Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Jun 1.
Published in final edited form as: J Neuroimmune Pharmacol. 2014 Feb 23;9(3):369–379. doi: 10.1007/s11481-014-9527-3

Δ9-tetrahydrocannabinol treatment during human monocyte differentiation reduces macrophage susceptibility to HIV-1 infection

Julie C Williams 1, Sofia Appelberg 1, Bruce A Goldberger 1, Thomas W Klein 2, John W Sleasman 3, Maureen M Goodenow 1
PMCID: PMC4019698  NIHMSID: NIHMS569786  PMID: 24562630

Abstract

The major psychoactive component of marijuana, Δ9-tetrahydrocannabinol (THC), also acts to suppress inflammatory responses. Receptors for THC, CB1, CB2, and GPR55, are differentially expressed on multiple cell types including monocytes and macrophages, which are important modulators of inflammation in vivo and target cells for HIV-1 infection. Use of recreational and medicinal marijuana is increasing, but the consequences of marijuana exposure on HIV-1 infection are unclear. Ex vivo studies were designed to investigate effects on HIV-1 infection in macrophages exposed to THC during or following differentiation. THC treatment of primary human monocytes during differentiation reduced HIV-1 infection of subsequent macrophages by replication competent or single cycle CCR5 using viruses. In contrast, treatment of macrophages with THC immediately prior to or continuously following HIV-1 exposure failed to alter infection. Specific receptor agonists indicated that the THC effect during monocyte differentiation was mediated primarily through CB2. THC reduced the number of p24 positive cells with little to no effect on virus production per infected cell, while quantitation of intracellular viral gag pinpointed the THC effect to an early event in the viral life cycle. Cells treated during differentiation with THC displayed reduced expression of CD14, CD16, and CD163 and donor dependent increases in mRNA expression of selected viral restriction factors, suggesting a fundamental alteration in phenotype. Ultimately, the mechanism of THC suppression of HIV-1 infection was traced to a reduction in cell surface HIV receptor (CD4, CCR5 and CXCR4) expression that diminished entry efficiency.

Keywords: Macrophage, THC, cannabinoid receptor, HIV, differentiation

Introduction

Self-administered marijuana use is common and can exceed 50% among human immunodeficiency virus -1 (HIV-1) positive adolescents (2012; Nichols et al, 2013; Rotheram-Borus et al, 1997). In addition, Dronabinol, a synthetic form of delta-9-tetrahydrocannabinol (THC), the major psychoactive constituent of marijuana, is an FDA approved drug prescribed to diminish AIDS-associated weight loss (Ben Amar, 2006).

THC interacts with cells primarily via cannabinoid receptors 1 and 2 (CB1 and CB2, respectively). CB1 and CB2 are G-protein coupled seven-transmembrane molecules that normally function as receptors for endocannabinoids (Devane et al, 1992). More recently a third G-protein coupled receptor, GPR55, which binds THC and the endogenous ligand lysophosphatidylinositol, was identified (Henstridge et al, 2011). Receptor expression is complex and can be modulated by anatomical location, cell lineage, and stage of differentiation. For example, CB1 is distributed throughout the brain (Matsuda et al, 1990), but is also detected on peripheral immune cells (Galiègue et al, 1995; Han et al 2009). CB2 is predominantly expressed on immune cells (Castaneda et al, 2013; Galiègue et al, 1995; Han et al, 2009), but appears on microglia cells during inflammation and HIV-1 infection (Cabral and Marciano-Cabral, 2005; Ramirez et al, 2013). GPR55 is expressed most abundantly in brain, intestine, and spleen but is also found on macrophages (Henstridge et al, 2011). Monocytes express CB2 and GPR55, but little if any CB1, although differentiation into macrophages increases levels of CB1 and reduces levels of CB2 compared with monocytes (Galiègue et al, 1995; Han et al, 2009; Whyte et al, 2009).

THC exhibits immune suppressive and anti-inflammatory effects on murine and human cells of monocyte/macrophage lineage (Chang et al, 2001; Coffey et al, 1996; Shivers et al, 1994). Macrophages provide long-lived environments for HIV-1 infection, which can prime infected cells leading to hyper-responsiveness to activation. As regulators of cellular immune responses, macrophages contribute to generalized immune dysfunction associated with HIV-1 infection. Macrophage activation resulting from HIV-1 infection persists for years even after initiation of antiretroviral therapy (ART) (Wallet et al, 2010) and is likely a significant contributor to chronic inflammation and inflammation-related pathogenesis (Hunt, 2012).

Cannabinoids modulate a number of virus infections, in some cases enhancing pathogenesis, but in other cases inhibiting reactivation from latency. For example, THC administration in murine models enhances disease severity and duration by vaccinia virus infection (Huemer et al, 2011), while attenuating cellular infiltration and increasing influenza viral load (Buchweitz et al, 2007). Kaposi’s sarcoma virus (KSV) infection of human microvascular endothelial cells is enhanced by THC treatment (Zhang et al, 2007), but THC inhibits KSV or Epstein Barr virus reactivation in immortalized B cells (Medveczky et al, 2004). In vitro, HIV-1 infection of human CD4+ T cells or macrophages is attenuated by CB2 specific agonists (Costantino et al, 2012; Ramirez et al, 2013), while chronic THC administration to rhesus macaques prior to simian immune deficiency virus (SIV) infection suppresses IFN-γ levels in lymph nodes, attenuates SIV levels in plasma and cerebral spinal fluid, and prolongs the life of the animals (Molina et al, 2011a; Molina et al, 2011b). Although THC appears to have a suppressive effect on virus infection in a number of studies, data can be conflicting and mechanisms of THC effect, particularly on HIV-1 infection of macrophages, are unclear.

Since, HIV-1 infected individuals use marijuana, and are thus exposed to THC, and macrophages are targets for HIV-1 infection and express cannabinoid receptors, THC may impact HIV-1 infection of macrophages, although whether the outcome is harmful or beneficial, remains unclear. Therefore, we designed a study to investigate the effects of THC ex vivo on macrophage susceptibility to HIV-1 infection.

Materials and Methods

Cell culture

Monocyte derived macrophages (MDM) were generated from elutriated human monocytes provided by Dr. Howard Gendelman at the University of Nebraska (Gendelman et al, 1988) or Dr. Mark Wallet at the University of Florida. Use of human cells was approved by the institutional review boards of the University of Nebraska and University of Florida. MDM were cultured as previously described (Wallet et al, 2012).

THC treatment

THC (Sigma Aldrich, St Louis, MO) was obtained under the Federal Drug Enforcement Administration (DEA) license of our collaborator Dr. Bruce Goldberger at the University of Florida. Vehicle control for THC is ethanol (ETOH). Cannabinoid receptor specific agonists, JWH-133, ACEA, and O-1602, were obtained from Tocris (Bristol, UK). Vehicle control for JWH-133 is Tocrisolve (Tocris, Bristol, UK); for ACEA, ETOH; for O-1602, methyl acetate. Cells were exposed to THC using 3 different treatment protocols (Figure 1). In treatment 1, monocytes received THC or vehicle control on days -7 and -5 concurrent with MCSF treatment during differentiation into MDM. In treatment 2, MDM were differentiated and treated with THC or vehicle control 30 minutes prior to infection. Finally, in treatment 3, MDM were treated with THC or vehicle control on post infection days 1, 4, and 7. Toxicity of THC or cannabinoid receptor agonists was evaluated by MTS viability assays; briefly, MDM were incubated with CellTiter 96 Aqueous One Solution (Promega, Madison, WI) for 3 hours and absorbance measured at a wavelength of 490 nm using a universal microplate reader (BioTek Instrument Inc, Winooski, VT). Cell viability after THC treatments was 92-105% compared to untreated or vehicle treated cells.

Figure 1. Study Design.

Figure 1

Open in a new tab

Cells were treated with THC in 3 different ways. Treatment 1: monocytes were treated with THC during differentiation and then infected with HIV-1 as macrophages; Treatment 2: macrophages differentiated from monocytes (MDM) were treated with THC 30 minutes prior to HIV-1 infection; Treatment 3: MDM were treated with THC on days 1, 4 and 7 following infection.

HIV-1 infection of macrophages

Virus stocks of the CCR5 using, macrophage tropic, replication competent HIV-1AD were prepared by transfecting plasmid DNA from a molecular clone into 293T cells and titered as described previously (Theodore et al, 1996). MDMs were infected for 24 hours with HIV-1AD (MOI = 0.005). On post-infection day (PID) 1 media was removed, cells washed with PBS, and fresh media added. Supernatants were collected on PID 4, 7, and 10 and levels of p24 antigen were assessed using p24 ELISA kits (Sino Biological Inc., Beijing, China). Single cycle, luciferase-tagged HIV-1JRFL envelope pseudotyped virus particles were produced as previously described, titered on TZM-bl cells (Tuttle et al, 2002), and used to infect MDM for 24 hours (MOI = 0.0005). On PID 1, media was removed, cells washed with PBS, and fresh media added. On PID 4, media was removed, cells lysed, and luciferase activity was determined as relative light units (RLU) using the luciferase assay system (Promega, Madison, WI) and the microplate luminometer Monolight 3096 (BD Biosciences, San Jose, CA).

Flow cytometry

Macrophages were differentiated in UpCell tissue culture plates (Thermo Scientific Nunc, Rochester, NY). After indicated times, cells were released from plates according to manufacturer’s protocol and stained in 0.5% BSA and 1 mM EDTA in PBS using the following antibodies, anti-CCR5 APC, anti-CXCR4 PE, anti-CD14 Pacific Blue, anti-CD16 PE-Cy7 (BD Biosciences, San Jose, CA), anti-CD4 FITC, anti-CD163 APC (ebioscience, San Diego CA), or anti-p24 PE antibody (KC57-RD1) (Beckman Coulter Indianapolis, IN). For intracellular p24 staining, cells were permeabilized and stained using the BD Cytofix/Cytoperm kit according to manufacturer’s instructions (BD Biosciences San Jose, CA). Flow cytometry was performed using a LSRII flow cytometer (BD Biosciences, San Jose, CA). Data were analyzed using Flow Jo software (Treestar, Ashland, OR).

Quantification of supernatant

Flow cytometry was used to quantitate infected cells based on the presence of intracellular p24, while picogram (pg) of p24 released into the supernatant was quantified by ELISA (Biological Inc., Beijing, China). Amount of supernatant p24 was divided by total number of infected cells in the well, and this ratio was converted to pg of p24 released per 1000 infected cells.

Quantitative Real Time PCR

Total RNA from MDM was extracted using the Ambion RNAqueous-4PCR Kit (Invitrogen, Life Technologies, Grand Island, NY) according to the manufacturer’s instructions. Samples were treated with DNAse 1 and RNA concentrations were quantified. cDNA was synthesized using equal concentrations of RNA and SuperScript III First-Strand Synthesis SuperMix for qRT-PCR (Invitrogen, Grand Island, NY) per manufacturer’s instructions. The qRT-PCR was performed using SYBER Select Master Mix (Applied Biosystems, Life Technologies, Grand Island, NY) and primers specific for APOBEC3G, SAMHD1, or Cyclophilin A , actin (Qiagen, Germantown, MD) or TRIM5α or Tetherin (IDT, Coralville, Iowa). Data was first normalized to the endogenous control, actin, and then expressed as a relative fold change compared to results from vehicle treated cells.

For HIV-1 gag and ApoB copies, DNA was extracted from cells 24 hours post infection by HIV-1AD using the DNeasy blood and tissue kit from Qiagen (Germantown, MD) and quantified by qRT-PCR using a TaqMan assay as previously described (Coberley et al, 2004). All qRT-PCR was performed using the ABI 7500 FAST instrument (Applied Biosystems, Life Technologies, Grand Island, NY).

Hypermutation Analysis

Genomic DNA was isolated from MDM infected with HIV-1AD using DNeasy Blood and Tissue DNA isolation kit (Qiagen, Germantown, MD). A 460 base pair portion of viral DNA, corresponding to HXB2 coordinates 2147-2610, was amplified with the following program 95°C for 2 minutes, 30 cycles of 95°C for 15 sec, 55°C fpr 15 sec, 45°C for 45 seconds, followed by 1 cycle of 68°C for 5 minutes using Platinum Taq (Invitrogen, Life Technologies, Grand Island, NY) and the following forward and reverse primers, CAGAGCCAACAGCCCCACCAG and CTTTTGGGCCATCCATTCCTGGC, respectively. PCR products were ligated in TOPO-TA pCR 2.1 vector (Invitrogen, Life Technologies, Grand Island, NY). Samples were transformed and colonies were grown overnight. Sanger sequencing was performed by the UF ICBR Sequencing core facility. Quality sequences [at least 50 per treatment] were aligned and hypermutation was assessed using the Hypermut tool (Los Alamos National laboratory).

Statistical analysis

Statistical analyses were performed using Graph Pad Prism software (La Jolla, CA). One or two way ANOVA and Bonferroni’s post-test or t-tests were used where appropriate as indicated in figure legends. p-values less than 0.05 were considered statistically significant. Three to six replicate wells were examined in each experiment. Each experiment was performed in cells from multiple independent donors as indicated in figure legends(Bol et al, 2009).

Results

THC treatment during differentiation reduces HIV-1 replication in MDM

To determine if THC modulates HIV-1 replication, monocytes or MDM were treated with THC using three different treatment schemes (described in materials and methods, Figure 1) and infected by macrophage tropic, CCR5 using, replication competent, HIV-1AD. Monocytes treated during differentiation with THC at 1, 10 or 30 μM concentrations (Treatment 1) showed a concentration dependent decrease in supernatant p24 levels relative to vehicle controls (Figure 2A). THC at 30 μM significantly reduced, but failed to completely suppress, p24 production on days 7 or 10 of infection. Although p24 production varied amongst donors, 30 μM THC mediated suppression ranged from 2 to 25 fold, (mean of 6 fold) on PID 7 and 10. In contrast to THC treatment during differentiation, no differences in supernatant p24 levels were detected when MDM were exposed to a single THC treatment 30 minutes prior to infection (Treatment 2) (Figure 2B) or a series of THC treatments following HIV-1 infection (Treatment 3) (Figure 2C). Results indicate that THC treatment of monocytes during differentiation subsequently altered HIV-1 infection in resultant MDM.

Figure 2. THC treatment of monocytes during differentiation into MDMs suppresses HIV-1 infection.

Figure 2

Open in a new tab

A, D, G, H, I) Treatment 1; B and E) Treatment 2; C and F) Treatment 3. A-C) Cells were infected with replication competent HIV-1AD and supernatant p24 was measured by ELISA. D-F) Light units were observed via luciferase assay from cells were infected with single cycle HIV-1JRFL Env-pseudotyped, luciferase-tagged virus particles. G) Percent of cells expressing intracellular p24 on days 4, 7, and 10 after infection was measured by flow cytometry. H) Amount of virus production from 1000 infected cells. Calculation described in materials and methods. I) 24 hours after infection, DNA was collected and subjected to real-time PCR analysis for viral gag and ApoB. Relative gag expression is graphed. Symbols, ■ Untreated, □ Vehicle, Inline graphic 30 μM THC, Inline graphic 10 μM THC, Inline graphic 1 μM THC. * p<0.05, ** p<0.01, *** p<0.001 vs. vehicle control using Bonferroni’s post-test. Data are means with SD for 6 wells. Graphs are of a single experiment and are representative of at least 3 donors with similar results. A is representative of 9 donors, B, C, E, F, G, and H are representative of 3 donors, D and I are representative of 5 donors.

To determine if THC reduces initial infection or diminishes virus production per cell, the percent of infected MDM was evaluated by intracellular p24 staining using flow cytometry. Significantly fewer p24 positive macrophages were observed on PID 7 and 10 in the cells treated with THC during differentiation (Treatment 1) compared to untreated or vehicle treated cells (Figure 2G). Average percent p24+ reduction across experiments from 3 donors was 3.5 fold for PID 7 and 5.5 fold on PID 10. While the percent of p24+ cells in untreated or vehicle treated cells increased over 15-fold from PID 4 to 10, the percent p24+ macrophages treated with THC during differentiation increased about 3-fold (Figure 2G). However, when infection was examined as release of p24 into the supernatant per 1000 infected cells, similar values were observed across treatments (Figure 2H). Results suggest that THC reduces the potential of cells to be infected with little to no effect on virus replication or production within an infected cell.

THC inhibits early events of HIV-1 infection in MDM

To examine first round replication, monocytes were differentiated in the presence of THC (Treatment 1) and infected by single-cycle CCR5-envelope pseudotyped viruses (HIV-1JRFL). A dose dependent reduction, to a maximum of 70%, in luciferase activity was observed (Figure 2D). Across 5 donors, the average RLU reduction induced by 10 μM THC was 2.1 fold while 30μM was 16 fold; in contrast, no differences were found when MDM were treated with any concentration of THC either immediately prior to (Treatment 2) or following infection (Treatment 3) (Figure 2E and 2F respectively). To examine initial infection, viral gag copies were quantified after 24 hours of HIV-1AD infection. MDM cultures treated with 30μM THC during differentiation had significantly reduced gag copies (4 to 5 fold fewer) compared to vehicle treated cells (Figure 2I). Taken together, these data support a model of reduced cell infection that could reflect modulation of entry and/or first round replication by THC treatment during differentiation.

CB2, but not CB1 or GPR55, specific agonists suppresses HIV-1 replication in MDM

To determine if the THC effect on viral infection was mediated through cannabinoid receptors CB1, CB2, or GPR55, monocytes were differentiated into MDM in the presence of cannabinoid receptor agonists, vehicle alone, or left untreated prior to infection (Treatment 1). MDM differentiated in the presence of 10 μM CP55,940 (pan cannabinoid receptor agonist) showed significantly lower supernatant p24 levels compared to vehicle control by days 7 and 10 post-infection (Figure 3A). MDM treated during differentiation with the CB2 specific agonist, JWH-133, also showed a decrease in viral production, with an average reduction on day 10 post infection of 7.1 fold at the 10 μM dose across experiments from 3 donors (Figure 3B). In contrast, MDM treated during differentiation with ACEA, a CB1 specific agonist, or O-1602, a GPR55 specific agonist, showed no decrease in p24 levels (Figure 3C and D). Overall, results indicate that activation of the CB2 receptor plays a significant role in suppression of HIV-1 replication in MDM treated with THC during differentiation.

Figure 3. CB2 mediates suppression of HIV-1 infection.

Figure 3

Open in a new tab

Monocytes were differentiated using Treatment 1 scheme with specific cannabinoid receptor agonists. A) pan cannabinoid receptor agonist CP55,940; B) CB2 agonist JWH-133; C) CB1 agonist ACEA, or D) GPR55 agonist O-1602 at 0.1, 1.0 or 10 μM. Cells were infected with HIV-1AD and supernatant p24 levels were measured after 4, 7 and 10 days of infection. Symbols, ■ Untreated, □ Vehicle, Inline graphic 10 μM agonist, Inline graphic 1 μM agonist, Inline graphic 0.1 μM agonist. *** p<0.001 vs. vehicle control using Bonferroni’s post-test. Data are means with SD for 6 wells. Graphs are of a single experiment and are representative of 3 donors with similar results.

Differentiation of MDMs in the presence of THC inhibits HIV-1 receptor expression

Since the inhibitory mechanism of THC treatment appears to diminish entry and/or first round replication, cell surface levels of CD4, CCR5, and CXCR4, receptors used by HIV-1 for entry, were evaluated. Compared to treatment by vehicle control or untreated cells, monocytes treated with 30 μM THC during differentiation into MDM (Treatment 1) displayed reduced cell surface expression of each HIV-1 receptor after 7 days of differentiation (Figure 4A-C). To determine the kinetics of the THC effect on HIV-1 receptors during differentiation, cell surface expression of CD4, CCR5 and CXCR4 was evaluated over the course of differentiation. Surface expression of CD4 and CCR5 was significantly reduced after only 1 day of exposure to THC (Figure 4D and E). CD4 levels continued to decline to a maximum of approximately 50% of untreated on days 5 and 7 (Figure 4D), while maximal reduction in CCR5 expression to approximately 50% of untreated persisted over time (Figure 4E). CXCR4 surface expression was significantly reduced on days 3 and 5 of differentiation with maximal reduction at approximately 65% of untreated (Figure 4F). Overall, monocyte exposure to THC during differentiation reduced HIV-1 receptor CD4 and CCR5 cell surface protein levels, which would limit viral entry and diminish infection of macrophages.

Figure 4. THC treatment of monocytes during differentiation into macrophages results in decreased HIV-1 receptor levels.

Figure 4

Open in a new tab

Monocytes were differentiated into macrophages the presence of 30 μM THC or vehicle control or left untreated (Treatment 1). A-C) After 7 days of differentiation, cells were stained for CD4, CCR5, and CXCR4 and analyzed by flow cytometry. A) CD4, B) CCR5, C) CXCR4. Figures are representative of experiments from at least 4 donors with similar results. D-F) Cells were stained on day 1, 3, 5 and 7 of differentiation, D) CD4, E) CCR5, F) CXCR4. MFI of receptor expression of vehicle and THC treated MDM were normalized to untreated cells. Data graphed are mean and SD from at least 4 donors. Dashed black lines correspond to unstained cells, solid black lines correspond to untreated cells, green lines correspond to vehicle treatment, and red lines correspond to THC treatment. No statistically significant differences in MFI between vehicle and untreated at any time point. *p<0.05, **p<0.01, ***p<0.001 vs. vehicle control using Bonferroni’s post-test.

Differentiation of MDM in the presence of THC alters cell surface marker phenotype

Since HIV receptors are modulated during monocyte to macrophage differentiation, we next examined the phenotype of macrophages differentiated from monocytes in the presence of THC. In vivo, the circulating monocyte/macrophage phenotype, CD14+ CD16+ CD163+, correlates with viral load (Fischer-Smith et al, 2008). Therefore, CD14, CD16 and CD163 surface expression levels were assessed and all were reduced by differentiation in the presence of THC (Treatment 1) (Figure 5A-C). To investigate the kinetics of the THC effect, cell surface expression of CD14, CD16 and CD163 was evaluated after 1, 3, 5 and 7 days of differentiation. Expression of CD14 declined over time and was significantly reduced on days 3, 5 and 7 of differentiation with a maximal reduction to approximately 45% of untreated cells (Figure 5D). Expression of CD16 and CD163 rapidly declined to approximately 30% of untreated cells, and remained suppressed over time (Figure 5E and F). The THC effect on phenotype was selective, in that cell surface receptors CD11b, ICAM-1 and intracellular marker Mac 387 were not altered by THC treatment (Figure 5 G, H and I). Results indicate that THC treatment during monocyte differentiation selectively modifies MDM phenotype.

Figure 5. THC treatment of monocytes during differentiation into macrophages alters cell surface receptor phenotype.

Figure 5

Open in a new tab

Monocytes were differentiated into macrophages the presence of 30 μM THC or vehicle control or untreated (Treatment 1). A-C) After 7 days of differentiation, cells were stained for A) CD14, B) CD16, C) CD163, G) CD11b, H) ICAM-1, I) Mac 387 and analyzed by flow cytometry. Figures are a representative of experiments from at least 3 donors with similar results D-F) Cells were stained on day 1, 3, 5 and 7 of differentiation, D) CD14, E) CD16 F) CD163. MFI of receptor expression was normalized to untreated cells. Data graphed are mean and SD from at least 4 donors. No statistical differences in MFI between vehicle and untreated in any receptor. **p<0.01, ***p<0.001 vs. vehicle control using Bonferroni’s post-test.

THC treatment during differentiation results in elevated levels of viral restriction factors

Host viral restriction factors are expressed at higher levels in monocytes and downregulated during differentiation (Bergamaschi and Pancino, 2010), therefore we examined the effect of THC on mRNA levels of host cell viral restriction factors, including cyclophilin A, tetherin, TRIM5α, SAMHD1, and APOBEC3G (Figure 6). THC treatment of differentiating macrophages (Treatment 1) produced no differences in steady state mRNA levels for cyclophilin A or tetherin. In contrast, steady state levels of APOBEC3G, SAMHD1, and TRIM5α were increased by about 1.5 to 2.5-fold over vehicle with evident donor variability (p<0.05, p<0.01, p=0.18 respectively). Results support alteration of MDM phenotype by THC that might restrict virus replication.

Figure 6. THC treatment during monocyte differentiation increases expression of selected viral restriction factors.

Figure 6

Open in a new tab

Monocytes from 5 to 6 donors were differentiated for 7 days in the presence of 30 μM THC or vehicle control. mRNA was isolated and analyzed for a panel of HIV-1 restriction factors by quantitative real-time PCR. Each symbol represents results from an individual donor. Values are graphed relative to vehicle control which is represented as a dotted line at 1. Paired t-test was used to evaluate significant differences between THC-treated and untreated cells p<0.05 for APOBEC3G and SAMHD1.

To determine if elevated APOBEC3G mRNA corresponded with increased hypermutation of HIV-1 genomes, frequency of G to A substitutions in sequences of a 400 bp region of HIV-1 that includes protease were evaluated in infected THC treated, vehicle treated or untreated macrophages. Fewer than 5% of sequences showed one or more G to A transitions, with no differences in frequency of G to A substitutions between THC or control treated cells. In addition, less than 3% of sequences displayed an APOBEC3G hypermutation signature independent of THC treatment.

Discussion

Our study uncovered a novel inhibitory function of THC in HIV-1 infection of macrophages. Administration of THC during macrophage differentiation rendered the cells less susceptible to HIV-1 infection concomitant with a dramatic reduction in surface expression of HIV receptors CD4 and CCR5. THC treatment of monocytes primarily modifies entry steps of HIV infection, with little to no effect post entry, and modulates macrophage phenotype.

Monocyte/macrophage differentiation state alters HIV receptor expression and infection (Bergamaschi and Pancino, 2010; Tuttle et al, 1998). Functional receptors are required for HIV infection of MDM as anti-receptor antibodies, pharmacologic inhibitors, such as Maraviroc, and soluble CD4 severely diminish infection (O’Connell et al, 2013; Surdo et al, 2013; Tuttle et al, 1998). Similarly, a number of studies have demonstrated that HIV-1 receptor expression levels modulate entry kinetics on a variety of target cells, including lymphocytes and macrophages (Anderson and Akkina, 2005; Anderson et al, 2003; Chikere et al, 2013; Johnston et al, 2009; Keele et al, 2008). Despite an increase in host restriction factor mRNA, a role for THC in the control of viral infection post entry was not apparent in our study. Moreover, infected cells released similar levels of p24 into the supernatant independent of THC treatment. Results taken together led us to conclude that THC mediated reduction in HIV-infected cells is due to a reduction in HIV receptor cell surface expression.

Our study focused on CCR5-using viruses, including replication competent HIV-1AD and single cycle HIV-1JRFL enveloped virions, because of the persistence of macrophage tropic CCR5-using viruses throughout the course of infection. Given the importance of CD4 expression for infection and dramatic reduction in CD4 surface expression by THC, we expect that infection of macrophages differentiated in the presence of THC by a CXCR4 using virus would be similarly reduced.

Doses of THC used in our study to achieve suppression of HIV-1 infection are consistent with other publications with human cells (Shivers et al, 1994; Watzl et al, 1991; Zheng et al, 1992), but are nonetheless greater than THC levels detected in the circulation following marijuana use (Grotenhermen, 2003). This disparity is partially explained by our use of 10% human serum in the monocyte cultures and the findings of a number of investigators that increasing the serum concentration in the tissue culture medium shifts the THC dose response to the right (Klein et al, 1985; Tang et al, 1993). Over the past 40 years concentrations of THC in marijuana have increased more than 10 fold (Sevigny, 2013), and levels in the blood of drivers suspected of DUI have also increased (Vindenes et al, 2013), so previous estimates of the concentration of THC and its metabolites in the circulation may not be reflective of levels in current chronic users. Cannabinoids and their metabolites accumulate at higher concentrations in fat, spleen and lymph nodes, compared to the brain and blood after administration in animal models (Ho et al, 1970; Kreuz and Axelrod, 1973; Lynn and Herkenham, 1994; Ryrfeldt et al, 1973). Consequently, current marijuana users may well have greater accumulation of THC in immune tissues compared to cells in circulation, which has implications for immune modulation. Ultimately ex vivo findings provide a framework to investigate the effects of marijuana use on HIV-1 infection in vivo.

The suppressive effect of exposure to THC during differentiation of MDM on HIV-1 infection is primarily mediated through CB2, consistent with monocytes expressing CB2, but little if any CB1 (Galiègue et al, 1995; Han et al, 2009). In addition, CP55,940 (a full CB1/CB2 agonist) and THC (a partial CB1/CB2 agonist) appear to have the same potency in suppressing p24 (Figures 2 and 3) suggesting that THC might have non-receptor effects on the MDM as has been suggested by a number of previous studies (Newton and Klein, 2012; Springs et al, 2008). Suppression of HIV-1 infection using the CB2 agonist, JWH-133, has been observed in MDM (Ramirez et al, 2013), although in contrast to our study with THC, expression of HIV-1 receptors was unaltered. Differences between THC and JWH-133 as CB2 ligands, multiplicity of infection, as well as infection and treatment schemes may explain our divergent results and point to multiple mechanisms, substantiating that the differentiation state of the target cells can impact THC responses.

Treatment with a CB1 agonist during differentiation failed to reduce infection in MDMs reflecting a lack of CB1 expression on monocytes (Han et al, 2009). A role in our study for signaling via GPR55 can also be ruled out, as no decrease of infection in MDMs differentiated in the presence of a GPR55 specific agonist occurred even though cells express GPR55 (Henstridge et al, 2011; Whyte et al, 2009). Differences in downstream signaling between CB2 and GPR55 receptors can be used to identify signaling pathways critical for THC mediated suppression of HIV infection. CB2 receptor signaling is associated with a Gi/o protein, while GPR55 receptor signaling is mediated through activation of a Gα13 protein (Cabral and Griffin-Thomas, 2009; Henstridge et al, 2011). Previous studies show that THC signaling via CB2 and the associated Gi/o protein leads to activation of signaling pathways involving cAMP, release of intracellular calcium and activation of the MAPK pathway (Bouaboula et al, 1996; Cabral and Griffin-Thomas, 2009). CB2 mediated MAPK activation induces EGR1, a transcriptional regulator critical for macrophage differentiation and functioning (Bouaboula et al, 1996; McMahon and Monroe, 1996). Although, intracellular signaling pathways facilitating suppression of HIV-1 receptors and subsequent infection remains unclear; THC treatment prevents chemotaxis of mouse peritoneal macrophages to the CCR5 ligand, CCL5, in a CB2 dependent manner; suggesting that THC can modulate signaling or expression of CCR5 (Cabral and Griffin-Thomas, 2009; Raborn et al, 2008). Similar signaling interactions by THC may modulate surface expression levels of CD4 or other chemokine receptors.

Our study is especially novel in that we discovered a treatment scheme in which exposure of monocytes to a drug alters the phenotype of the resultant macrophages. Others have found phenotypic alterations of MDM derived from monocytes infected by Mycobacterium tuberculosis (Castaño et al, 2011) or treated with corticosteroids (Rinehart et al, 1982) or butyrate, which diminishes macrophage expression of CD14 and CD16 (Millard et al, 2002). Ultimately, it is conceivable that exposure to THC during differentiation may elicit global or selective changes to the cell, resulting in phenotypic reprograming.

THC mediated reduction in CD14, CD16, and CD163 could affect HIV-1 associated neurocognitive disorders (HAND). Cells expressing high levels of these markers can be infected in vivo (Ellery et al, 2007), are associated with alterations in brain metabolism (Lentz et al, 2011) and migrate through the blood brain barrier (Buckner et al, 2011; Williams et al, 2012). Ex vivo, THC reduces migration of macrophages to HIV-1 proteins (Raborn and Cabral, 2010). Taken together with our results, THC exposure may reduce HIV-1 infection in the brain by modulating CD14, CD16 and CD163 expressing cells and limiting migration.

Results from our study raise the possibility that extended marijuana use might decrease macrophage susceptibility to HIV-1 infection. Chronic exposure to marijuana may also fundamentally alter macrophage differentiation, which could result in functional differences in macrophages as regulators of immune responses and contributors to immune dysfunction. Increasing approval of marijuana and its derivatives for medical indications and elevating levels of THC in recreational marijuana necessitates further studies investigating the immunological effects of marijuana use.

Acknowledgments

We would like to acknowledge Daniel Rodriguez, Chris Little, and Steve Pomeroy for technical assistance and thank Dr. Mark Wallet for helpful comments and critical review of the manuscript. We would also like to thank the University of Florida Interdisciplinary Center for Biotechnology Research cellomics core facility for providing flow cytometers and genomics core facility for Sanger sequencing and access to the ABI 7500 FAST instrument. This study was supported in part by HHS funding from the National Institute for Drug Abuse [DA031017] and by Adolescent Medicine Trials Network for HIV/AIDS Interventions (ATN) supported by the National Institutes of Child Health and Development [HD40533 and HD40474]. JCW is supported by the Laura McClamma Fellowship at the University of Florida. SA is supported by the University of Florida Alumni graduate fellowship and the Linton E. Grinter fellowship. Additional support was provided by the Robert A. Good endowed Chair in Immunology (University of South Florida), Stephany W. Holloway University Chair for AIDS Research (University of Florida), Center for Research in Pediatric Immune Deficiency and Inflammation, and University of Florida Health Cancer Center.

Footnotes

Conflicts of Interest: The authors declare that we have no conflict of interest.

References

  1. National Institute on Drug Abuse. Research Report Series: Marijuana Abuse. Abuse NIoD, (ed) National Institues of Health; 2012. [Google Scholar]
  2. Anderson J, Akkina R. HIV-1 resistance conferred by siRNA cosuppression of CXCR4 and CCR5 coreceptors by a bispecific lentiviral vector. AIDS Res Ther. 2005;2:1. doi: 10.1186/1742-6405-2-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Anderson J, Banerjea A, Akkina R. Bispecific short hairpin siRNA constructs targeted to CD4, CXCR4, and CCR5 confer HIV-1 resistance. Oligonucleotides. 2003;13:303–12. doi: 10.1089/154545703322616989. [DOI] [PubMed] [Google Scholar]
  4. Ben Amar M. Cannabinoids in medicine: A review of their therapeutic potential. J Ethnopharmacol. 2006;105:1–25. doi: 10.1016/j.jep.2006.02.001. [DOI] [PubMed] [Google Scholar]
  5. Bergamaschi A, Pancino G. Host hindrance to HIV-1 replication in monocytes and macrophages. Retrovirology. 2010;7:31. doi: 10.1186/1742-4690-7-31. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bol SM, van Remmerden Y, Sietzema JG, Kootstra NA, Schuitemaker H, van’t Wout AB. Donor variation in in vitro HIV-1 susceptibility of monocyte-derived macrophages. Virology. 2009;390:205–11. doi: 10.1016/j.virol.2009.05.027. [DOI] [PubMed] [Google Scholar]
  7. Bouaboula M, Poinot-Chazel C, Marchand J, Canat X, Bourrié B, Rinaldi-Carmona M, Calandra B, Le Fur G, Casellas P. Signaling pathway associated with stimulation of CB2 peripheral cannabinoid receptor. Involvement of both mitogen-activated protein kinase and induction of Krox-24 expression. Eur J Biochem. 1996;237:704–11. doi: 10.1111/j.1432-1033.1996.0704p.x. [DOI] [PubMed] [Google Scholar]
  8. Buchweitz JP, Karmaus PW, Harkema JR, Williams KJ, Kaminski NE. Modulation of airway responses to influenza A/PR/8/34 by Delta9-tetrahydrocannabinol in C57BL/6 mice. J Pharmacol Exp Ther. 2007;323:675–83. doi: 10.1124/jpet.107.124719. [DOI] [PubMed] [Google Scholar]
  9. Buckner CM, Calderon TM, Willams DW, Belbin TJ, Berman JW. Characterization of monocyte maturation/differentiation that facilitates their transmigration across the blood-brain barrier and infection by HIV: implications for NeuroAIDS. Cell Immunol. 2011;267:109–23. doi: 10.1016/j.cellimm.2010.12.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cabral GA, Griffin-Thomas L. Emerging role of the cannabinoid receptor CB2 in immune regulation: therapeutic prospects for neuroinflammation. Expert Rev Mol Med. 2009;11:e3. doi: 10.1017/S1462399409000957. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cabral GA, Marciano-Cabral F. Cannabinoid receptors in microglia of the central nervous system: immune functional relevance. J Leukoc Biol. 2005;78:1192–7. doi: 10.1189/jlb.0405216. [DOI] [PubMed] [Google Scholar]
  12. Castaneda JT, Harui A, Kiertscher SM, Roth JD, Roth MD. Differential Expression of Intracellular and Extracellular CB(2) Cannabinoid Receptor Protein by Human Peripheral Blood Leukocytes. J Neuroimmune Pharmacol. 2013 doi: 10.1007/s11481-012-9430-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Castaño D, Barrera LF, Rojas M. Mycobacterium tuberculosis alters the differentiation of monocytes into macrophages in vitro. Cell Immunol. 2011;268:60–7. doi: 10.1016/j.cellimm.2011.02.006. [DOI] [PubMed] [Google Scholar]
  14. Chang YH, Lee ST, Lin WW. Effects of cannabinoids on LPS-stimulated inflammatory mediator release from macrophages: involvement of eicosanoids. J Cell Biochem. 2001;81:715–23. doi: 10.1002/jcb.1103. [DOI] [PubMed] [Google Scholar]
  15. Chikere K, Chou T, Gorry PR, Lee B. Affinofile profiling: how efficiency of CD4/CCR5 usage impacts the biological and pathogenic phenotype of HIV. Virology. 2013;435:81–91. doi: 10.1016/j.virol.2012.09.043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Coberley CR, Kohler JJ, Brown JN, Oshier JT, Baker HV, Popp MP, Sleasman JW, Goodenow MM. Impact on genetic networks in human macrophages by a CCR5 strain of human immunodeficiency virus type 1. J Virol. 2004;78:11477–86. doi: 10.1128/JVI.78.21.11477-11486.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Coffey RG, Snella E, Johnson K, Pross S. Inhibition of macrophage nitric oxide production by tetrahydrocannabinol in vivo and in vitro. Int J Immunopharmacol. 1996;18:749–52. doi: 10.1016/s0192-0561(97)85557-9. [DOI] [PubMed] [Google Scholar]
  18. Costantino CM, Gupta A, Yewdall AW, Dale BM, Devi LA, Chen BK. Cannabinoid receptor 2-mediated attenuation of CXCR4-tropic HIV infection in primary CD4+ T cells. PLoS One. 2012;7:e33961. doi: 10.1371/journal.pone.0033961. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Devane WA, Hanus L, Breuer A, Pertwee RG, Stevenson LA, Griffin G, Gibson D, Mandelbaum A, Etinger A, Mechoulam R. Isolation and structure of a brain constituent that binds to the cannabinoid receptor. Science. 1992;258:1946–9. doi: 10.1126/science.1470919. [DOI] [PubMed] [Google Scholar]
  20. Ellery PJ, Tippett E, Chiu YL, Paukovics G, Cameron PU, Solomon A, Lewin SR, Gorry PR, Jaworowski A, Greene WC, Sonza S, Crowe SM. The CD16+ monocyte subset is more permissive to infection and preferentially harbors HIV-1 in vivo. J Immunol. 2007;178:6581–9. doi: 10.4049/jimmunol.178.10.6581. [DOI] [PubMed] [Google Scholar]
  21. Fischer-Smith T, Tedaldi EM, Rappaport J. CD163/CD16 coexpression by circulating monocytes/macrophages in HIV: potential biomarkers for HIV infection and AIDS progression. AIDS Res Hum Retroviruses. 2008;24:417–21. doi: 10.1089/aid.2007.0193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Galiègue S, Mary S, Marchand J, Dussossoy D, Carrière D, Carayon P, Bouaboula M, Shire D, Le Fur G, Casellas P. Expression of central and peripheral cannabinoid receptors in human immune tissues and leukocyte subpopulations. Eur J Biochem. 1995;232:54–61. doi: 10.1111/j.1432-1033.1995.tb20780.x. [DOI] [PubMed] [Google Scholar]
  23. Gendelman HE, Orenstein JM, Martin MA, Ferrua C, Mitra R, Phipps T, Wahl LA, Lane HC, Fauci AS, Burke DS. Efficient isolation and propagation of human immunodeficiency virus on recombinant colony-stimulating factor 1-treated monocytes. J Exp Med. 1988;167:1428–41. doi: 10.1084/jem.167.4.1428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Grotenhermen F. Pharmacokinetics and pharmacodynamics of cannabinoids. Clin Pharmacokinet. 2003;42:327–60. doi: 10.2165/00003088-200342040-00003. [DOI] [PubMed] [Google Scholar]
  25. Han KH, Lim S, Ryu J, Lee CW, Kim Y, Kang JH, Kang SS, Ahn YK, Park CS, Kim JJ. CB1 and CB2 cannabinoid receptors differentially regulate the production of reactive oxygen species by macrophages. Cardiovasc Res. 2009;84:378–86. doi: 10.1093/cvr/cvp240. [DOI] [PubMed] [Google Scholar]
  26. Henstridge CM, Balenga NA, Kargl J, Andradas C, Brown AJ, Irving A, Sanchez C, Waldhoer M. Minireview: recent developments in the physiology and pathology of the lysophosphatidylinositol-sensitive receptor GPR55. Mol Endocrinol. 2011;25:1835–48. doi: 10.1210/me.2011-1197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Ho BT, Fritchie GE, Kralik PM, Englert LF, McIsaac WM, Idänpään-Heikkilä J. Distribution of tritiated-1 delta 9tetrahydrocannabinol in rat tissues after inhalation. J Pharm Pharmacol. 1970;22:538–9. doi: 10.1111/j.2042-7158.1970.tb10563.x. [DOI] [PubMed] [Google Scholar]
  28. Huemer HP, Lassnig C, Bernhard D, Sturm S, Nowotny N, Kitchen M, Pavlic M. Cannabinoids lead to enhanced virulence of the smallpox vaccine (vaccinia) virus. Immunobiology. 2011;216:670–7. doi: 10.1016/j.imbio.2010.11.001. [DOI] [PubMed] [Google Scholar]
  29. Hunt PW. HIV and inflammation: mechanisms and consequences. Curr HIV/AIDS Rep. 2012;9:139–47. doi: 10.1007/s11904-012-0118-8. [DOI] [PubMed] [Google Scholar]
  30. Johnston SH, Lobritz MA, Nguyen S, Lassen K, Delair S, Posta F, Bryson YJ, Arts EJ, Chou T, Lee B. A quantitative affinity-profiling system that reveals distinct CD4/CCR5 usage patterns among human immunodeficiency virus type 1 and simian immunodeficiency virus strains. J Virol. 2009;83:11016–26. doi: 10.1128/JVI.01242-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Keele BF, Giorgi EE, Salazar-Gonzalez JF, Decker JM, Pham KT, Salazar MG, Sun C, Grayson T, Wang S, Li H, Wei X, Jiang C, Kirchherr JL, Gao F, Anderson JA, Ping LH, Swanstrom R, Tomaras GD, Blattner WA, Goepfert PA, Kilby JM, Saag MS, Delwart EL, Busch MP, Cohen MS, Montefiori DC, Haynes BF, Gaschen B, Athreya GS, Lee HY, Wood N, Seoighe C, Perelson AS, Bhattacharya T, Korber BT, Hahn BH, Shaw GM. Identification and characterization of transmitted and early founder virus envelopes in primary HIV-1 infection. Proc Natl Acad Sci U S A. 2008;105:7552–7. doi: 10.1073/pnas.0802203105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Klein TW, Newton CA, Widen R, Friedman H. The effect of delta-9-tetrahydrocannabinol and 11-hydroxy-delta-9-tetrahydrocannabinol on T-lymphocyte and B-lymphocyte mitogen responses. J Immunopharmacol. 1985;7:451–66. doi: 10.3109/08923978509026487. [DOI] [PubMed] [Google Scholar]
  33. Kreuz DS, Axelrod J. Delta-9-tetrahydrocannabinol: localization in body fat. Science. 1973;179:391–3. doi: 10.1126/science.179.4071.391. [DOI] [PubMed] [Google Scholar]
  34. Lentz MR, Kim WK, Kim H, Soulas C, Lee V, Venna N, Halpern EF, Rosenberg ES, Williams K, González RG. Alterations in brain metabolism during the first year of HIV infection. J Neurovirol. 2011;17:220–9. doi: 10.1007/s13365-011-0030-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Lynn AB, Herkenham M. Localization of cannabinoid receptors and nonsaturable high-density cannabinoid binding sites in peripheral tissues of the rat: implications for receptor-mediated immune modulation by cannabinoids. J Pharmacol Exp Ther. 1994;268:1612–23. [PubMed] [Google Scholar]
  36. Matsuda LA, Lolait SJ, Brownstein MJ, Young AC, Bonner TI. Structure of a cannabinoid receptor and functional expression of the cloned cDNA. Nature. 1990;346:561–4. doi: 10.1038/346561a0. [DOI] [PubMed] [Google Scholar]
  37. McMahon SB, Monroe JG. The role of early growth response gene 1 (egr-1) in regulation of the immune response. J Leukoc Biol. 1996;60:159–66. doi: 10.1002/jlb.60.2.159. [DOI] [PubMed] [Google Scholar]
  38. Medveczky MM, Sherwood TA, Klein TW, Friedman H, Medveczky PG. Delta-9 tetrahydrocannabinol (THC) inhibits lytic replication of gamma oncogenic herpesviruses in vitro. BMC Med. 2004;2:34. doi: 10.1186/1741-7015-2-34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Millard AL, Mertes PM, Ittelet D, Villard F, Jeannesson P, Bernard J. Butyrate affects differentiation, maturation and function of human monocyte-derived dendritic cells and macrophages. Clin Exp Immunol. 2002;130:245–55. doi: 10.1046/j.0009-9104.2002.01977.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Molina PE, Amedee A, LeCapitaine NJ, Zabaleta J, Mohan M, Winsauer P, Vande Stouwe C. Cannabinoid neuroimmune modulation of SIV disease. J Neuroimmune Pharmacol. 2011a;6:516–27. doi: 10.1007/s11481-011-9301-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Molina PE, Winsauer P, Zhang P, Walker E, Birke L, Amedee A, Stouwe CV, Troxclair D, McGoey R, Varner K, Byerley L, LaMotte L. Cannabinoid administration attenuates the progression of simian immunodeficiency virus. AIDS Res Hum Retroviruses. 2011b;27:585–92. doi: 10.1089/aid.2010.0218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Newton CA, Klein TW. Cannabinoid 2 (CB2) receptor involvement in the down-regulation but not up-regulation of serum IgE levels in immunized mice. J Neuroimmune Pharmacol. 2012;7:591–8. doi: 10.1007/s11481-012-9361-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Nichols S, Lowe A, Zhange X, Garvie P, Thornton S, Goldberger B, Hou W, Goodenow M, Sleasman J. Concordance between self-reported substance use and toxicoogy among HIV-infected and unifected at risk youth. Adolescent substance use: self-report vs blood toxicology: Durg and Alcohol Dependence. 2013 doi: 10.1016/j.drugalcdep.2013.11.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. O’Connell O, Repik A, Reeves JD, Gonzalez-Perez MP, Quitadamo B, Anton ED, Duenas-Decamp M, Peters P, Lin R, Zolla-Pazner S, Corti D, Wallace A, Wang S, Kong XP, Lu S, Clapham PR. Efficiency of bridging-sheet recruitment explains HIV-1 R5 envelope glycoprotein sensitivity to soluble CD4 and macrophage tropism. J Virol. 2013;87:187–98. doi: 10.1128/JVI.01834-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Raborn ES, Cabral GA. Cannabinoid inhibition of macrophage migration to the transactivating (Tat) protein of HIV-1 is linked to the CB(2) cannabinoid receptor. J Pharmacol Exp Ther. 2010;333:319–27. doi: 10.1124/jpet.109.163055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Raborn ES, Marciano-Cabral F, Buckley NE, Martin BR, Cabral GA. The cannabinoid delta-9-tetrahydrocannabinol mediates inhibition of macrophage chemotaxis to RANTES/CCL5: linkage to the CB2 receptor. J Neuroimmune Pharmacol. 2008;3:117–29. doi: 10.1007/s11481-007-9077-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Ramirez SH, Reichenbach NL, Fan S, Rom S, Merkel SF, Wang X, Ho WZ, Persidsky Y. Attenuation of HIV-1 replication in macrophages by cannabinoid receptor 2 agonists. J Leukoc Biol. 2013;93:801–10. doi: 10.1189/jlb.1012523. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Rinehart JJ, Wuest D, Ackerman GA. Corticosteroid alteration of human monocyte to macrophage differentiation. J Immunol. 1982;129:1436–40. [PubMed] [Google Scholar]
  49. Rotheram-Borus MJ, Murphy DA, Coleman CL, Kennedy M, Reid HM, Cline TR, Birnbaum JM, Futterman D, Levin L, Schneir A, Chabon B, O’Keefe Z, Kipke M. Risk Acts, Health Care, and Mdical Adherence Among HIV+ Youths in Care over Time. AIDS and Behavior. 1997;1:43–52. [Google Scholar]
  50. Ryrfeldt A, Ramsay CH, Nilsson IM, Widman M, Agurell S. Whole-body autoradiography of 1-tetrahydrocannabinol and 1(6)-tetrahydrocannabinol in mouse. Pharmacokinetic aspects of 1-tetrahydrocannabinol and its metabolites. Acta Pharm Suec. 1973;10:13–28. [PubMed] [Google Scholar]
  51. Sevigny EL. Is today’s marijuana more potent simply because it’s fresher? Drug Test Anal. 2013;5:62–7. doi: 10.1002/dta.1430. [DOI] [PubMed] [Google Scholar]
  52. Shivers SC, Newton C, Friedman H, Klein TW. delta 9-Tetrahydrocannabinol (THC) modulates IL-1 bioactivity in human monocyte/macrophage cell lines. Life Sci. 1994;54:1281–9. doi: 10.1016/0024-3205(94)00856-6. [DOI] [PubMed] [Google Scholar]
  53. Springs AE, Karmaus PW, Crawford RB, Kaplan BL, Kaminski NE. Effects of targeted deletion of cannabinoid receptors CB1 and CB2 on immune competence and sensitivity to immune modulation by Delta9-tetrahydrocannabinol. J Leukoc Biol. 2008;84:1574–84. doi: 10.1189/jlb.0508282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Surdo M, Balestra E, Saccomandi P, Di Santo F, Montano M, Di Carlo D, Sarmati L, Aquaro S, Andreoni M, Svicher V, Perno CF, Ceccherini-Silberstein F. Inhibition of dual/mixed tropic HIV-1 isolates by CCR5-inhibitors in primary lymphocytes and macrophages. PLoS One. 2013;8:e68076. doi: 10.1371/journal.pone.0068076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Tang JL, Lancz G, Specter S. Delta-9-tetrahydrocannabinol-(THC)-mediated inhibition of macrophage macromolecular metabolism is antagonized by human serum proteins and by cell surface proteins. Int J Immunopharmacol. 1993;15:665–72. doi: 10.1016/0192-0561(93)90139-p. [DOI] [PubMed] [Google Scholar]
  56. Theodore TS, Englund G, Buckler-White A, Buckler CE, Martin MA, Peden KW. Construction and characterization of a stable full-length macrophage-tropic HIV type 1 molecular clone that directs the production of high titers of progeny virions. AIDS Res Hum Retroviruses. 1996;12:191–4. doi: 10.1089/aid.1996.12.191. [DOI] [PubMed] [Google Scholar]
  57. Tuttle DL, Anders CB, Aquino-De Jesus MJ, Poole PP, Lamers SL, Briggs DR, Pomeroy SM, Alexander L, Peden KW, Andiman WA, Sleasman JW, Goodenow MM. Increased replication of non-syncytium-inducing HIV type 1 isolates in monocyte-derived macrophages is linked to advanced disease in infected children. AIDS Res Hum Retroviruses. 2002;18:353–62. doi: 10.1089/088922202753519133. [DOI] [PubMed] [Google Scholar]
  58. Tuttle DL, Harrison JK, Anders C, Sleasman JW, Goodenow MM. Expression of CCR5 increases during monocyte differentiation and directly mediates macrophage susceptibility to infection by human immunodeficiency virus type 1. J Virol. 1998;72:4962–9. doi: 10.1128/jvi.72.6.4962-4969.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Vindenes V, Strand DH, Kristoffersen L, Boix F, Mørland J. Has the intake of THC by cannabis users changed over the last decade? Evidence of increased exposure by analysis of blood THC concentrations in impaired drivers. Forensic Sci Int. 2013;226:197–201. doi: 10.1016/j.forsciint.2013.01.017. [DOI] [PubMed] [Google Scholar]
  60. Wallet MA, Reist CM, Williams JC, Appelberg S, Guiulfo GL, Gardner B, Sleasman JW, Goodenow MM. The HIV-1 protease inhibitor nelfinavir activates PP2 and inhibits MAPK signaling in macrophages: a pathway to reduce inflammation. J Leukoc Biol. 2012;92:795–805. doi: 10.1189/jlb.0911447. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Wallet MA, Rodriguez CA, Yin L, Saporta S, Chinratanapisit S, Hou W, Sleasman JW, Goodenow MM. Microbial translocation induces persistent macrophage activation unrelated to HIV-1 levels or T-cell activation following therapy. AIDS. 2010;24:1281–90. doi: 10.1097/QAD.0b013e328339e228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Watzl B, Scuderi P, Watson RR. Marijuana components stimulate human peripheral blood mononuclear cell secretion of interferon-gamma and suppress interleukin-1 alpha in vitro. Int J Immunopharmacol. 1991;13:1091–7. doi: 10.1016/0192-0561(91)90160-9. [DOI] [PubMed] [Google Scholar]
  63. Whyte LS, Ryberg E, Sims NA, Ridge SA, Mackie K, Greasley PJ, Ross RA, Rogers MJ. The putative cannabinoid receptor GPR55 affects osteoclast function in vitro and bone mass in vivo. Proc Natl Acad Sci U S A. 2009;106:16511–6. doi: 10.1073/pnas.0902743106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Williams DW, Eugenin EA, Calderon TM, Berman JW. Monocyte maturation, HIV susceptibility, and transmigration across the blood brain barrier are critical in HIV neuropathogenesis. J Leukoc Biol. 2012;91:401–15. doi: 10.1189/jlb.0811394. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Zhang X, Wang JF, Kunos G, Groopman JE. Cannabinoid modulation of Kaposi’s sarcoma-associated herpesvirus infection and transformation. Cancer Res. 2007;67:7230–7. doi: 10.1158/0008-5472.CAN-07-0960. [DOI] [PubMed] [Google Scholar]
  66. Zheng ZM, Specter S, Friedman H. Inhibition by delta-9-tetrahydrocannabinol of tumor necrosis factor alpha production by mouse and human macrophages. Int J Immunopharmacol. 1992;14:1445–52. doi: 10.1016/0192-0561(92)90017-f. [DOI] [PubMed] [Google Scholar]

RESOURCES