Abstract
The purpose of this study is to establish in vivo and in vitro models for studying lymphatic metastasis of squamous cell carcinoma (SCC). Three cell lines CAL-27, Tca-83, and HeLa were injected into the tongue of nude mice. Forty days after injection, we could isolate cells of 2 homologous cell lines LN-CAL-27 and LN-HeLa from lymph node metastasis lesions. Then, the homologous cell pairs were compared by the CCK-8 assay, wound healing assay, real-time PCR, western blot, and animal experiments. The results showed that all the three cell lines could be used to establish lymphatic metastasis animal models, and the lymphatic metastasis process was observed clearly. In addition, the homologous cell pairs performed differently from parent lines with respect to biological behavior and lymphatic metastasis-related gene and protein expression. In conclusion, CAL-27, Tca-83, and HeLa cells could be used to simulate the lymphatic metastasis process of oral cancer in vivo. Furthermore, the homologous cell pairs (CAL-27 and LN-CAL-27; HeLa and LN-HeLa) are potential tools for in vitro investigation of the mechanisms underlying metastasis.
Keywords: Oral cancer, lymphatic metastasis, animal model, oral lymphatic system, homologous cell pair
Introduction
Lymphatic metastasis is the most common metastatic route for some types of cancer, especially for SCC, which is most likely to invade the lymphatic system, spread to regional lymph nodes, and ultimately spread to other parts of the body [1,2]. SCC accounts for more than 90% of oral cancers [3], and its metastasis to lymph nodes is the major cause of mortality for this disease [4]. Despite advances in treatment, the 5-year survival rate of oral cancer still remains at 60% and has not improved significantly over the past several decades [5]. Furthermore, the 5-year survival rate is less than 28% in patients diagnosed with oral SCC with lymphatic metastasis [6].
In the past 10 years, along with identification of lymphatic specific markers [7], more attention has been paid to investigating the mechanism underlying lymphatic metastasis of SCC [8]. However, the mechanism still remains largely unknown because scientists lack a reliable model that can simulate the complicated process. In previous studies, researchers have used oral or footpad lymphatic systems to study lymphatic metastasis. Qiu et al. transplanted human tumor specimens into the tongues of nude mice, dissected the metastatic lymph nodes, and again transplanted the tissue into the tongues; the metastatic rate increased significantly in the fourth round [9]. Myers et al. injected Tu167 cells transfected with the green fluorescent protein gene into the tongues of nude mice; metastatic tumor cells from lymph nodes were harvested and again injected into the tongues of nude mice to identify the ability for metastasis [10]. Sano et al. used luciferase-transduced cells to inoculate the tongues of the nude mice [11] for improving detection of lymphatic metastasis.
In this study, we used 3 cell lines to establish a lymphatic metastasis animal model of oral cancer and for pathological analysis of the lymphatic metastasis process. In addition, we cultured 2 homologous cell pairs with differing biological behaviors, gene and protein expression, and metastatic rates.
Materials and methods
Cells and cell culture
The human oral tongue squamous cell line CAL-27 and cervical carcinoma cell line HeLa and their derivative homologous cell lines LN-CAL-27 and LN-HeLa were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM; Gibco), and the human oral tongue squamous cell line Tca-83 was maintained in RPMI-1640 (Gibco), supplemented with 10% fetal bovine serum (FBS; Hyclone), in a humidified 5% CO2 incubator at 37°C. Cells in mid-logarithmic growth (~75% confluence) were used for the following experiments. All the three cell lines were cultured carefully to prevent cross contamination.
Establishment of the SCC lymphatic metastasis animal model in nude mice
This study was approved by the Medical Ethical Committee of the Peking University School and Hospital of Stomatology (LA 2012-79). Six-week-old male nude mice (Vital River Laboratory Animal Technology Co. Ltd., Beijing, China) were placed under general anesthesia with 1% pentobarbital sodium (Sigma). SCC cells (5 × 106) were injected into the right side of the anterior third of the tongue (tongue group) and footpad (footpad group). Fifteen days after injection, a nutritious semi-liquid diet was provided to the tongue group to alleviate weight loss due to tumor growth in the tongue. After 40 days for the tongue group and 60 days for the footpad group, mice were sacrificed with an overdose of pentobarbital sodium, and the cervical and popliteal swollen lymph nodes were dissected and divided in half. One half was used in tissue culture to generate lymph node-derived homologous cell lines, and the other was fixed immediately with 4% paraformaldehyde for pathological analysis.
Detection of lymphatic metastatic foci
Swollen lymph nodes and primary tumors were embedded in wax for pathological analysis. Then, 4-μm-thick sections were mounted on slides for hematoxylin and eosin (HE) staining and immunohistochemical staining. After dewaxing, the slides were stained with HE or treated with 3% hydrogen peroxide for 10 min to block the endogenous peroxidase activity. Antigen retrieval was performed using a high pressure method (citrate, 0.01M, pH 6.0) for 3 min. The slides were incubated with the epithelial marker pan-cytokeratin (pan-CK; ready-to-use; Zhongshangoldenbrige Co. Ltd, Beijing, China, ZM-0067) in a humidified chamber overnight at 4°C, and they were incubated with horseradish peroxidase (HRP)-conjugated secondary antibody for 1 h at ambient temperature. After washing, the immunoreaction was followed by incubation with diaminobenzidine (DAB, Zhongshangoldenbrige Co. Ltd.) for 30 s. The slides were counterstained with hematoxylin, and images were recorded by an Olympus DP controller (Olympus, Japan).
Generation of lymph node-derived homologous cell lines
The swollen lymph nodes were cut into small fragments (less than 1 mm3) for tissue culture and cultured in a T25 flask with DMEM containing 10% FBS, at 37°C in a humidified 5% CO2 atmosphere. Single colony-derived cell lines were established and cultured continuously over 60 passages, and then identified by GoldeneyeTM 20A Short Tandem Repeat (STR) profiling.
Cell proliferation assay
Cell proliferation was measured in vitro with the CCK-8 assay (Dojindo). Briefly, 3 × 103 cells were plated into 96-well plates with 100 μL growth medium per well. Following overnight incubation, cells were cultured in DMEM containing 10% FBS or serum-free DMEM. Every 24 hours, 10 μL CCK-8 solution was added to each well, and the cultures were incubated for 2 h at 37°C. Color development was quantified photometrically at 450 nm using an ELx808 absorbance microplate reader (Bio TeK Instruments). All the experiments were performed in biological triplicates and were repeated at least 3 times.
Wound healing assay
Cells (5 × 105) were cultured as confluent monolayers and were wounded by scratching across the well with a 200 μL pipette tip. The deciduous cells were removed by D-Hanks. At 0, 24, and 48 h after wounding, the monolayers were photographed at 10 × magnification (Nikon, Japan) and the distance between the front of the removed cells on the wound was measured.
Real-time PCR
Total RNA was extracted from tumor cells using TRIzol reagent (Invitrogen). Complementary DNA was synthesized by reverse transcription with the GoScriptTM Reverse Transcription System (Promega). Relative quantitative PCR done using the SYBR Green master mix (Roche Diagnostics). All PCR reactions were performed in a 20 μL total volume containing 10 μL of SYBR Green PCR master mix, 50 ng cDNA, and 250 nM of each primer (Table 1). Relative expression of the target genes was calculated using the 2-ΔΔCt method.
Table 1.
The sequences of real-time PCR primers used in this study
| Gene | Forward primers | Reverse primers |
|---|---|---|
| CCL14 | GGGACCTTACCACCCCTCA | GCTGACGCGGGATCTTGTA |
| CCL15 | TCCCAGGCCCAGTTCATAAAT | TGCTTTGTGAGATGTAGGAGGT |
| CCL19 | CCAGCCCCAACTCTGAGTG | ATCCTTGATGAGAAGGTAGTGGA |
| CCL2 | GATCTCAGTGCAGAGGCTCG | TGCTTGTCCAGGTGGTCCAT |
| CCL21 | AGCCTCCTTATCCTGGTTCTG | ACAACCTTGGCGGGAATCTTC |
| CCL23 | ACTTCTGGACAGATTCCATGCT | CTTCGTGGGGTGTAGGAGATG |
| CCL27 | TCCTGAGCCCAGACCCTAC | CAGTTCCACCTGGATGACCTT |
| CCL28 | TGCACGGAGGTTTCACATCAT | ACAGATTCTTCTGCGCTTGAC |
| CXCL10 | GTGGCATTCAAGGAGTACCTC | GCCTTCGATTCTGGATTCAGACA |
| CXCL11 | TTGGCTGTGATATTGTGTGCT | GGATTTAGGCATCGTTGTCCTTT |
| CXCL12 | ATGCCCATGCCGATTCTTCG | GCCGGGCTACAATCTGAAGG |
| CXCL13 | TTGAGGTGTAGATGTGTCCAAGA | ATTCGATCAATGAAGCGTCTAGG |
| CXCL14 | GGACCCAAGATCCGCTACAG | TCCAGGCGTTGTACCACTTG |
| CXCL16 | CAGCGTCACTGGAAGTTGTTA | CACCGATGGTAAGCTCTCAGG |
| CXCL5 | GAGAGCTGCGTTGCGTTTG | TTTCCTTGTTTCCACCGTCCA |
| CXCL6 | AGAGCTGCGTTGCACTTGTT | GCAGTTTACCAATCGTTTTGGGG |
| CXCL9 | CCAGTAGTGAGAAAGGGTCGC | TGGGGCAAATTGTTTAAGGTCTT |
| CXCR1 | GCAGCTCCTACTGTTGGACA | GGGCATAGGCGATGATCACA |
| CXCR2 | AGCTGAGAATATGCAGCCGTT | GAGACCACCTTGCACAGGAA |
| CXCR4 | ATGAAGGAACCCTGTTTCCGT | AGATGATGGAGTAGATGGTGGG |
| HIF1α | ACTTGGCAACCTTGGATTGGA | GCACCAAGCAGGTCATAGGT |
| IL24 | TTGCCTGGGTTTTACCCTGC | AAGGCTTCCCACAGTTTCTGG |
| MMP-13 | TTTCAACGGACCCATACAGTTTG | CATGACGCGAACAATACGGTTA |
| MMP-14 | GAAGCCTGGCTACAGCAATATG | TGCAAGCCGTAAAACTTCTGC |
| MMP-16 | GCTGTGATGGACCAACAGACA | CCAAGATGCAGGGAATGACAA |
| MMP-25 | GACTGGCTGACTCGCTATGG | CGAACCTCTGCATGACTTTGATG |
| MMP-2 | GCCCCAGACAGGTGATCTTG | GCTTGCGAGGGAAGAAGTTGT |
| MMP-7 | CATGAGTGAGCTACAGTGGGA | CTATGACGCGGGAGTTTAACAT |
| MMP-9 | GCCCGACCCGAGCTGACTC | TTCAGGGCGAGGACCATAGAGG |
| periostin | GAAGGAATGAAAGGCTGCCCA | GAATCCAAGTTGTCCCAAGCC |
| S100A2 | GCCAAGAGGGCGACAAGTT | AGGAAAACAGCATACTCCTGGA |
| S100A4 | GATGAGCAACTTGGACAGCAA | CTGGGCTGCTTATCTGGGAAG |
| S100A5 | CACTATGGTGACCACGTTTCA | TCCCCAAGACACAGCTCTTTC |
| S100A9 | GGTCATAGAACACATCATGGAGG | GGCCTGGCTTATGGTGGTG |
| S100P | ATGACGGAACTAGAGACAGCC | AGGAAGCCTGGTAGCTCCTT |
| TNFα | GTGCTTGTTCCTCAGCCTCT | GCTTGTCACTCGGGGTTCGA |
| VEGF-A | GCAGAATCATCACGAAGTGG | GCAACGCGAGTCTGTGTTTTTG |
| VEGF-C | ACGTTCCCTGCCAGCAACAC | TCATCCAGCTCCTTGTTTGGTCC |
| VEGF-D | GTGCAGGGCTCCAGTAATGAAC | CCGATGGGATGCTGAGCGAG |
Western blot
Cells were lysed in RIPA buffer (Applygen Technologies, Beijing, China) with protease inhibitors (Applygen Technologies). 40 μg of protein was loaded onto a polyacrylamide gel for each sample. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (Applygen Technologies) and transferred to a polyvinylidene difluoride membrane. The membranes were blocked in 5% non-fat dry milk for 1 h and probed with antibodies against VEGF-C (1:1000 dilution, Abcam), VEGF-D (1:800, Abcam), VEGFR-3 (1:50, Abcam), MMP-2 (1:1000, Epitomics), MMP-9 (1:500, Epitomics), MMP-12 (1:1000, Epitomics), MMP-13 (1:1000, Epitomics), MMP-14 (1:1000, Epitomics), MMP-17 (1:1000, Epitomics), Bcl-2 (1:1000, Genetex), Bad (1:1000, Genetex), BID (1: 1000, Genetex), and GAPDH (1:1000, Santa Cruz Biotechnology) separately at 4°C overnight. After incubation with HRP-linked secondary antibodies, immunoreactive proteins were visualized with an enhanced chemiluminescence reagent (Applygen Technologies).
Statistical analysis
All results were evaluated with the SPSS 13.0 software. Data are expressed as mean ± SD and have been compared using the Student t tests or ANOVA, as appropriate. P < 0.05 was considered statistically significant.
Results
STR profiling analysis
The 20 gene foci in CAL-27 and LN-CAL-27 are mentioned as follows: [D19S433 (14, 15.2); D5S818 (11, 12); D21S11 (28, 29); D18S51 (13, 13); D6S1043 (12, 12); D3S1358 (16, 16); D13S317 (10, 11); D7S820 (10, 10); D16S539 (11, 12); CSF1PO (10, 12); PentaD (9, 10); Amelogenin (X, X); vWA (14, 17); D8S1179 (13, 15); TPOX (8, 8); PentaE (7, 7); TH01 (6; 9.3); D12S391 (18.3, 19.3); D2S1338 (23, 24); FGA (25, 25)]. All of the 20 gene foci were the same; therefore we concluded that both the cell lines originated from 1 patient. 9 of the gene foci were compared with the foci that provided by the American type culture collection (ATCC; CRL-2095) and results showed that the cells were not contaminated by others. The other cell lines Tca-83, HeLa, and LN-HeLa cells were also identified by STR analysis (data not shown). Results showed that Tca-83 was not contaminated by other cells. All of the 20 gene foci of HeLa and LN-HeLa cells were the same with each other and 9 of them were the same with the foci that ATCC provided.
Evidence for the valuable role of the oral lymphatic system in studying SCC lymphatic metastasis
To observe the process of lymphatic metastasis, CAL-27, Tca-83, and HeLa cells (5 × 105) were inoculated into the right side of mice tongue tips. A swollen neck lymph node was clearly observed at 40 d after tumor cell inoculation, and a small lump of white tumor tissue was enveloped in the lymph node (Figure 1A), which was removed and divided into half for cell culture and pathological analysis. Histopathological analysis by HE staining (Figure 1B-D) showed that all the 3 cell lines metastasized by spreading to the neck lymph node. To identify the metastatic Tca-83 cells, pan-CK tests were performed via immunostaining, and tumor cells strongly expressed pan-CK (Figure 1E). Two novel lymph node-derived homologous cell lines LN-CAL-27 and LN-HeLa were successfully generated from the primary culture of the enlarged neck lymph node (Figure 1F and 1G). In addition, HeLa cells (5 × 105) were injected into the footpads of 10 nude mice. However, no metastatic lymph node was detectable in the footpad group, even 60 d after inoculation (Figure 1H).
Figure 1.
Establishment of a lymphatic metastasis animal model and homologous cell pairs via the oral lymphatic system of nude mice. (A) A small white lump embedded in the swollen lymph node denotes lymphatic metastatic foci. (B) Metastatic CAL-27 cells, (C) HeLa cells, and (D) Tca-83 cells are visible in an HE-stained slide. (E) Immunostaining of pan-CK indicates the location of the metastatic Tca-83 cells. (F) LN-CAL-27 cells and (G) LN-HeLa cells were isolated from the neck lymph node metastatic tissue. (H) A swollen popliteal lymph node (black arrow) was found in the popliteal space at day 60 post inoculation. Tu, metastatic tumor cell.
Pathological observation of the lymphatic metastasis process
Serial section analysis showed that tumor cells could migrate into the neck lymph nodes by penetrating the lymphatic vessels. Initially, the wall of the lymphatic vessel containing tumor cells was integrated (Figure 2A). Gradually, the lymphatic vessel expanded significantly, and tumor cells invaded and migrated out of the lymphatic vessel. The wall of the lymphatic vessel adjacent to the lymph node center became poorly defined (Figure 2B). Ultimately, tumor cells penetrated the lymphatic vessel completely, and there was almost no clear boundary between the tumor cells in the lymphatic vessel and in the lymph node (Figure 2C).
Figure 2.
Serial sections illustrate the invasive process of tumor cells from the lymphatic vessel into the lymph node. A: Tumor cells in the lymphatic vessel. B: Tumor cells within the expanded lymphatic vessel invade the lymph node. C: Tumor cells invade the partial wall of the lymphatic vessel. Tu, metastatic tumor cell.
Lymph node-derived cells have higher proliferation, migration abilities than their parental cells
A CCK-8 assay was performed with complete medium culture (10% serum). The results showed that LN-CAL-27 and LN-HeLa cells had greater proliferative ability than their parental cells (Figure 3A).
Figure 3.
Comparison of biological behavior of homologous cell pairs. A: The OD value of the homologous cell pairs. B: Wound healing assay of CAL-27 and LN-CAL-27. C: Wound healing assay of HeLa and LN-HeLa. *, P < 0.05; **, P < 0.01.
Spontaneous cell migration was evaluated using the wound healing assay. The migration speeds of CAL-27 and LN-CAL-27 cells were 3.76 ± 0.32 μm/h versus 4.25 ± 0.11 μm/h at 24 h (P < 0.05) and 2.35 ± 0.10 μm/h versus 2.49 ± 0.31 μm/h at 48 h after wounding; while the HeLa and LN-HeLa cells were 2.43 ± 0.29 μm/h versus 3.82 ± 0.13 μm/h at 24 h (P < 0.01) and 2.00 ± 0.11 μm/h versus 2.69 ± 0.15 μm/h at 48 h (P < 0.01) after wounding, respectively. (Figure 3B & 3C).
Screening SCC lymphatic metastasis-associated genes via the homologous cell pairs by real-time PCR and western blot
To investigate the mechanism underlying SCC lymphatic metastasis, we screened 106 lymphatic metastasis-related genes, including the MMP, VEGF, S100, and chemokine gene families and others by real-time PCR. Fifteen genes in LN-CAL27 cells and 14 genes in LN-HeLa cells were expressed at higher levels than in the parental cell lines. Fifteen genes in both cell pairs showed decreased expression compared to the parental cell lines. Seventeen genes showed consistent expression between the 2 cell pairs (Table 2).
Table 2.
Differential expression of 30 genes between LN-CAL-27 and CAL-27 cells and 29 genes between LN-HeLa and HeLa cells
| LN-HeLa versus HeLa | LN-CAL-27 versus CAL-27 | ||||||
|---|---|---|---|---|---|---|---|
|
|
|
||||||
| Abbreviation | GenBank accession no. | Fold change | P-value | Abbreviation | GenBank accession no. | Fold change | P-value |
| Increased | Increased | ||||||
| CCL15 | NM_032965.4 | 4.0 | 0.036 | CCL15 | NM_032965.4 | 2.6 | 0.049 |
| CXCR2 | NM_001168298.1 | 2.5 | 0.025 | CXCR2 | NM_001168298.1 | 2.5 | 0.006 |
| CXCR4 | NM_003467.2 | 1.5 | 0.041 | CXCR4 | NM_003467.2 | 1.7 | 0.019 |
| HIF1α | NM_001243084.1 | 1.4 | 0.005 | HIF1α | NM_001243084.1 | 11.2 | 0.012 |
| MMP-2 | NM_001127891.1 | 1.7 | 0.049 | MMP-2 | NM_001127891.1 | 1.8 | 0.041 |
| MMP-7 | NM_002423.3 | 2.1 | 0.008 | MMP-7 | NM_002423.3 | 3.0 | 0.025 |
| MMP-13 | NM_002427.3 | 1.6 | 0.025 | MMP-13 | NM_002427.3 | 3.5 | 0.004 |
| MMP-14 | NM_004995.3 | 1.4 | 0.043 | MMP-14 | NM_004995.3 | 4.5 | 0.018 |
| VEGF-C | NM_005429.3 | 1.6 | 0.032 | VEGF-C | NM_005429.3 | 1.4 | 0.039 |
| MMP-9 | NM_004994.2 | 1.5 | 0.046 | VEGF-A | NM_001204385.1 | 4.0 | 0.003 |
| CCL2 | NM_002982.3 | 1.6 | 0.057 | CXCL5 | NM_002994.4 | 2.9 | 0.037 |
| CXCL14 | NM_004887.4 | 2.4 | 0.044 | CXCR1 | NM_000634.2 | 1.7 | 0.004 |
| IL24 | NM_001185158.1 | 2.2 | 0.043 | S100A2 | NM_005978.3 | 1.8 | 0.025 |
| Periostin | NM_006475.2 | 4.6 | 0.001 | S100A4 | NM_019554.2 | 1.3 | 0.031 |
| S100P | NM_005980.2 | 1.5 | 0.011 | ||||
| Decreased | Decreased | ||||||
| CCL14 | NM_032962.4 | 6.2 | 0.001 | CCL14 | NM_032962.4 | 4.2 | 0.065 |
| CXCL6 | NM_002993.3 | 7.7 | 0.021 | CXCL6 | NM_002993.3 | 4.4 | 0.023 |
| CXCL9 | NM_002416.1 | 16.3 | 0.009 | CXCL9 | NM_002416.1 | 3.3 | 0.016 |
| CXCL12 | NM_000609.6 | 4.5 | 0.043 | CXCL12 | NM_000609.6 | 4.6 | 0.023 |
| CXCL13 | NM_006419.2 | 13.3 | 0.025 | CXCL13 | NM_006419.2 | 1.5 | 0.049 |
| CXCL16 | NM_001100812.1 | 2.5 | 0.013 | CXCL16 | NM_001100812.1 | 1.4 | 0.027 |
| MMP-25 | NM_022468.4 | 1.7 | 0.017 | MMP-25 | NM_022468.4 | 5.8 | 0.045 |
| S100A5 | NM_002962.1 | 7.7 | 0.045 | S100A5 | NM_002962.1 | 2.5 | 0.019 |
| CCL27 | NM_006664.2 | 2.6 | 0.029 | CCL19 | NM_006274.2 | 5.7 | 0.004 |
| CCL28 | NM_148672.2 | 2.6 | 0.029 | CCL21 | NM_002989.3 | 7.6 | 0.029 |
| CXCL1 | NM_001511.3 | 10.7 | 0.055 | CCL23 | NM_145898.2 | 1.6 | 0.046 |
| CXCL5 | NM_002994.4 | 9.1 | 0.028 | CXCL14 | NM_004887.4 | 1.6 | 0.015 |
| CXCL10 | NM_001565.3 | 2.3 | 0.019 | MMP-16 | NM_005941.4 | 1.9 | 0.016 |
| CXCL11 | NM_005409.4 | 2.5 | 0.001 | TNFα | NM_000594.3 | 2.3 | 0.021 |
| S100A9 | NM_002965.3 | 14.1 | 0.007 | VEGF-D | NM_004469.4 | 4.3 | 0.025 |
Western blot results correlated with real-time PCR results for MMP-13 and MMP-14 expression in CAL-27 and LN-CAL-27 cells and for MMP-2, MMP-9, MMP-13, MMP-14, VEGF-C, and VEGFR-3 expression in HeLa and LN-HeLa cells (Figure 4).
Figure 4.
Expression of lymphatic metastasis-related proteins in the 2 homologous cell pairs.
Discussion
Lymph node metastasis is an important stage during the progression of some types of human malignancies, especially for SCC, and influences prognosis and therapeutic design. However, the mechanism underlying lymphatic metastasis remains largely unknown [12]. Given that regional lymph node metastasis is an initial step for SCC metastasis, if the early metastatic step could be controlled, cancer lymphatic metastasis might be avoidable in the future. Therefore, it is necessary to investigate the mechanism underlying cancer lymphatic metastasis. To our knowledge, one of the main obstacles in lymphatic metastasis research is the lack of reliable in vivo and in vitro lymphatic metastasis models. In this study, we confirmed that the oral lymphatic system is a reliable model for studying SCC lymphatic metastasis and that homologous cell pairs could be established for this system.
Transfected exogenous genes may affect the fate of modified tumor cells [13,14], leading to poor representation of the natural lymphatic metastasis process of tumor cells. Therefore, we used 3 natural SCC cell lines, CAL-27, Tca-83, and HeLa, to generate orthotopic and xenograft animal models for investigating the mechanism underlying SCC.
The lymphatic metastasis process is a complicated event. To our knowledge, the process could be observed and recorded in very few studies. In this study, we pathologically analyzed lymphatic metastasis. Our results indicate that SCC cells may invade the lymph node by breaking down the lymphatic vessels. Further studies will be required to investigate the mechanism underlying this process.
We established a lymphatic metastasis animal model via the oral lymphatic system and also isolated 2 lymph node metastatic cell lines, LN-CAL-27 and LN-HeLa, after selecting single colonies and culturing them over 60 passages. We compared the parental cell lines with their corresponding daughter cell lines by STR profiling analysis, cell proliferation, migration ability assays, animal experimentation, real-time PCR, and western blot. The results suggest that the cell pairs are homologous cells with different biological characteristics and lymphatic metastasis ability compared to the parent cell lines. The differential genes and gene products between the 2 homologous cell pairs include the MMP, VEGF, S100, and chemokine families and others (HIF1α, IL-24, periostin, TNFα). These molecular markers could be used to distinguish the daughter cell line from the parental cell line. The MMP and VEGF families are known to promote metastasis in most cancers [15-20]. Overexpression of MMPs could lead to degradation of the extracellular matrix and promote angiogenesis [19]. VEGFs could accelerate lymphangiogenesis and facilitate lymphatic metastasis [18]. The interaction of the chemokine family is complicated but important for the lymphatic metastasis [21]. The expression of chemokines was significantly different between the 2 homologous cell pairs; thus, they could be used as an in vitro research tool to study the mechanism underlying lymphatic metastasis. In this study, compared to CAL-27 cells, LN-CAL-27 cells exhibited higher expression of Bcl-2 and lower levels of Bad and BID. These results suggest that LN-CAL-27 cells are less likely to undergo apoptosis as Bcl-2 promotes apoptosis of cells while Bad and BID inhibit the antiapoptosis [22]. MMP-14 can activate MMP-2 protein, and this activity is involved in tumor invasion, which suggests that LN-CAL-27 and LN-HeLa may have better lymphatic metastasis ability than their corresponding parental cells. The expression of MMP-2 and VEGF-C was significantly different between HeLa and LN-HeLa cells but not between CAL-27 and LN-CAL-27 cells. In explanation, we believe that this is attributable to the fact that tumor cells are heterogeneous and behave differently depending on in vivo or in vitro conditions.
In conclusion, SCC lymphatic metastasis is an initial and complicated event during tumor spread. We used 3 cell lines to establish a lymphatic metastasis animal model for oral SCC. The lymphatic metastasis process was observed clearly on serial section analysis of the metastatic lymph node. The establishment of lymphatic metastasis homologous cell lines using the oral lymphatic system provides a good tool for investigating the cellular changes during the process of SCC lymphatic metastasis and the underlying molecular mechanisms. Further studies are required to determine the lymphatic metastasis mechanisms in the oral lymphatic system and in the lymphatic metastasis homologous cell lines.
Acknowledgements
The authors would like to thank Dr. Yan Gao for technical support in pathology and Professor Zhong Chen for critical reading of the manuscript. This study is supported by Natural Science Foundation of China (Grant No. 81341062).
Disclosure of conflict of interest
None.
References
- 1.Shayan R, Inder R, Karnezis T, Caesar C, Paavonen K, Ashton MW, Mann GB, Taylor GI, Achen MG, Stacker SA. Tumor location and nature of lymphatic vessels are key determinants of cancer metastasis. Clin Exp Metastasis. 2013;30:345–356. doi: 10.1007/s10585-012-9541-x. [DOI] [PubMed] [Google Scholar]
- 2.Beltramini GA, Massarelli O, Demarchi M, Copelli C, Cassoni A, Valentini V, Tullio A, Gianni AB, Sesenna E, Baj A. Is neck dissection needed in squamous-cell carcinoma of the maxillary gingiva, alveolus, and hard palate? A multicentre Italian study of 65 cases and literature review. Oral Oncol. 2012;48:97–101. doi: 10.1016/j.oraloncology.2011.08.012. [DOI] [PubMed] [Google Scholar]
- 3.Bagan J, Sarrion G, Jimenez Y. Oral cancer: clinical features. Oral Oncol. 2010;46:414–417. doi: 10.1016/j.oraloncology.2010.03.009. [DOI] [PubMed] [Google Scholar]
- 4.Amornphimoltham P, Rechache K, Thompson J, Masedunskas A, Leelahavanichkul K, Patel V, Molinolo A, Gutkind JS, Weigert R. Rab25 regulates invasion and metastasis in head and neck cancer. Clin Cancer Res. 2013;619:1375–88. doi: 10.1158/1078-0432.CCR-12-2858. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Zhang X, Liu Y, Gilcrease MZ, Yuan XH, Clayman GL, Adler-Storthz K, Chen Z. A lymph node metastatic mouse model reveals alterations of metastasis-related gene expression in metastatic human oral carcinoma sublines selected from a poorly metastatic parental cell line. Cancer. 2002;95:1663–1672. doi: 10.1002/cncr.10837. [DOI] [PubMed] [Google Scholar]
- 6.Lian IeB, Tseng YT, Su CC, Tsai KY. Progression of precancerous lesions to oral cancer: results based on the Taiwan National Health Insurance Database. Oral Oncol. 2013;49:427–430. doi: 10.1016/j.oraloncology.2012.12.004. [DOI] [PubMed] [Google Scholar]
- 7.Jackson DG. New molecular markers for the study of tumour lymphangiogenesis. Anticancer Res. 2001;21:4279–4283. [PubMed] [Google Scholar]
- 8.Mandriota SJ, Jussila L, Jeltsch M, Compagni A, Baetens D, Prevo R, Banerji S, Huarte J, Montesano R, Jackson DG, Orci L, Alitalo K, Christofori G, Pepper MS. Vascular endothelial growth factor-C-mediated lymphangiogenesis promotes tumour metastasis. EMBO J. 2001;20:672–682. doi: 10.1093/emboj/20.4.672. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Qiu C, Wu H, He H, Qiu W. A cervical lymph node metastatic model of human tongue carcinoma: Serial and orthotopic transplantation of histologically intact patient specimens in nude mice. J Oral Maxillofac Surg. 2003;61:696–700. doi: 10.1053/joms.2003.50139. [DOI] [PubMed] [Google Scholar]
- 10.Myers JN, Holsinger FC, Jasser SA, Bekele BN, Fidler IJ. An orthotopic nude mouse model of oral tongue squamous cell carcinoma. Clin Cancer Res. 2002;8:293–298. [PubMed] [Google Scholar]
- 11.Sano D, Myers JN. Metastasis of squamous cell carcinoma of the oral tongue. Cancer Metastasis Rev. 2007;26:645–662. doi: 10.1007/s10555-007-9082-y. [DOI] [PubMed] [Google Scholar]
- 12.Tammela T, Alitalo K. Lymphangiogenesis: Molecular mechanisms and future promise. Cell. 2010;140:460–476. doi: 10.1016/j.cell.2010.01.045. [DOI] [PubMed] [Google Scholar]
- 13.van Gaal EV, van Eijk R, Oosting RS, Kok RJ, Hennink WE, Crommelin DJ, Mastrobattista E. How to screen non-viral gene delivery systems in vitro? J Control Release. 2011;154:218–232. doi: 10.1016/j.jconrel.2011.05.001. [DOI] [PubMed] [Google Scholar]
- 14.Lv H, Zhang S, Wang B, Cui S, Yan J. Toxicity of cationic lipids and cationic polymers in gene delivery. J Control Release. 2006;114:100–109. doi: 10.1016/j.jconrel.2006.04.014. [DOI] [PubMed] [Google Scholar]
- 15.Lund AW, Duraes FV, Hirosue S, Raghavan VR, Nembrini C, Thomas SN, Issa A, Hugues S, Swartz MA. VEGF-C promotes immune tolerance in B16 melanomas and cross-presentation of tumor antigen by lymph node lymphatics. Cell Rep. 2012;1:191–199. doi: 10.1016/j.celrep.2012.01.005. [DOI] [PubMed] [Google Scholar]
- 16.Karnezis T, Shayan R, Caesar C, Roufail S, Harris NC, Ardipradja K, Zhang YF, Williams SP, Farnsworth RH, Chai MG, Rupasinghe TW, Tull DL, Baldwin ME, Sloan EK, Fox SB, Achen MG, Stacker SA. VEGF-D promotes tumor metastasis by regulating prostaglandins produced by the collecting lymphatic endothelium. Cancer Cell. 2012;21:181–195. doi: 10.1016/j.ccr.2011.12.026. [DOI] [PubMed] [Google Scholar]
- 17.Sugiura T, Inoue Y, Matsuki R, Ishii K, Takahashi M, Abe M, Shirasuna K. VEGF-C and VEGF-D expression is correlated with lymphatic vessel density and lymph node metastasis in oral squamous cell carcinoma: Implications for use as a prognostic marker. Int J Oncol. 2009;34:673–680. doi: 10.3892/ijo_00000193. [DOI] [PubMed] [Google Scholar]
- 18.Li B, Li F, Chi L, Zhang L, Zhu S. The expression of SPARC in human intracranial aneurysms and its relationship with MMP-2/-9. PLoS One. 2013;8:e58490. doi: 10.1371/journal.pone.0058490. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Kaimal R, Aljumaily R, Tressel SL, Pradhan RV, Covic L, Kuliopulos A, Zarwan C, Kim YB, Sharifi S, Agarwal A. Selective blockade of matrix metalloprotease-14 with a monoclonal antibody abrogates invasion, angiogenesis, and tumor growth in ovarian cancer. Cancer Res. 2013;73:2457–2467. doi: 10.1158/0008-5472.CAN-12-1426. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Asrani K, Keri RA, Galisteo R, Brown SA, Morgan SJ, Ghosh A, Tran NL, Winkles JA. The HER2- and heregulin β1 (HRG)-inducible TNFR superfamily member Fn14 promotes HRG-driven breast cancer cell migration, invasion, and MMP9 expression. Mol Cancer Res. 2013;11:393–404. doi: 10.1158/1541-7786.MCR-12-0542. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Franciszkiewicz K, Boissonnas A, Boutet M, Combadiere C, Mami-Chouaib F. Role of chemokines and chemokine receptors in shaping the effector phase of the antitumor immune response. Cancer Res. 2012;72:6325–6332. doi: 10.1158/0008-5472.CAN-12-2027. [DOI] [PubMed] [Google Scholar]
- 22.Shamas-Din A, Kale J, Leber B, Andrews DW. Mechanisms of action of Bcl-2 family proteins. Cold Spring Harb Perspect Biol. 2013;5:a008714. doi: 10.1101/cshperspect.a008714. [DOI] [PMC free article] [PubMed] [Google Scholar]