatory CpG oligodeoxynucleotides is related to an enhanced innate effector cell response. J Immunol. 2000;165:4537–4543. doi: 10.4049/jimmunol.165.8.4537. [DOI] [PubMed] [Google Scholar]
  • 27.Hornung V, Rothenfusser S, Britsch S, Krug A, Jahrsdorfer B, Giese T, Endres S, Hartmann G. Quantitative expression of toll-like receptor 1–10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides. J Immunol. 2002;168:4531–4537. doi: 10.4049/jimmunol.168.9.4531. [DOI] [PubMed] [Google Scholar]
  • 28.Shin H, Zhang Y, Jagannathan M, Hasturk H, Kantarci A, Liu H, Van Dyke TE, Ganley-Leal LM, Nikolajczyk BS. B cells from periodontal disease patients express surface Toll-like receptor 4. J Leukoc Biol. 2009;85:648–655. doi: 10.1189/jlb.0708428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Lorenz E. TLR2 and TLR4 expression during bacterial infections. Curr Pharm Des. 2006;12:4185–4193. doi: 10.2174/138161206778743547. [DOI] [PubMed] [Google Scholar]
  • 30.Su J, Xie Q, Wilson I, Li L. Differential regulation and role of interleukin-1 receptor associated kinase-M in innate immunity signaling. Cell Signal. 2007;19:1596–1601. doi: 10.1016/j.cellsig.2007.02.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Zhao L, Chen J, Cheng L, Wang X, Du J, Wang F, Peng Z. Effects of Enterococcus faecalis lipoteichoic acid on receptor activator of nuclear factor-kappaB ligand and osteoprotegerin expression in periodontal ligament fibroblasts. Int Endod J. 2013 doi: 10.1111/iej.12127. [DOI] [PubMed] [Google Scholar]
  • 32.Steinbach JP, Supra P, Huang HJ, Cavenee WK, Weller M. CD95-mediated apoptosis of human glioma cells: modulation by epidermal growth factor receptor activity. Brain Pathol. 2002;12:12–20. doi: 10.1111/j.1750-3639.2002.tb00418.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Yoshimoto Y, Imoto M. Induction of EGF-dependent apoptosis by vacuolar-type H(+)-ATPase inhibitors in A431 cells overexpressing the EGF receptor. Exp Cell Res. 2002;279:118–127. doi: 10.1006/excr.2002.5588. [DOI] [PubMed] [Google Scholar]
  • 34.Torgler R, Jakob S, Ontsouka E, Nachbur U, Mueller C, Green DR, Brunner T. Regulation of activation-induced Fas (CD95/Apo-1) ligand expression in T cells by the cyclin B1/Cdk1 complex. J Biol Chem. 2004;279:37334–37342. doi: 10.1074/jbc.M406913200. [DOI] [PubMed] [Google Scholar]
  • 35.Ichiba M, Miyazaki Y, Kitamura S, Kiyohara T, Shinomura Y, Matsuzawa Y. Epidermal growth factor inhibits the growth of TE8 esophageal cancer cells through the activation of STAT1. J Gastroenterol. 2002;37:497–503. doi: 10.1007/s005350200077. [DOI] [PubMed] [Google Scholar]
  • 36.N'Cho M, Brahmi Z. Evidence that Fas-induced apoptosis leads to S phase arrest. Hum Immunol. 2001;62:310–319. doi: 10.1016/s0198-8859(01)00214-2. [DOI] [PubMed] [Google Scholar]
  • 37.Chiariello M, Gomez E, Gutkind JS. Regulation of cyclin-dependent kinase (Cdk) 2 Thr-160 phosphorylation and activity by mitogen-activated protein kinase in late G1 phase. Biochem J. 2000;349(Pt 3):869–876. doi: 10.1042/bj3490869. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Wen-Sheng W. Protein kinase C alpha trigger Ras and Raf-independent MEK/ERK activation for TPA-induced growth inhibition of human hepatoma cell HepG2. Cancer Lett. 2006;239:27–35. doi: 10.1016/j.canlet.2005.07.034. [DOI] [PubMed] [Google Scholar]
  • 39.Besson A, Dowdy SF, Roberts JM. CDK inhibitors: cell cycle regulators and beyond. Dev Cell. 2008;14:159–169. doi: 10.1016/j.devcel.2008.01.013. [DOI] [PubMed] [Google Scholar]
  • 40.Schwartz GK. CDK inhibitors: cell cycle arrest versus apoptosis. Cell Cycle. 2002;1:122–123. doi: 10.4161/cc.1.2.115. [DOI] [PubMed] [Google Scholar]
  • 41.Zoubir M, Flament C, Gdoura A, Bahleda R, Litvinova E, Soumelis V, Conforti R, Viaud S, Soria JC, Kroemer G, Zitvogel L, Chaput N. An inhibitor of cyclin-dependent kinases suppresses TLR signaling and increases the susceptibility of cancer patients to herpesviridae. Cell Cycle. 2011;10:118–126. doi: 10.4161/cc.10.1.14445. [DOI] [PubMed] [Google Scholar]
  • 42.Nguyen HA, Rajaram MV, Meyer DA, Schlesinger LS. Pulmonary surfactant protein A and surfactant lipids upregulate IRAK-M, a negative regulator of TLR-mediated inflammation in human macrophages. Am J Physiol Lung Cell Mol Physiol. 2012;303:L608–L616. doi: 10.1152/ajplung.00067.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Reddi D, Bostanci N, Hashim A, Aduse-Opoku J, Curtis MA, Hughes FJ, Belibasakis GN. Porphyromonas gingivalis regulates the RANKL-OPG system in bone marrow stromal cells. Microbes Infect. 2008;10:1459–1468. doi: 10.1016/j.micinf.2008.08.007. [DOI] [PubMed] [Google Scholar]
  • 44.Okahashi N, Inaba H, Nakagawa I, Yamamura T, Kuboniwa M, Nakayama K, Hamada S, Amano A. Porphyromonas gingivalis induces receptor activator of NF-kappaB ligand expression in osteoblasts through the activator protein 1 pathway. Infect Immun. 2004;72:1706–1714. doi: 10.1128/IAI.72.3.1706-1714.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES