Skip to main content
Oxidative Medicine and Cellular Longevity logoLink to Oxidative Medicine and Cellular Longevity
. 2014 Apr 22;2014:283180. doi: 10.1155/2014/283180

Melatonin Therapy Prevents Programmed Hypertension and Nitric Oxide Deficiency in Offspring Exposed to Maternal Caloric Restriction

You-Lin Tain 1,2, Li-Tung Huang 1,3, Chien-Ning Hsu 4,5, Chien-Te Lee 6,*
PMCID: PMC4016897  PMID: 24864188

Abstract

Nitric oxide (NO) deficiency is involved in the development of hypertension, a condition that can originate early in life. We examined whether NO deficiency contributed to programmed hypertension in offspring from mothers with calorie-restricted diets and whether melatonin therapy prevented this process. We examined 3-month-old male rat offspring from four maternal groups: untreated controls, 50% calorie-restricted (CR) rats, controls treated with melatonin (0.01% in drinking water), and CR rats treated with melatonin (CR + M). The effect of melatonin on nephrogenesis was analyzed using next-generation sequencing. The CR group developed hypertension associated with elevated plasma asymmetric dimethylarginine (ADMA, a nitric oxide synthase inhibitor), decreased L-arginine, decreased L-arginine-to-ADMA ratio (AAR), and decreased renal NO production. Maternal melatonin treatment prevented these effects. Melatonin prevented CR-induced renin and prorenin receptor expression. Renal angiotensin-converting enzyme 2 protein levels in the M and CR + M groups were also significantly increased by melatonin therapy. Maternal melatonin therapy had long-term epigenetic effects on global gene expression in the kidneys of offspring. Conclusively, we attributed these protective effects of melatonin on CR-induced programmed hypertension to the reduction of plasma ADMA, restoration of plasma AAR, increase of renal NO level, alteration of renin-angiotensin system, and epigenetic changes in numerous genes.

1. Introduction

Hypertension might originate during early life. Maternal malnutrition can impair development, resulting in intrauterine growth restriction (IUGR), permanent structural changes, and disrupted physiological function—a phenomenon called “developmental programming” [1]. In the kidneys of both humans and experimental models, developmental programming reduces nephron numbers, alters the renin-angiotensin system (RAS), and impairs natriuresis, leading to adult kidney disease and hypertension [25].

A number of hypotheses have been proposed to explain the developmental programming phenomenon [6]. Oxidative stress is proposed as the underlying link between developmental programing and elevated risks of hypertension and kidney disease in adulthood [7, 8]. Asymmetric dimethylarginine (ADMA), an endogenous inhibitor of NO synthase (NOS), causes oxidative stress and is involved in the development of hypertension [9]. Our recent work demonstrated that an impaired ADMA-NO pathway and low nephron numbers are associated with programmed hypertension in the adult offspring of malnourished or diabetic mothers [10, 11]. Reduced nephron numbers impaired renal tubular sodium reabsorption, and the altered RAS components disrupted sodium retention, ultimately increasing blood pressure (BP) and inducing kidney damage. Histone deacetylases (HDACs) repress gene expression, a mechanism of epigenetic control that is involved in developmental programming. Class I HDACs are critical in nephrogenesis, particularly HDAC1-3 that are highly expressed in nephron precursors [12]. HDACs also play an important role in regulating RAS components during nephrogenesis [13]. These observations suggest that these mechanisms jointly lead to the development of hypertension and kidney disease.

Melatonin, an indoleamine produced from the pineal gland, is an antioxidant and free radical scavenger [14]. Experimental and human studies indicate that melatonin can regulate BP [10, 11]. We recently found that melatonin can prevent oxidative stress and hypertension concurrently in young spontaneously hypertensive rats (SHR) [15]. Emerging evidence supports novel roles of melatonin in epigenetic modulation through the regulation of HDACs [16, 17]. Thus, we examined whether melatonin prevented programmed hypertension in offspring exposed to maternal caloric restriction through reduction of oxidative stress, alteration of the RAS pathway, and modulation of HDACs. Moreover, we identified melatonin-induced gene changes during nephrogenesis and determined whether melatonin treatment induced global changes in biological processes by using next-generation sequencing.

2. Material and Methods

2.1. Animal Models

This study was carried out in strict accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Institutional Animal Care and Use Committee of the Kaohsiung Chang Gung Memorial Hospital. Virgin Sprague-Dawley (SD) rats (12–16 weeks old) were obtained from BioLASCO Taiwan Co., Ltd. (Taipei, Taiwan), and were housed and maintained in a facility accredited by the Association for Assessment and Accreditation of Laboratory Animal Care International. Male SD rats were caged with individual females until mating was confirmed. Calorie-restricted (CR) maternal rats received 11 g/d of a standard chow from day 11 of pregnancy until the day of delivery (day 23) and 20 g/d during the entire lactation period [10]. A subset of CR mothers was treated for the duration of the pregnancy with 0.01% melatonin dissolved in drinking water (CR + M, n = 8). The control group (n = 8) mothers had free access to standard rat chow. As another control, maternal rats were allowed free access to standard rat chow and were treated with 0.01% melatonin in drinking water (M, n = 10). After birth, each litter was left with the mother until weaning; pups were not weighed at birth to prevent maternal rejection. Male offspring, selected at random from each litter, were used in all subsequent experiments. In rats, nephrogenesis occurs predominantly from late gestation to 1-2 weeks postnatum and litters were typically weaned by postnatal week 3. Thus, melatonin was administered to mother rats for a total period of 6 weeks to cover the entire period of nephrogenesis. The dose of melatonin used was based on our previous study [15]. Water bottles were covered with aluminum foil to protect them from light. BP was measured in conscious rats by using an indirect tail-cuff method (BP-2000, Visitech Systems, Inc., Apex, NC, USA) after they had been systematically trained [10]. Three stable consecutive measures were taken and averaged. All offspring were sacrificed at 12 weeks of age and heparinized blood samples were collected. Kidneys were harvested after perfusion with PBS, divided into cortex and medulla regions, and snap-frozen. The activity of dimethylarginine dimethylaminohydrolase (DDAH), an ADMA-metabolizing enzyme, was measured using a colorimetric assay. The assay determined the rate of l-citrulline production and we performed the assay as previously described [18].

2.2. High-Performance Liquid Chromatography (HPLC)

Plasma and kidney l-arginine, l-citrulline, ADMA, and symmetric dimethylarginine (SDMA, a stereoisomer of ADMA) levels were measured using HPLC (HP series 1100, Agilent Technologies, Inc., Santa Clara, CA, USA) with the OPA-3MPA derivatization reagent as we described previously [10]. Standards contained l-arginine, l-citrulline, ADMA, and SDMA in the range of 1–100 μM, 1–100 μM, 0.5–5 μM, and 0.5–5 μM, respectively. The recovery rate was between 90 and 105%. The tissue concentration was factored for protein concentration, which was represented as μmol/mg protein. Plasma and urine creatinine (Cr) levels were analyzed by HPLC as described previously [10]. The creatinine clearance (CCr) was calculated by dividing the total amount of Cr excreted in urine by the Cr concentration in plasma. CCr values were normalized with respect to body weight.

2.3. Electron Paramagnetic Resonance (EPR)

Superoxide production was measured by EPR spectroscopy using a 1-hydroxy-3-carboxypyrrolidine (CPH) hydroxylamine spin probe, as we previously described [11]. The EPR spectra were recorded using an EMX Plus EPR spectrometer (Bruker BioSpin, Rheinstetten, Germany) equipped with an EMX-m40X microwave bridge operating at 9.87 GHz. NO was detected by EPR using N-methyl-D-glucamine dithiocarbamate (MGD) spin probe and FeSO4, as previously described [11]. The EPR spectra were recorded using an EMX Plus EPR spectrometer (Bruker BioSpin) equipped with an EMX-m40X microwave bridge operating at 3.16 GHz.

2.4. Metanephros Organ Culture

Metanephros organ culture was performed as we described previously [11]. Briefly, SD female rats of known mating date were anesthetized and laparotomized. Fetuses were aseptically removed, and metanephroi from fetuses at embryonic day 14 (E14) were collected and freed of exogenous tissue. Explants were placed onto a Steritop filter unit (Millipore, Billerica, MA, USA) floating on a defined serum-free medium and incubated for 6 d in 35 mm Petri dishes at 37°C in a humidified incubator (5% CO2). The defined medium was composed of Eagle's Minimum Essential Medium containing 10% (v/v) fetal calf serum, 100 units/mL penicillin, and 100 μg/mL streptomycin. All of these reagents were obtained from Sigma (St. Louis, MO, USA). The culture medium was changed daily, and no antibiotic or fungicide was present throughout the experiment. Fresh aliquots of each culture medium additive were used for each metanephros culture. The medium was changed daily. Metanephroi were treated with melatonin (1 μM and 1 mM) and harvested after 6 d for real-time polymerase chain reaction.

2.5. Quantitative Real-Time Polymerase Chain Reaction (PCR)

RNA was extracted as described previously [10]. Two-step quantitative real-time PCR was conducted using the QuantiTect SYBR Green PCR Kit (Qiagen, Valencia, CA, USA) and the iCycler iQ Multicolor Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). Nephron deficit was assessed by changes in the expression factors known to be involved in branching morphogenesis (BMP4, FGF2, and PAX2) and apoptosis (p53 and Bax). Several components of the RAS were analyzed including renin, prorenin receptor (PRR), angiotensinogen (AGT), angiotensin-converting enzyme (ACE), ACE2, angiotensin II type 1 (AT1R) and 2 receptor (AT2R), and angiotensin (1–7) MAS receptor. Class I HDACs, HDAC-1, -2, -3, and -8, were also examined. We used 18S rRNA (r18S) as a reference. Primers were designed using GeneTool Software (BioTools, Edmonton, Alberta, Canada) (Table 1). All samples were run in duplicate. To quantify the relative gene expression, the comparative threshold cycle (CT) method was employed. For each sample, the average CT value was subtracted from the corresponding average r18S value, calculating the ΔCT. ΔΔCT was calculated by subtracting the average control ΔCT value from the average experimental ΔCT. The fold-increase of the experimental sample relative to the control was calculated using the formula 2−ΔΔCT.

Table 1.

PCR primers sequences.

Gene Forward Reverse
Bax 5 ttgctgatggcaacttcaactg 3 5 ctttagtgcacagggccttgag 3
P53 5 catgagcgttgctctgatg 3 5 cagatactcagcatacggatttcc 3
PAX2 5 gagactcccagagtggtgtg 3 5 cattcccctgttctgatttg 3
FGF2 5 ccagttggtatgtggcactg 3 5 cagggaagggtttgacaaga 3
BMP4 5 gacttcgaggcgacacttctg 3 5 agccggtaaagatccctcatg 3
Renin 5 aacattaccagggcaactttcact 3 5 acccccttcatggtgatctg 3
Prorenin receptor 5 gaggcagtgaccctcaacat 3 5 ccctcctcacacaacaaggt 3
Angiotensinogen 5 gcccaggtcgcgatgat 3 5 tgtacaagatgctgagtgaggcaa 3
ACE 5 caccggcaaggtctgctt 3 5 cttggcatagtttcgtgaggaa 3
ACE2 5 acccttcttacatcagccctactg 3 5 tgtccaaaacctaccccacatat 3
AT1R 5 gctgggcaacgagtttgtct 3 5 cagtccttcagctggatcttca 3
AT2R 5 caatctggctgtggctgactt 3 5 tgcacatcacaggtccaaaga 3
MAS 5 catctctcctctcggctttgtg 3 5 cctcatccggaagcaaagg 3
HDAC-1 5 gaactggggacctacggg 3 5 gctcttgacaaattccacacac 3
HDAC-2 5 agttgcccttgattgtgaga 3 5 ccactgttgtccttggatttat 3
HDAC-3 5 tgatgaccagagttacaagcac 3 5 gggcaacatttc ggacag 3
HDAC-8 5 gctacccccggtttatatttacag 3 5 ttcgatcagagagtgaaccatactg 3
R18S 5 gccgcggtaattccagctcca 3 5 cccgcccgctcccaagatc 3

2.6. Western Blot

Western blot analysis was performed as previously described [10]. We used the following antibodies from Santa Cruz Biotechnology (Santa Cruz, CA, USA): rabbit polyclonal anti-rat PRR (1 : 500, overnight incubation), rabbit anti-rat ACE2 (1 : 1000, overnight incubation), rabbit anti-rat AT1R (1 : 250, overnight incubation), rabbit anti-rat AT2R (1 : 250, overnight incubation), and rabbit anti-rat MAS (1 : 1000, overnight incubation; Santa Cruz Biotechnology). The bands of interest were visualized using enhanced chemiluminescence reagent (PerkinElmer, Waltham, MA, USA) and quantified by densitometry (Quantity One Analysis software, Bio-Rad). Band density was calculated as the integrated optical density (IOD) minus the background value. The density of Ponceau red staining (PonS) was used to correct for variations in total protein loading. Protein abundance was calculated as IOD/PonS.

2.7. Next-Generation Sequencing and Analysis

In rats, nephrogenesis occurs predominantly from late gestation to 7–10 days postnatum. Thus, offspring from the control and M groups were sacrificed at 1 week of age. Kidneys were isolated and snap-frozen for whole-genome RNA next-generation sequencing (RNA-seq), performed by Welgene Biotech Co., Ltd. (Taipei, Taiwan). Purified RNA was quantified at 260 nm (OD600) by using ND-1000 spectrophotometer (Nanodrop Technology, Wilmington, DE, USA) and analyzed using a Bioanalyzer 2100 (Agilent Technology) with RNA 6000 LabChip kit (Agilent Technologies). All procedures were performed according to the Illumina protocol. For all samples, library construction was performed using the TruSeq RNA Sample Prep Kit v2 for ∼160 bp (single-end) sequencing and the Solexa platform. The sequence was directly determined by sequencing-by-synthesis technology using the TruSeq SBS Kit. Raw sequences were obtained using the Illumina GA Pipeline software CASAVA v1.8, which was expected to generate 10 million reads per sample. Quantification for gene expression was calculated as reads per kilobase of exon per million mapped reads [19]. For differential expression analysis, Cufflink v 2.1.1 and CummeRbund v 2.0.0 were used to perform statistical analyses of the gene expression profiles. The reference genome and gene annotations were retrieved from the Ensembl database (http://asia.ensembl.org/index.html). Gene ontology analysis for significant genes was performed using KEGG (http://www.genome.jp/kegg/) and NIH DAVID Bioinformatics Resources 6.7 (http://david.abcc.ncifcrf.gov/) to identify regulated biological themes.

2.8. Statistical Analysis

TheShapiro-Wilk normality test was used to determine which data were normally distributed. Normally distributed data are given as mean ± standard error of the mean. For most parameters, statistical analysis was performed using one-way analysis of variance (ANOVA) and Tukey's post hoc test for multiple comparisons. BP was analyzed by two-way repeated-measures ANOVA and Tukey's post hoc test. A P value < 0.05 was considered statistically significant. Analyses were performed using the Statistical Package for the Social Sciences (SPSS) software (Chicago, IL, USA).

3. Results

3.1. The Effects of Melatonin on Morphological and Biochemical Values in CR Rats

Litter sizes were not significantly altered by caloric restriction in the mother rat or by melatonin treatment. The amounts of water intake and urine output were not significantly different in the control and CR groups. Male pup mortality rates did not differ between the four groups analyzed. As shown in Table 2, the CR and M groups had lower and higher body weight (BW) than the control at 12 weeks of age, respectively, whereas the CR + M group had an intermediate BW. Kidney weight and kidney weight-to-BW ratio did not differ between the control and CR groups. Melatonin significantly increased kidney weight and kidney weight-to-BW ratio in the M and CR + M groups. Although heart weight was not different between control and CR groups, the heart weight-to-BW ratio was greater in the CR group. Melatonin caused increased heart weight and heart weight-to-BW ratio in the M group, but not in the CR + M group. CR increased systolic and diastolic BP and mean arterial pressure at 12 weeks of age. Melatonin therapy prevented these effects of CR. In addition, melatonin therapy reduced diastolic BP and mean arterial pressure in the M group compared to the control. As shown in Figure 1, mean arterial pressure was similar in the four groups at 4 weeks of age. By 8 weeks of age, mean arterial pressure had increased in the CR group relative to controls. A significant reduction in mean arterial pressure was measured in the M and CR + M groups versus the control at 8 and 12 weeks of age. In contrast, plasma creatinine level did not differ between the four groups. These data demonstrated that CR induced programmed hypertension but had no effect on renal function on 12-week-old offspring.

Table 2.

Morphological and biochemical values in different experimental groups.

Control CR M CR + M
n = 8 n = 8 n = 10 n = 8
Mortality 10% 0% 0% 0%
Body weight (BW) (g) 435 ± 14 356 ± 4* 489 ± 8∗# 370 ± 9∗$
Left kidney weight (g) 1.22 ± 0.06 1.01 ± 0.02 1.97 ± 0.05∗# 1.48 ± 0.03#$
Left kidney weight/100g BW 0.28 ± 0.01 0.28 ± 0.01 0.4 ± 0.01∗# 0.4 ± 0.01∗#
Heart weight (g) 1.23 ± 0.05 1.24 ± 0.02 1.63 ± 0.01∗# 1.16 ± 0.05$
Heart weight/100 g BW 0.28 ± 0.01 0.35 ± 0.01* 0.35 ± 0.01* 0.31 ± 0.01
Systolic blood pressure (mmHg) 162 ± 2 180 ± 2* 155 ± 1# 166 ± 1$
Diastolic blood pressure (mmHg) 122 ± 2 134 ± 3* 108 ± 2∗# 113 ± 1∗#
Mean arterial pressure (mmHg) 135 ± 2 149 ± 2* 124 ± 1∗# 131 ± 1#$
CCr, mL·min−1·kg body weight−1 9.12 ± 3.45 8.5 ± 3.0 7.34 ± 2.32 7.81 ± 2.76

CCr: clearance of creatinine; *P < 0.05 versus control; # P < 0.05 versus CR; $ P < 0.05 versus M.

Figure 1.

Figure 1

Effect of melatonin and caloric restriction (CR) on mean arterial pressure in male offspring at 12 weeks of age.  *P < 0.05 versus control; # P < 0.05 versus CR.

3.2. The Effects of Melatonin on l-Arginine, l-Citrulline, and Dimethylarginine Levels

As shown in Table 3, plasma levels of ADMA and SDMA were elevated nearly 70% and 150% following maternal CR, respectively. In contrast, the l-arginine levels and l-arginine-to-ADMA ratio were decreased by 30% and 55%, respectively. Melatonin treatment significantly increased l-arginine levels and l-arginine-to-ADMA ratio, but decreased ADMA and SDMA levels in the CR + M group. In the kidney, levels of l-citrulline, l-arginine, ADMA, and SDMA did not differ between the four groups. However, renal l-arginine-to-ADMA ratio was higher in the CR + M group versus the M group. We next analyzed superoxide and NO production in the kidney by using EPR. We found no difference in renal superoxide level among the four groups (control: 745 ± 28, CR: 823 ± 107, M: 665 ± 35, CR + M: 757 ± 42 arbitrary units; P > 0.05). CR significantly reduced renal NO levels, but not in the presence of melatonin (control: 412 ± 43, CR: 284 ± 18, M: 308 ± 34, CR + M: 414 ± 55 arbitrary units; control versus CR, P < 0.05; CR versus CR + M, P < 0.05).

Table 3.

L-Citrulline, L-arginine, and dimethylarginine levels in the plasma and kidney.

Control CR M CR + M
Plasma (μmol)
L-Citrulline 50 ± 4.1 61 ± 3.6 59.3 ± 5.1 55.8 ± 6.9
L-Arginine 121.1 ± 14 84.4 ± 2.4* 113.6 ± 8.7# 112.8 ± 13.6#
 ADMA 1.31 ± 0.1 2.21 ± 0.18* 1.18 ± 0.06# 1.08 ± 0.12#
 SDMA 0.66 ± 0.04 1.62 ± 0.27* 0.97 ± 0.09# 0.92 ± 0.08#
L-Arginine-to-ADMA ratio 92 ± 8 40 ± 4* 98 ± 10# 105 ± 6#
Kidney (μmol/mg protein)
L-Citrulline 52.5 ± 8.6 53.1 ± 4.6 97.6 ± 8.4 68.8 ± 12.4
L-Arginine 425 ± 62.3 552.9 ± 58.9 522.8 ± 61.6 488.1 ± 56
 ADMA 5.09 ± 0.88 6.33 ± 0.71 6.72 ± 1.03 4.84 ± 0.61
 SDMA 4.3 ± 0.65 5.3 ± 0.51 5.57 ± 0.79 4.59 ± 0.73
L-Arginine-to-ADMA ratio 86 ± 4 89 ± 5 80 ± 4 103 ± 8$

*P < 0.05 versus control; # P < 0.05 versus CR; $ P < 0.05 versus M.

3.3. The Effects of Melatonin on the ADMA Pathway

Next, we examined the expression/activity of proteins involved in the ADMA pathway. We found that renal level of protein arginine N-methyltransferase 1 (PRMT-1), an ADMA-synthesizing enzyme, was significantly lower in the M and CR + M groups than that in control and CR groups (Figure 2(b)). However, protein levels of DDAH-1 and -2, ADMA-metabolizing enzymes, in the kidney were not different between the four groups (Figures 2(c) and 2(d)). We found that renal DDAH activity did not differ between control and CR groups (Figure 2(e)). However, melatonin increased renal DDAH activity in both the M and CR + M groups. Thus, we speculate that the increase of systemic ADMA observed with CR is due to excessive synthesis or decreased metabolism in extrarenal tissues. On the other hand, the reduced plasma ADMA levels in response to melatonin might be due to decreased ADMA synthesis and increased ADMA breakdown in the kidney.

Figure 2.

Figure 2

Representative western blots (a) showing protein arginine methyltransferase 1 (PRMT-1; ∼42 kDa), dimethylarginine dimethylaminohydrolase 1 (DDAH-1; ∼34 kDa), and DDAH-2 (∼30 kDa) bands in CR offspring at 12 weeks of age. Relative abundance of renal cortical (b) PRMT-1, (c) DDAH-1, and (d) DDAH-2. (e) Effect of melatonin and CR on renal DDAH activity in male offspring at 12 weeks of age. *P < 0.05 versus control; # P < 0.05 versus CR.

3.4. The Effects of Melatonin on Nephrogenesis

We investigated whether changes in nephrogenesis- or apoptosis-related gene expression were associated with CR-induced reduced nephron numbers, as we found previously [10]. Consistent with our previous report [10], renal expression of p53 and the proapoptotic factor Bax did not differ between the control and CR groups (Figure 3(a)). Similarly, growth factors BMP4 and FGF2 were unaltered by CR or melatonin in the kidney. However, melatonin significantly increased the expression of the transcriptional activator PAX2 in CR + M group compared to controls (Figure 3(a)).

Figure 3.

Figure 3

Effect of melatonin and CR on the expression of (a) apoptosis- and nephrogenesis-related genes, (b) sodium transporters, (c) renin-angiotensin system (RAS) components, and (d) class I histone deacetylase (HDAC) in the kidney at 12 weeks of age. *P < 0.05 versus control; # P < 0.05 versus CR; $ P < 0.05 versus M.

3.5. The Effects of Melatonin on Sodium Transporters, RAS, and HDACs

Next, we evaluated two critical pathways involved in hypertension, sodium transporters and RAS components. We found that CR upregulated sodium-hydrogen exchanger 3 (NHE3) expression in the kidney (Figure 3(b)). The increase in renal NHE3 expression was not prevented by melatonin therapy. CR had no effect on the expression of RAS genes in the kidney, including renin, PRR, AGT, ACE, ACE2, AT1R, AT2R, and MAS (Figure 3(c)). Melatonin treatment, on the other hand, upregulated renal expression of renin, PRR, and ACE2 in the CR + M group compared to the control. Because melatonin therapy prevented the elevation of BP in offspring exposed to maternal CR, our data suggested that the antihypertensive effect of melatonin was related to renin, PRR, and ACE2 expression in the CR model. We found that CR did not alter renal expression of class I HDACs in the CR versus control group (Figure 3(d)). However, melatonin therapy increased HDAC-2, -3, and -8 expression in the kidney.

We analyzed the renal protein levels of PRR, ACE2, AT1R, AT2R, and MAS. Melatonin therapy significantly increased renal PRR and ACE2 protein levels in the M and CR + M group compared with the control and CR groups (Figures 4(b) and 4(c)). We observed that renal AT1R, AT2R, and MAS protein levels did not differ among the four groups (Figures 4(d)4(f)).

Figure 4.

Figure 4

Representative western blots (a) showing prorenin receptor (PRR; 39 kDa), angiotensin-converting enzyme (ACE2; 50 kDa), angiotensin II type 1 (AT1R; 43 kDa) and type 2 (AT2R; 90 kDa), and MAS (37 kDa) proteins in male offspring kidneys at 12 weeks of age. Relative abundance of renal (b) PRR, (c) ACE2, (d) AT1R, (e) AT2R, and (f) MAS is quantified. *P < 0.05 versus control; # P < 0.05 versus CR.

We also determined whether melatonin regulated nephrogenesis-related genes, RAS components, sodium transporters, and HDACs during nephrogenesis. The mRNA levels in rat metanephroi grown in different concentrations of melatonin are shown in Figure 5. We found that low doses of melatonin had no effect on the expression of these genes, whereas high-dose melatonin treatment significantly increased expression of PAX2, renin, PRR, Mas, NHE3, and Na-K-Cl cotransporter 2 in metanephroi.

Figure 5.

Figure 5

Gene expression of (a) apoptosis- and nephrogenesis-related genes, (b) RAS components, and (c) sodium transporters in the metanephroi of offspring from mothers treated with melatonin (1 μM or 1 mM). *P < 0.05 versus control (n = 5/group).

3.6. The Effects of Melatonin on Gene Expression during Nephrogenesis

We demonstrated that numerous individual genes were significantly regulated in the kidneys of offspring from melatonin-treated mothers during a critical period of renal development. As shown in Table 4, 439 and 15 genes were upregulated and downregulated, respectively. The most significantly regulated biological theme in the KEGG gene ontology analysis was tryptophan metabolism (Figure 6).

Table 4.

Genes that changed by RPKM > 0.3 in the kidney of melatonin treated offspring versus control at 1 week of age.

Gene_ID Gene symbol Fold changes Log2 P value
Upregulated: 439 genes
ENSRNOG00000038989 D3ZSD6_RAT 28.686 4.842 0.0083
ENSRNOG00000006367 Slc5a8 19.264 4.268 0.0001
ENSRNOG00000003038 Sft2d2 17.101 4.096 0.0020
ENSRNOG00000007720 F1LX97_RAT 13.841 3.791 0.0027
ENSRNOG00000019014 Ndst1 12.657 3.662 0.0003
ENSRNOG00000017434 Mgat3 12.364 3.628 0.0005
ENSRNOG00000001656 Kcnj15 11.724 3.551 0.0028
ENSRNOG00000021292 11.449 3.517 0.0015
ENSRNOG00000017078 Sepn1 11.107 3.473 0.0011
ENSRNOG00000030121 Enpep 10.970 3.456 0.0029
ENSRNOG00000005854 Angpt1 10.920 3.449 0.0165
ENSRNOG00000009944 LOC314407 10.858 3.441 0.0017
ENSRNOG00000013279 Scd 10.775 3.430 0.0012
ENSRNOG00000001724 LOC678704 10.690 3.418 0.0011
ENSRNOG00000002463 LOC682752 10.633 3.411 0.0033
ENSRNOG00000011630 Ak3l1 10.304 3.365 0.0441
ENSRNOG00000005447 RGD1311564 10.117 3.339 0.0026
ENSRNOG00000009019 Slc6a6 10.090 3.335 0.0016
ENSRNOG00000002969 Itpkb 9.892 3.306 0.0020
ENSRNOG00000037307 Spata22 9.876 3.304 0.0036
ENSRNOG00000039717 Ipo11 9.584 3.261 0.0069
ENSRNOG00000025372 Glce 9.536 3.253 0.0023
ENSRNOG00000037884 Oxgr1 9.510 3.249 0.0169
ENSRNOG00000021203 Atl3 9.487 3.246 0.0056
ENSRNOG00000006787 Dhcr24 9.328 3.222 0.0023
ENSRNOG00000015038 Adam10 9.279 3.214 0.0005
ENSRNOG00000002519 Magt1 9.253 3.210 0.0010
ENSRNOG00000038933 D3ZF12_RAT 9.225 3.206 0.0023
ENSRNOG00000024757 RGD1310444 9.119 3.189 0.0066
ENSRNOG00000030285 Epha3 9.064 3.180 0.0032
ENSRNOG00000018338 Vwa1 9.017 3.173 0.0355
ENSRNOG00000022802 Tmem184b 8.982 3.167 0.0070
ENSRNOG00000013265 Tgfbr2 8.947 3.161 0.0014
ENSRNOG00000026941 Tril 8.934 3.159 0.0024
ENSRNOG00000020532 Kcnq1 8.904 3.154 0.0441
ENSRNOG00000018503 LOC293190 8.862 3.148 0.0172
ENSRNOG00000002198 LOC685352 8.711 3.123 0.0037
ENSRNOG00000017172 Fam125b 8.706 3.122 0.0291
ENSRNOG00000018554 8.663 3.115 0.0067
ENSRNOG00000013963 IL6RB_RAT 8.571 3.099 0.0023
ENSRNOG00000042565 8.547 3.095 0.0114
ENSRNOG00000032834 Hspa13 8.544 3.095 0.0011
ENSRNOG00000002355 Slc47a1 8.474 3.083 0.0025
ENSRNOG00000011927 SDC3_RAT 8.460 3.081 0.0065
ENSRNOG00000042540 Mef2a 8.454 3.080 0.0368
ENSRNOG00000029216 Dgcr2 8.331 3.059 0.0175
ENSRNOG00000023725 LOC689756 8.215 3.038 0.0191
ENSRNOG00000028129 Fktn 8.207 3.037 0.0063
ENSRNOG00000000547 Tspyl4 8.202 3.036 0.0103
ENSRNOG00000011859 Eif5a2 8.192 3.034 0.0403
ENSRNOG00000028387 E9PTK5_RAT 8.168 3.030 0.0197
ENSRNOG00000015986 Rassf8 8.134 3.024 0.0094
ENSRNOG00000029409 Gstm6l 8.062 3.011 0.0292
ENSRNOG00000008895 Hnf4a 7.993 2.999 0.0398
ENSRNOG00000038149 Defb9 7.948 2.991 0.0437
ENSRNOG00000040287 Cyp1b1 7.890 2.980 0.0439
ENSRNOG00000010468 Elovl6 7.871 2.977 0.0394
ENSRNOG00000014524 F1M9D3_RAT 7.828 2.969 0.0077
ENSRNOG00000014209 Utp6 7.793 2.962 0.0050
ENSRNOG00000013419 Agphd1 7.789 2.961 0.0031
ENSRNOG00000020653 S1pr2 7.775 2.959 0.0313
ENSRNOG00000018714 Arl5b 7.770 2.958 0.0078
ENSRNOG00000002408 Rbm47 7.719 2.948 0.0057
ENSRNOG00000008971 Hnf4g 7.715 2.948 0.0085
ENSRNOG00000011271 Mcc 7.688 2.943 0.0120
ENSRNOG00000002276 LOC100359714 7.641 2.934 0.0073
ENSRNOG00000009446 Rxra 7.607 2.927 0.0066
ENSRNOG00000019400 Dag1 7.591 2.924 0.0010
ENSRNOG00000013098 F1M9J1_RAT 7.581 2.922 0.0320
ENSRNOG00000014511 Alg10 7.551 2.917 0.0076
ENSRNOG00000012490 Amph 7.533 2.913 0.0461
ENSRNOG00000014934 Fam63b 7.481 2.903 0.0193
ENSRNOG00000039630 LOC290577 7.414 2.890 0.0045
ENSRNOG00000032707 Egf 7.368 2.881 0.0017
ENSRNOG00000015605 Ptprk 7.357 2.879 0.0298
ENSRNOG00000000168 Gatm 7.311 2.870 0.0017
ENSRNOG00000027097 F1M683_RAT 7.273 2.863 0.0087
ENSRNOG00000018109 Clic4 7.251 2.858 0.0048
ENSRNOG00000008629 Secisbp2l 7.236 2.855 0.0042
ENSRNOG00000019799 Pcdhgc3 7.231 2.854 0.0246
ENSRNOG00000024089 Fndc3b 7.221 2.852 0.0065
ENSRNOG00000015852 D4AD82_RAT 7.192 2.846 0.0020
ENSRNOG00000006967 Xiap 7.151 2.838 0.0136
ENSRNOG00000031487 F1LM52_RAT 7.129 2.834 0.0477
ENSRNOG00000014866 Pign 7.077 2.823 0.0190
ENSRNOG00000033206 Entpd5 7.060 2.820 0.0070
ENSRNOG00000037753 Slc10a2 7.002 2.808 0.0089
ENSRNOG00000040195 F1LZT0_RAT 7.001 2.808 0.0018
ENSRNOG00000042817 D4A5M8_RAT 6.925 2.792 0.0104
ENSRNOG00000005070 Spopl 6.920 2.791 0.0139
ENSRNOG00000006459 D4AEA4_RAT 6.871 2.781 0.0251
ENSRNOG00000012784 Gtf3c4 6.850 2.776 0.0096
ENSRNOG00000016968 Gramd4 6.838 2.774 0.0216
ENSRNOG00000004448 RGD1307051 6.819 2.770 0.0050
ENSRNOG00000021809 Gpx3 6.801 2.766 0.0008
ENSRNOG00000014183 Gnaq 6.801 2.766 0.0084
ENSRNOG00000012991 LOC100363275 6.798 2.765 0.0046
ENSRNOG00000013443 Tm9sf3 6.791 2.764 0.0040
ENSRNOG00000042673 LOC100359544 6.789 2.763 0.0012
ENSRNOG00000003873 Cpd 6.767 2.758 0.0028
ENSRNOG00000007990 Adipor2 6.762 2.758 0.0026
ENSRNOG00000007804 C1galt1 6.762 2.757 0.0109
ENSRNOG00000043256 D3ZNR8_RAT 6.720 2.749 0.0145
ENSRNOG00000015124 Gpam 6.720 2.748 0.0109
ENSRNOG00000004888 Spred2 6.690 2.742 0.0454
ENSRNOG00000003960 Tmem27 6.682 2.740 0.0026
ENSRNOG00000015750 Wnt7b 6.654 2.734 0.0218
ENSRNOG00000030763 Dpp4 6.601 2.723 0.0011
ENSRNOG00000039504 Q5M885_RAT 6.562 2.714 0.0116
ENSRNOG00000032768 D3Z9G8_RAT 6.497 2.700 0.0214
ENSRNOG00000039771 LOC100361629 6.494 2.699 0.0140
ENSRNOG00000009274 Fut11 6.475 2.695 0.0354
ENSRNOG00000027938 RGD1562037 6.420 2.683 0.0117
ENSRNOG00000001335 Zkscan1 6.419 2.682 0.0077
ENSRNOG00000004978 Prkacb 6.379 2.673 0.0216
ENSRNOG00000005446 Gna11 6.363 2.670 0.0172
ENSRNOG00000003884 Acmsd 6.362 2.669 0.0262
ENSRNOG00000028190 D4ACF8_RAT 6.354 2.668 0.0432
ENSRNOG00000006338 Lrp6 6.351 2.667 0.0041
ENSRNOG00000009523 Rab11fip2 6.345 2.666 0.0470
ENSRNOG00000003759 Galc 6.345 2.666 0.0140
ENSRNOG00000010620 NDC1_RAT 6.319 2.660 0.0275
ENSRNOG00000001821 Adipoq 6.306 2.657 0.0244
ENSRNOG00000038572 RGD1562646 6.293 2.654 0.0106
ENSRNOG00000026120 Fam8a1 6.282 2.651 0.0129
ENSRNOG00000025476 RGD1359349 6.243 2.642 0.0126
ENSRNOG00000019508 Wars2 6.216 2.636 0.0317
ENSRNOG00000008271 Fam91a1 6.216 2.636 0.0031
ENSRNOG00000017120 Abhd2 6.208 2.634 0.0278
ENSRNOG00000010843 Nhlrc3 6.203 2.633 0.0255
ENSRNOG00000030704 F1LV74_RAT 6.139 2.618 0.0369
ENSRNOG00000002509 Gnl3l 6.129 2.616 0.0124
ENSRNOG00000010841 Col8a2 6.089 2.606 0.0457
ENSRNOG00000002728 Btc 6.088 2.606 0.0348
ENSRNOG00000027320 Eif2c1 6.082 2.605 0.0243
ENSRNOG00000009453 Mobkl2b 6.072 2.602 0.0271
ENSRNOG00000007797 Rbpsuh 6.069 2.602 0.0133
ENSRNOG00000017286 HYES_RAT 6.064 2.600 0.0032
ENSRNOG00000002461 Nid1 6.057 2.599 0.0014
ENSRNOG00000006649 Thrb 6.048 2.596 0.0180
ENSRNOG00000025042 Pde3a 6.048 2.596 0.0189
ENSRNOG00000015916 Ttc38 6.048 2.596 0.0384
ENSRNOG00000013581 Extl3 6.038 2.594 0.0093
ENSRNOG00000002332 MSPD1_RAT 6.034 2.593 0.0213
ENSRNOG00000032757 D3Z903_RAT 6.032 2.593 0.0431
ENSRNOG00000029651 Rdh2 6.025 2.591 0.0258
ENSRNOG00000018588 Sox4 6.019 2.590 0.0342
ENSRNOG00000012428 Maf 6.005 2.586 0.0483
ENSRNOG00000009506 Mre11a 6.005 2.586 0.0332
ENSRNOG00000028330 5.987 2.582 0.0375
ENSRNOG00000034025 D4A4T5_RAT 5.979 2.580 0.0227
ENSRNOG00000007079 Met 5.979 2.580 0.0117
ENSRNOG00000008088 Btbd3 5.979 2.580 0.0181
ENSRNOG00000017546 Mylk3 5.945 2.572 0.0224
ENSRNOG00000042333 Dnal1 5.895 2.559 0.0187
ENSRNOG00000001092 Kl 5.873 2.554 0.0106
ENSRNOG00000016498 5.836 2.545 0.0049
ENSRNOG00000037765 Lims1 5.833 2.544 0.0367
ENSRNOG00000010267 Klhdc10 5.827 2.543 0.0346
ENSRNOG00000043277 D3ZIC7_RAT 5.809 2.538 0.0206
ENSRNOG00000024799 D3ZNV9_RAT 5.803 2.537 0.0032
ENSRNOG00000004919 Gns 5.795 2.535 0.0282
ENSRNOG00000015080 Wdfy1 5.766 2.528 0.0292
ENSRNOG00000009565 Pdk4 5.764 2.527 0.0206
ENSRNOG00000013082 LCAP_RAT 5.754 2.525 0.0322
ENSRNOG00000026501 Slc6a19 5.742 2.522 0.0406
ENSRNOG00000009597 Cyp4a1 5.740 2.521 0.0123
ENSRNOG00000011560 Mtmr9 5.738 2.521 0.0368
ENSRNOG00000022710 Prrg4 5.736 2.520 0.0269
ENSRNOG00000013469 LOC100362805 5.715 2.515 0.0059
ENSRNOG00000024640 RGD1304731 5.698 2.510 0.0080
ENSRNOG00000018952 Sema3g 5.692 2.509 0.0143
ENSRNOG00000020011 Q66HF5_RAT 5.677 2.505 0.0381
ENSRNOG00000012826 Creb3l2 5.665 2.502 0.0189
ENSRNOG00000032492 Usp22 5.657 2.500 0.0107
ENSRNOG00000021840 LOC500046 5.644 2.497 0.0118
ENSRNOG00000034026 Lclat1 5.642 2.496 0.0223
ENSRNOG00000009153 Cidec 5.642 2.496 0.0432
ENSRNOG00000028899 Zbtb33 5.633 2.494 0.0168
ENSRNOG00000001766 Tfrc 5.613 2.489 0.0102
ENSRNOG00000017901 Acy3 5.613 2.489 0.0044
ENSRNOG00000012095 Pkia 5.596 2.484 0.0339
ENSRNOG00000001796 Dgkg 5.573 2.479 0.0471
ENSRNOG00000004958 RGD1304605 5.563 2.476 0.0100
ENSRNOG00000025587 Plagl1 5.550 2.472 0.0289
ENSRNOG00000027540 Fam102b 5.536 2.469 0.0410
ENSRNOG00000001518 Itga6 5.519 2.465 0.0452
ENSRNOG00000032723 Eftud1 5.515 2.463 0.0336
ENSRNOG00000002053 F1M3H3_RAT 5.491 2.457 0.0081
ENSRNOG00000003472 Atp11c-ps1 5.473 2.452 0.0317
ENSRNOG00000003984 Apln 5.448 2.446 0.0337
ENSRNOG00000012453 RGD1564560 5.438 2.443 0.0046
ENSRNOG00000017846 Slc44a1 5.422 2.439 0.0293
ENSRNOG00000016921 Klhl11 5.418 2.438 0.0275
ENSRNOG00000026415 D4A301_RAT 5.403 2.434 0.0280
ENSRNOG00000013798 Fnbp1l 5.391 2.431 0.0098
ENSRNOG00000003620 Fmo3 5.384 2.429 0.0050
ENSRNOG00000018220 Pde4dip 5.377 2.427 0.0462
ENSRNOG00000000145 Pik3r3 5.352 2.420 0.0210
ENSRNOG00000008834 LOC306096 5.351 2.420 0.0356
ENSRNOG00000025882 Nipal1 5.345 2.418 0.0306
ENSRNOG00000010996 Mobkl1a 5.341 2.417 0.0147
ENSRNOG00000001582 Bach1 5.339 2.417 0.0199
ENSRNOG00000022309 D3ZRU8_RAT 5.313 2.410 0.0048
ENSRNOG00000015741 Slc2a13 5.298 2.406 0.0371
ENSRNOG00000014303 F1M753_RAT 5.294 2.404 0.0391
ENSRNOG00000036798 Dusp3 5.284 2.402 0.0199
ENSRNOG00000012142 Glyat 5.283 2.401 0.0081
ENSRNOG00000024426 D3ZXW1_RAT 5.259 2.395 0.0477
ENSRNOG00000006628 Dusp16 5.256 2.394 0.0271
ENSRNOG00000026143 Ckap2l 5.230 2.387 0.0271
ENSRNOG00000018867 Klhdc7a 5.223 2.385 0.0489
ENSRNOG00000025296 Lrrc8a 5.203 2.379 0.0176
ENSRNOG00000014508 Mgll 5.203 2.379 0.0137
ENSRNOG00000000589 RGD1310495 5.199 2.378 0.0372
ENSRNOG00000014234 Hif1an 5.192 2.376 0.0394
ENSRNOG00000008450 LOC100359539 5.178 2.372 0.0409
ENSRNOG00000010744 Nrp1 5.177 2.372 0.0072
ENSRNOG00000039837 RGD1563945 5.161 2.368 0.0466
ENSRNOG00000013177 Map3k1 5.154 2.366 0.0114
ENSRNOG00000021719 F1LX81_RAT 5.153 2.365 0.0133
ENSRNOG00000024629 Hadha 5.116 2.355 0.0126
ENSRNOG00000014907 Aldh8a1 5.105 2.352 0.0055
ENSRNOG00000036673 Sectm1b 5.098 2.350 0.0121
ENSRNOG00000024794 Senp5 5.096 2.349 0.0264
ENSRNOG00000005131 Lin7c 5.086 2.347 0.0289
ENSRNOG00000002225 Scarb2 5.081 2.345 0.0116
ENSRNOG00000020284 Prkar2a 5.077 2.344 0.0215
ENSRNOG00000014648 Efnb2 5.072 2.343 0.0303
ENSRNOG00000002488 Galnt10 5.063 2.340 0.0437
ENSRNOG00000017406 Atrnl1 5.056 2.338 0.0269
ENSRNOG00000010813 Tspan14 5.048 2.336 0.0304
ENSRNOG00000000645 Reep3 5.047 2.336 0.0262
ENSRNOG00000018873 Fam168a 5.036 2.332 0.0160
ENSRNOG00000020253 RAB1B_RAT 5.030 2.331 0.0128
ENSRNOG00000001235 Gna12 5.012 2.325 0.0149
ENSRNOG00000040215 F1LZL1_RAT 5.011 2.325 0.0302
ENSRNOG00000011619 Myo9a 4.988 2.319 0.0163
ENSRNOG00000039976 D3ZHG3_RAT 4.983 2.317 0.0137
ENSRNOG00000016011 Plekhg1 4.971 2.314 0.0315
ENSRNOG00000037909 Ppm1f 4.964 2.312 0.0269
ENSRNOG00000016419 Pdlim5 4.962 2.311 0.0248
ENSRNOG00000023280 Als2 4.952 2.308 0.0166
ENSRNOG00000005417 Zhx2 4.948 2.307 0.0430
ENSRNOG00000017671 Rasa3 4.944 2.306 0.0403
ENSRNOG00000016848 Fzd4 4.942 2.305 0.0255
ENSRNOG00000003508 LOC100364400 4.942 2.305 0.0244
ENSRNOG00000012394 Bcl2l13 4.931 2.302 0.0466
ENSRNOG00000018400 D4AEL2_RAT 4.931 2.302 0.0303
ENSRNOG00000013707 Spata13 4.930 2.302 0.0445
ENSRNOG00000002039 LOC100360066 4.930 2.301 0.0436
ENSRNOG00000004563 Sec24a 4.917 2.298 0.0191
ENSRNOG00000020386 D3ZKH4_RAT 4.906 2.295 0.0098
ENSRNOG00000007419 Pank3 4.900 2.293 0.0128
ENSRNOG00000024533 Aer61 4.889 2.290 0.0382
ENSRNOG00000027151 Lrrc58 4.886 2.289 0.0393
ENSRNOG00000030124 Ptpn11 4.869 2.284 0.0160
ENSRNOG00000006131 Mettl2 4.846 2.277 0.0271
ENSRNOG00000000407 Dcbld1 4.834 2.273 0.0412
ENSRNOG00000008061 Nuak1 4.826 2.271 0.0360
ENSRNOG00000037514 Qser1 4.821 2.269 0.0136
ENSRNOG00000004959 Actr2 4.807 2.265 0.0327
ENSRNOG00000028582 F1M163_RAT 4.795 2.261 0.0045
ENSRNOG00000043037 LOC100366023 4.788 2.259 0.0349
ENSRNOG00000012135 F1M2H7_RAT 4.763 2.252 0.0406
ENSRNOG00000031069 D4A9A7_RAT 4.749 2.247 0.0462
ENSRNOG00000023109 F1LVL2_RAT 4.736 2.244 0.0482
ENSRNOG00000004442 RGD1311756 4.729 2.241 0.0456
ENSRNOG00000021318 Epas1 4.723 2.240 0.0138
ENSRNOG00000018099 Itch 4.702 2.233 0.0383
ENSRNOG00000038892 LOC686123 4.691 2.230 0.0268
ENSRNOG00000000296 Aqp6 4.685 2.228 0.0310
ENSRNOG00000014901 Uggt1 4.684 2.228 0.0168
ENSRNOG00000019659 Aspa 4.680 2.227 0.0055
ENSRNOG00000010450 D4ADY9_RAT 4.662 2.221 0.0220
ENSRNOG00000011066 6-Mar 4.658 2.220 0.0264
ENSRNOG00000013121 Mier3 4.647 2.216 0.0408
ENSRNOG00000030894 Slco1a6 4.640 2.214 0.0068
ENSRNOG00000004964 Erbb3 4.609 2.205 0.0351
ENSRNOG00000014135 Rab11fip4 4.607 2.204 0.0453
ENSRNOG00000005052 Slc39a9 4.594 2.200 0.0454
ENSRNOG00000005276 Csnk2a1 4.589 2.198 0.0259
ENSRNOG00000015007 RGD1565591 4.583 2.196 0.0462
ENSRNOG00000002099 Wdfy3 4.579 2.195 0.0217
ENSRNOG00000001747 Pak2 4.572 2.193 0.0178
ENSRNOG00000018226 Zcchc14 4.565 2.190 0.0441
ENSRNOG00000010702 Ube3c 4.564 2.190 0.0154
ENSRNOG00000010610 Hpgd 4.556 2.188 0.0125
ENSRNOG00000001756 D3ZDR3_RAT 4.551 2.186 0.0486
ENSRNOG00000006335 Klhl9 4.550 2.186 0.0083
ENSRNOG00000016715 Kif11 4.547 2.185 0.0159
ENSRNOG00000021916 Slc16a12 4.541 2.183 0.0224
ENSRNOG00000011250 Inmt 4.506 2.172 0.0125
ENSRNOG00000013140 Pdzd2 4.502 2.171 0.0305
ENSRNOG00000012440 Msra 4.501 2.170 0.0308
ENSRNOG00000019932 Ip6k1 4.500 2.170 0.0307
ENSRNOG00000037227 Yes1 4.499 2.170 0.0412
ENSRNOG00000012054 Zmpste24 4.498 2.169 0.0179
ENSRNOG00000007370 Rnf144a 4.493 2.168 0.0443
ENSRNOG00000022968 F1M4Y9_RAT 4.491 2.167 0.0400
ENSRNOG00000011340 D3ZMJ4_RAT 4.488 2.166 0.0143
ENSRNOG00000021705 D3ZXN6_RAT 4.486 2.165 0.0229
ENSRNOG00000003865 Tmigd1 4.483 2.164 0.0072
ENSRNOG00000012105 F1MAE3_RAT 4.478 2.163 0.0346
ENSRNOG00000011312 F1LQ39_RAT 4.475 2.162 0.0366
ENSRNOG00000000127 F1LT58_RAT 4.463 2.158 0.0484
ENSRNOG00000022929 MTMRC_RAT 4.438 2.150 0.0307
ENSRNOG00000033372 Klhl24 4.431 2.148 0.0197
ENSRNOG00000008332 Smo 4.420 2.144 0.0209
ENSRNOG00000028616 Pck1 4.418 2.143 0.0219
ENSRNOG00000013281 Mib1 4.415 2.142 0.0306
ENSRNOG00000011448 Eri1 4.410 2.141 0.0414
ENSRNOG00000028422 Rmnd5a 4.409 2.141 0.0212
ENSRNOG00000014859 Rnf152 4.404 2.139 0.0298
ENSRNOG00000001893 LOC100362453 4.397 2.137 0.0349
ENSRNOG00000018123 Ccny 4.396 2.136 0.0173
ENSRNOG00000016337 Slc22a1 4.394 2.135 0.0356
ENSRNOG00000003709 Kmo 4.389 2.134 0.0166
ENSRNOG00000019939 CCND2_RAT 4.386 2.133 0.0383
ENSRNOG00000029947 4.377 2.130 0.0399
ENSRNOG00000008346 Itgb6 4.372 2.128 0.0245
ENSRNOG00000008678 Antxr1 4.357 2.123 0.0237
ENSRNOG00000029924 Klk1l 4.344 2.119 0.0267
ENSRNOG00000043406 LOC100360800 4.341 2.118 0.0323
ENSRNOG00000012343 Pdp2 4.324 2.112 0.0419
ENSRNOG00000009899 D3ZWL1_RAT 4.306 2.106 0.0427
ENSRNOG00000003434 Trove2 4.301 2.105 0.0368
ENSRNOG00000015519 Ces1d 4.294 2.102 0.0253
ENSRNOG00000017439 Cgnl1 4.294 2.102 0.0236
ENSRNOG00000014700 Ttc36 4.287 2.100 0.0266
ENSRNOG00000007944 Edem1 4.281 2.098 0.0367
ENSRNOG00000031263 Haao 4.246 2.086 0.0200
ENSRNOG00000001647 Ets2 4.245 2.086 0.0357
ENSRNOG00000008652 RGD1564964 4.226 2.079 0.0153
ENSRNOG00000023202 Usp15 4.217 2.076 0.0230
ENSRNOG00000016289 Bmpr1b 4.212 2.075 0.0370
ENSRNOG00000015024 E9PT54_RAT 4.208 2.073 0.0252
ENSRNOG00000000555 Eif4ebp2 4.199 2.070 0.0381
ENSRNOG00000008620 Smad3 4.198 2.070 0.0440
ENSRNOG00000008619 Agtrap 4.198 2.070 0.0217
ENSRNOG00000009711 Hepacam2 4.196 2.069 0.0409
ENSRNOG00000015734 Ube3a 4.193 2.068 0.0225
ENSRNOG00000015634 SMAD4_RAT 4.189 2.067 0.0277
ENSRNOG00000042519 RGD1312026 4.182 2.064 0.0380
ENSRNOG00000007564 Evc 4.160 2.057 0.0289
ENSRNOG00000008372 Vamp7 4.160 2.057 0.0433
ENSRNOG00000024671 D4AA13_RAT 4.157 2.056 0.0120
ENSRNOG00000004622 Calcrl 4.142 2.050 0.0131
ENSRNOG00000009660 Enpp6 4.140 2.050 0.0247
ENSRNOG00000014750 D3ZXU7_RAT 4.138 2.049 0.0176
ENSRNOG00000008694 Miox 4.134 2.048 0.0226
ENSRNOG00000004831 Arid2 4.134 2.047 0.0317
ENSRNOG00000043167 Itga9 4.124 2.044 0.0349
ENSRNOG00000001770 Ehhadh 4.114 2.040 0.0104
ENSRNOG00000042160 Tmem167b 4.112 2.040 0.0466
ENSRNOG00000018668 Glg1 4.095 2.034 0.0172
ENSRNOG00000007985 D4ABH6_RAT 4.084 2.030 0.0231
ENSRNOG00000014623 F1M3F2_RAT 4.071 2.026 0.0332
ENSRNOG00000002227 Kit 4.056 2.020 0.0429
ENSRNOG00000016219 Vnn1 4.052 2.019 0.0115
ENSRNOG00000008322 E9PTI4_RAT 4.035 2.013 0.0418
ENSRNOG00000011358 Hipk3 4.034 2.012 0.0372
ENSRNOG00000028335 Fat4 4.017 2.006 0.0190
ENSRNOG00000025554 Zfp445 4.009 2.003 0.0365
ENSRNOG00000003388 Cenpf 3.990 1.996 0.0146
ENSRNOG00000000614 Bicc1 3.987 1.995 0.0162
ENSRNOG00000039091 D3ZRC4_RAT 3.975 1.991 0.0145
ENSRNOG00000030154 Cyp4a2 3.962 1.986 0.0422
ENSRNOG00000033172 3.952 1.983 0.0176
ENSRNOG00000017466 Kif5b 3.949 1.981 0.0128
ENSRNOG00000042879 D4A3X0_RAT 3.943 1.979 0.0454
ENSRNOG00000002146 Pkd2 3.942 1.979 0.0358
ENSRNOG00000012940 Vps41 3.937 1.977 0.0280
ENSRNOG00000017291 Sord 3.928 1.974 0.0133
ENSRNOG00000001606 Adamts5 3.923 1.972 0.0420
ENSRNOG00000016534 D3ZKX0_RAT 3.904 1.965 0.0295
ENSRNOG00000007202 Sema3d 3.898 1.963 0.0254
ENSRNOG00000012436 Adh6 3.897 1.962 0.0137
ENSRNOG00000016334 Rod1 3.867 1.951 0.0167
ENSRNOG00000018011 RGD1564456 3.867 1.951 0.0417
ENSRNOG00000039494 D4A608_RAT 3.853 1.946 0.0328
ENSRNOG00000014976 Acsm2 3.850 1.945 0.0330
ENSRNOG00000006636 Otud6b 3.817 1.932 0.0439
ENSRNOG00000015849 Sepp1 3.812 1.930 0.0292
ENSRNOG00000004689 Ptdss1 3.811 1.930 0.0342
ENSRNOG00000013808 Ces2g 3.803 1.927 0.0345
ENSRNOG00000014673 Eri2 3.791 1.922 0.0429
ENSRNOG00000009819 Vezf1 3.784 1.920 0.0450
ENSRNOG00000016758 Loxl2 3.783 1.919 0.0310
ENSRNOG00000010061 Gmfb 3.763 1.912 0.0466
ENSRNOG00000023021 Msl2 3.746 1.906 0.0486
ENSRNOG00000039571 Glod5 3.742 1.904 0.0370
ENSRNOG00000017600 Ptpn9 3.739 1.903 0.0329
ENSRNOG00000000590 Naglt1 3.718 1.895 0.0365
ENSRNOG00000011511 Stk24 3.716 1.894 0.0398
ENSRNOG00000018279 Sfxn1 3.712 1.892 0.0213
ENSRNOG00000003953 RB3GP_RAT 3.709 1.891 0.0486
ENSRNOG00000024632 Atf6 3.699 1.887 0.0421
ENSRNOG00000016779 Fam120a 3.679 1.879 0.0257
ENSRNOG00000010379 Cugbp1 3.670 1.876 0.0295
ENSRNOG00000010780 Dlc1 3.664 1.874 0.0495
ENSRNOG00000003948 Llgl1 3.659 1.871 0.0486
ENSRNOG00000016183 Ipp 3.647 1.867 0.0466
ENSRNOG00000017964 Slc22a25 3.567 1.835 0.0201
ENSRNOG00000039745 Pm20d1 3.557 1.831 0.0300
ENSRNOG00000010107 PALLD_RAT 3.528 1.819 0.0467
ENSRNOG00000019444 D4ADJ6_RAT 3.515 1.814 0.0265
ENSRNOG00000011260 Cmbl 3.513 1.813 0.0221
ENSRNOG00000013322 DPOLA_RAT 3.505 1.810 0.0498
ENSRNOG00000039278 Mcart1 3.477 1.798 0.0345
ENSRNOG00000021108 Slc22a12 3.449 1.786 0.0263
ENSRNOG00000010887 RGD1309534 3.435 1.781 0.0382
ENSRNOG00000008331 RGD1309995 3.394 1.763 0.0425
ENSRNOG00000007949 Rgn 3.355 1.746 0.0276
ENSRNOG00000011987 Cd2ap 3.343 1.741 0.0306
ENSRNOG00000042175 B6VQA7_RAT 3.331 1.736 0.0384
ENSRNOG00000012190 Cldn2 3.324 1.733 0.0347
ENSRNOG00000023972 F1M6Q3_RAT 3.323 1.733 0.0322
ENSRNOG00000011763 Serp1 3.319 1.731 0.0316
ENSRNOG00000004496 Rock2 3.318 1.730 0.0337
ENSRNOG00000004677 Zeb2 3.306 1.725 0.0306
ENSRNOG00000013409 Gclm 3.301 1.723 0.0338
ENSRNOG00000004302 Pah 3.270 1.709 0.0368
ENSRNOG00000010947 MMP14_RAT 3.253 1.702 0.0337
ENSRNOG00000011058 Utrn 3.247 1.699 0.0378
ENSRNOG00000018215 Slc22a6 3.246 1.698 0.0377
ENSRNOG00000016456 Il33 3.234 1.693 0.0319
ENSRNOG00000002541 Pds5a 3.164 1.662 0.0449
ENSRNOG00000002680 Lamc1 3.139 1.650 0.0366
ENSRNOG00000011124 Eif4g2-ps1 3.125 1.644 0.0380
ENSRNOG00000004009 Xpnpep2 3.118 1.641 0.0414
ENSRNOG00000010768 Kpna4 3.114 1.639 0.0499
ENSRNOG00000042249 F1LTA7_RAT 3.101 1.633 0.0422
ENSRNOG00000014166 Smoc2 3.078 1.622 0.0413
ENSRNOG00000002305 Slc15a2 3.061 1.614 0.0400
ENSRNOG00000005130 Ogdh 3.049 1.608 0.0465
ENSRNOG00000018086 Slc22a8 3.048 1.608 0.0418
ENSRNOG00000010814 Bmpr1a 3.006 1.588 0.0432
ENSRNOG00000032885 CYC_RAT 2.936 1.554 0.0478

Down-regulated Genes: 15
ENSRNOG00000032087 F1LWC2_RAT 0.301 −1.734 0.0328
ENSRNOG00000032609 0.300 −1.738 0.0394
ENSRNOG00000033748 F1LWC2_RAT 0.299 −1.741 0.0381
ENSRNOG00000025670 Shisa3 0.295 −1.759 0.0282
ENSRNOG00000029115 0.284 −1.815 0.0315
ENSRNOG00000011821 S100a4 0.228 −2.134 0.0086
ENSRNOG00000007632 Zmynd17 0.211 −2.243 0.0365
ENSRNOG00000025408 D3ZTT0_RAT 0.189 −2.403 0.0422
ENSRNOG00000028844 Slc9a5 0.181 −2.466 0.0282
ENSRNOG00000006889 Ambp 0.150 −2.741 0.0177
ENSRNOG00000028730 D3ZI71_RAT 0.148 −2.757 0.0450
ENSRNOG00000026067 Wfdc10 0.144 −2.791 0.0123
ENSRNOG00000037374 D3ZPQ1_RAT 0.140 −2.840 0.0087
ENSRNOG00000033517 LOC100360791 0.129 −2.950 0.0009
ENSRNOG00000042909 F1LZX4_RAT 0.107 −3.229 0.0466
ENSRNOG00000014578 Fxyd4 0.096 −3.374 0.0001

Figure 6.

Figure 6

Enzymes of the tryptophan metabolism pathway that are regulated by melatonin therapy in the kidney (red stars). Data were analyzed using the KEGG Pathway feature of the DAVID software.

4. Discussion

The major findings of our study can be summarized as follows: (1) CR offspring developed hypertension at 12 weeks of age and this was prevented by maternal melatonin therapy; (2) melatonin restored the CR-induced increase of plasma ADMA level, decreased l-arginine level, and decreased l-arginine-to-ADMA ratio; (3) CR reduced renal NO level and this was prevented by melatonin; (4) melatonin therapy increased PAX2 mRNA expression in the CR + M group; (5) CR upregulated renin and PRR expression and melatonin suppressed this increase; (6) melatonin therapy significantly increased renal ACE2 protein levels in the M and CR + M group; and (7) the expression of numerous genes was regulated in melatonin-treated offspring kidneys during nephrogenesis.

Our recent work indicates that ADMA-induced NO/reactive oxygen species (ROS) imbalance is involved in the development of hypertension in two different developmental models, maternal caloric restriction, and maternal diabetes [10, 11]. Several lines of evidence in this study indicated that ADMA-induced NO/ROS imbalance is involved in the developmental programming of hypertension in offspring exposed to maternal caloric restriction. First, plasma levels of the endogenous NOS inhibitor ADMA were increased in the CR group. Second, ADMA and l-arginine both compete for NOS and are present in a ratio that maintains NO homeostasis; this ratio was decreased in the plasma in the CR group. Third, maternal CR decreased renal NO levels in the offspring. Thus, alterations in the ADMA-NO pathway might be a major factor involved in programmed adult hypertension in response to maternal CR.

Melatonin is rapidly transferred from maternal to fetal circulation [20]. Administration of melatonin to pregnant rats prevents oxidative stress damage in the brains of offspring [21]. Previously, we showed that melatonin increases NO, restoring NO/ROS balance at the prehypertension stage and leading to lower blood pressure in young SHR [15]. Consistent with these findings, we found that early melatonin therapy in the mother could prevent programmed hypertension in their adult offspring. Thus, we suggest that melatonin has a novel protective effect on programmed hypertension through acting on the ADMA-NO pathway.

In addition to oxidative stress, the RAS plays a fundamental role in the development of hypertension and kidney development [5]. Epigenetic regulation of several RAS components has been reported in different programmed hypertension models [22, 23]. We demonstrated for the first time that melatonin therapy during nephrogenesis increased renin, PRR, and ACE2 expression in the kidney of the adult offspring. Consistent with these data, renal protein levels of PRR and ACE2 were increased in melatonin-treated offspring. Renin-PRR signaling is essential for proper kidney development and is causally linked to hypertension [13]. ACE2 appears to antagonize the effects of ACE through the production of angiotensin (1–7) in a manner that opposes the development of hypertension [24]. Surprisingly, melatonin therapy increased ACE2 expression in the kidney and prevented CR-induced programmed hypertension, despite the presence of increased renin and PRR expression. Notably, melatonin upregulated several RAS components and had reciprocal effects on vasodilation and vasoconstriction in rats at 3 months of age. Future studies are required to clarify the underlying mechanisms involved in the differential regulation of RAS components by melatonin.

Long-term amelioration of hypertension by melatonin therapy during gestation and lactation may be due to epigenetic changes in the kidney during a critical period of nephrogenesis. We found that melatonin upregulated HDAC-2, -3, and -8 expression in the kidney in CR + M group. This finding is consistent with that of our previous study showing that melatonin increased the expression of both class I and class II HDACs in vitro [25]. Given that melatonin increased class I HDACs expression and that HDACs are primarily thought to repress gene transcription, melatonin likely upregulates gene expression. Conversely, melatonin is known as a class III HDAC inhibitor [17]. Thus, melatonin might have dual effects on HDACs to epigenetically regulate gene expression. To the best of our knowledge, our study is the first to document altered expression of more than 400 genes in the kidney in response to melatonin and implicates melatonin in the protection from programmed hypertension in adult life. Notably, our data imply that melatonin is liable to induce, but not suppress, gene expression in the developing kidney. Using the KEGG database, several biological pathways were proposed to be regulated by melatonin including focal adhesion signaling, the peroxisome proliferator-activated receptors signaling pathway, fatty acid metabolism, the transforming growth factor β signaling pathway, and the Wnt signaling pathway. These findings suggest that melatonin might have a global epigenetic effect during nephrogenesis. Interestingly, the most significantly regulated biological theme was tryptophan metabolism, indicating that melatonin might have a negative feedback effect on its precursor tryptophan. Notably, maternal melatonin therapy has adverse effects on survival and renal growth in Wistar-Kyoto rats [26]. Because our data showed that maternal melatonin therapy had strong epigenetic effects, further evaluation is warranted to determine whether early melatonin therapy causes long-term epigenetic changes that lead to adverse effects in adulthood.

Previously, we showed that maternal CR reduces nephron numbers in offspring [10]. Increases in renal apoptosis and impaired expression of nephrogenesis-related genes may contribute to this reduction. In contrast to several earlier reports [27, 28], we found that apoptosis- and nephrogenesis-related genes were not altered in maternal CR-induced programmed hypertension. Of note, we showed for the first time that melatonin treatment upregulated PAX2 mRNA in metanephroi. Because PAX2 plays a crucial role in kidney development and is associated with various congenital renal and ureteral malformations, further studies are warranted to understand the epigenetic regulation of melatonin on PAX2 during nephrogenesis.

We conclude that prenatal melatonin therapy offsets the effects of maternal CR-induced programmed hypertension in adult offspring, primarily through the restoration of the ADMA-NO balance in the kidney. Our data suggested that a critical window exists during nephrogenesis in which the adult BP can be modified. Moreover, we showed that melatonin can modulate type I HDACs and serve as an inducer of gene expression in the developing kidney. The implications of melatonin-induced epigenetic changes on programmed hypertension in later life remain to be explored.

Acknowledgments

This work was supported by Grant NSC 101-2314-B-182A-021-MY3 from the National Science Council (Taiwan) and Grants CMRPG8B0172 and CMRPG8C0041 from Chang Gung Memorial Hospital (Kaohsiung, Taiwan).

Conflict of Interests

The authors declare that there is no conflict of interests regarding the publication of this paper.

References

  • 1.Ojeda NB, Grigore D, Alexander BT. Developmental programming of hypertension: insight from animal models of nutritional manipulation. Hypertension. 2008;52(1):44–50. doi: 10.1161/HYPERTENSIONAHA.107.092890. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Bagby SP. Maternal nutrition, low nephron number, and hypertension in later life: pathways of nutritional programming. Journal of Nutrition. 2007;137(4):1066–1072. doi: 10.1093/jn/137.4.1066. [DOI] [PubMed] [Google Scholar]
  • 3.McMillen IC, Robinson JS. Developmental origins of the metabolic syndrome: prediction, plasticity, and programming. Physiological Reviews. 2005;85(2):571–633. doi: 10.1152/physrev.00053.2003. [DOI] [PubMed] [Google Scholar]
  • 4.Alwasel SH, Ashton N. Prenatal programming of renal sodium handling in the rat. Clinical Science. 2009;117(2):75–84. doi: 10.1042/CS20080294. [DOI] [PubMed] [Google Scholar]
  • 5.Vehaskari VM, Stewart T, Lafont D, Soyez C, Seth D, Manning J. Kidney angiotensin and angiotensin receptor expression in prenatally programmed hypertension. The American Journal of Physiology—Renal Physiology. 2004;287(2):F262–F267. doi: 10.1152/ajprenal.00055.2004. [DOI] [PubMed] [Google Scholar]
  • 6.Dennery PA. Oxidative stress in development: nature or nurture? Free Radical Biology and Medicine. 2010;49(7):1147–1151. doi: 10.1016/j.freeradbiomed.2010.07.011. [DOI] [PubMed] [Google Scholar]
  • 7.Wilcox CS. Oxidative stress and nitric oxide deficiency in the kidney: a critical link to hypertension? The American Journal of Physiology—Regulatory Integrative and Comparative Physiology. 2005;289(4):R913–R935. doi: 10.1152/ajpregu.00250.2005. [DOI] [PubMed] [Google Scholar]
  • 8.Baylis C. Arginine, arginine analogs and nitric oxide production in chronic kidney disease. Nature Clinical Practice Nephrology. 2006;2(4):209–220. doi: 10.1038/ncpneph0143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Tain Y-L, Huang L-T. Asymmetric dimethylarginine: clinical applications in pediatric medicine. Journal of the Formosan Medical Association. 2011;110(2):70–77. doi: 10.1016/S0929-6646(11)60012-0. [DOI] [PubMed] [Google Scholar]
  • 10.Tain Y-L, Hsieh C-S, Lin I-C, Chen C-C, Sheen J-M, Huang L-T. Effects of maternal l-citrulline supplementation on renal function and blood pressure in offspring exposed to maternal caloric restriction: the impact of nitric oxide pathway. Nitric Oxide. 2010;23(1):34–41. doi: 10.1016/j.niox.2010.03.005. [DOI] [PubMed] [Google Scholar]
  • 11.Tain YL, Lee WC, Hsu CN, et al. Asymmetric dimethylarginine is associated with developmental programming of adult kidney disease and hypertension in offspring of streptozotocin-treated mothers. PLoS ONE. 2013;8(2) doi: 10.1371/journal.pone.0055420.e55420 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Chen S, Bellew C, Yao X, et al. Histone deacetylase (HDAC) activity is critical for embryonic kidney gene expression, growth, and differentiation. The Journal of Biological Chemistry. 2011;286(37):32775–32789. doi: 10.1074/jbc.M111.248278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Song R, Van Buren T, Yosypiv IV. Histone deacetylases are critical regulators of the renin-angiotensin system during ureteric bud branching morphogenesis. Pediatric Research. 2010;67(6):573–578. doi: 10.1203/PDR.0b013e3181da477c. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Galano A, Tan DX, Reiter RJ. On the free radical scavenging activities of melatonin's metabolites, AFMK and AMK. Journal of Pineal Research. 2013;54(3):245–257. doi: 10.1111/jpi.12010. [DOI] [PubMed] [Google Scholar]
  • 15.Tain Y-L, Huang L-T, Lin I-C, Lau Y-T, Lin C-Y. Melatonin prevents hypertension and increased asymmetric dimethylarginine in young spontaneous hypertensive rats. Journal of Pineal Research. 2010;49(4):390–398. doi: 10.1111/j.1600-079X.2010.00806.x. [DOI] [PubMed] [Google Scholar]
  • 16.Korkmaz A, Rosales-Corral S, Reiter RJ. Gene regulation by melatonin linked to epigenetic phenomena. Gene. 2012;503(1):1–11. doi: 10.1016/j.gene.2012.04.040. [DOI] [PubMed] [Google Scholar]
  • 17.Jung-Hynes B, Reiter RJ, Ahmad N. Sirtuins, melatonin and circadian rhythms: building a bridge between aging and cancer. Journal of Pineal Research. 2010;48(1):9–19. doi: 10.1111/j.1600-079X.2009.00729.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Tain Y-L, Baylis C. Determination of dimethylarginine dimethylaminohydrolase activity in the kidney. Kidney International. 2007;72(7):886–889. doi: 10.1038/sj.ki.5002446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Mortazavi A, Williams BA, McCue K, Schaeffer L, Wold B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nature Methods. 2008;5(7):621–628. doi: 10.1038/nmeth.1226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Okatani Y, Wakatsuki A, Kaneda C. Melatonin increases activities of glutathione peroxidase and superoxide dismutase in fetal rat brain. Journal of Pineal Research. 2000;28(2):89–96. doi: 10.1034/j.1600-079x.2001.280204.x. [DOI] [PubMed] [Google Scholar]
  • 21.Watanabe K, Wakatsuki A, Shinohara K, Ikenoue N, Yokota K, Fukaya T. Maternally administered melatonin protects against ischemia and reperfusion-induced oxidative mitochondrial damage in premature fetal rat brain. Journal of Pineal Research. 2004;37(4):276–280. doi: 10.1111/j.1600-079X.2004.00167.x. [DOI] [PubMed] [Google Scholar]
  • 22.Bogdarina I, Welham S, King PJ, Burns SP, Clark AJL. Epigenetic modification of the renin-angiotensin system in the fetal programming of hypertension. Circulation Research. 2007;100(4):520–526. doi: 10.1161/01.RES.0000258855.60637.58. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Goyal R, Goyal D, Leitzke A, Gheorghe CP, Longo LD. Brain renin-angiotensin system: fetal epigenetic programming by maternal protein restriction during pregnancy. Reproductive Sciences. 2010;17(3):227–238. doi: 10.1177/1933719109351935. [DOI] [PubMed] [Google Scholar]
  • 24.Feng Y, Xia H, Santos RA, Speth R, Lazartigues E. Angiotensin-converting enzyme 2: a new target for neurogenic hypertension. Experimental Physiology. 2010;95(5):601–606. doi: 10.1113/expphysiol.2009.047407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Sharma R, Ottenhof T, Rzeczkowska PA, Niles LP. Epigenetic targets for melatonin: induction of histone H3 hyperacetylation and gene expression in C17.2 neural stem cells. Journal of Pineal Research. 2008;45(3):277–284. doi: 10.1111/j.1600-079X.2008.00587.x. [DOI] [PubMed] [Google Scholar]
  • 26.Singh HJ, Keah LS, Kumar A, Sirajudeen KNS. Adverse effects of melatonin on rat pups of Wistar-Kyoto dams receiving melatonin supplementation during pregnancy. Experimental and Toxicologic Pathology. 2012;64(7-8):751–752. doi: 10.1016/j.etp.2011.01.011. [DOI] [PubMed] [Google Scholar]
  • 27.Dickinson H, Walker DW, Wintour EM, Moritz K. Maternal dexamethasone treatment at midgestation reduces nephron number and alters renal gene expression in the fetal spiny mouse. The American Journal of Physiology—Regulatory Integrative and Comparative Physiology. 2007;292(1):R453–R461. doi: 10.1152/ajpregu.00481.2006. [DOI] [PubMed] [Google Scholar]
  • 28.Abdel-Hakeem AK, Henry TQ, Magee TR, et al. Mechanisms of impaired nephrogenesis with fetal growth restriction: altered renal transcription and growth factor expression. The American Journal of Obstetrics and Gynecology. 2008;199(3):252.e1–252.e7. doi: 10.1016/j.ajog.2008.05.018. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Oxidative Medicine and Cellular Longevity are provided here courtesy of Wiley

RESOURCES