Skip to main content
PLOS One logoLink to PLOS One
. 2014 May 16;9(5):e95458. doi: 10.1371/journal.pone.0095458

Rapid Development of Microsatellite Markers for Callosobruchus chinensis Using Illumina Paired-End Sequencing

Can-xing Duan 1, Dan-dan Li 1, Su-li Sun 1, Xiao-ming Wang 1, Zhen-dong Zhu 1,*
Editor: Kun Yan Zhu2
PMCID: PMC4023940  PMID: 24835431

Abstract

Background

The adzuki bean weevil, Callosobruchus chinensis L., is one of the most destructive pests of stored legume seeds such as mungbean, cowpea, and adzuki bean, which usually cause considerable loss in the quantity and quality of stored seeds during transportation and storage. However, a lack of genetic information of this pest results in a series of genetic questions remain largely unknown, including population genetic structure, kinship, biotype abundance, and so on. Co-dominant microsatellite markers offer a great resolving power to determine these events. Here, we report rapid microsatellite isolation from C. chinensis via high-throughput sequencing.

Principal Findings

In this study, 94,560,852 quality-filtered and trimmed reads were obtained for the assembly of genome using Illumina paired-end sequencing technology. In total, the genome with total length of 497,124,785 bp, comprising 403,113 high quality contigs was generated with de novo assembly. More than 6800 SSR loci were detected and a suit of 6303 primer pair sequences were designed and 500 of them were randomly selected for validation. Of these, 196 pair of primers, i.e. 39.2%, produced reproducible amplicons that were polymorphic among 8 C. chinensis genotypes collected from different geographical regions. Twenty out of 196 polymorphic SSR markers were used to analyze the genetic diversity of 18 C. chinensis populations. The results showed the twenty SSR loci were highly polymorphic among these populations.

Conclusions

This study presents a first report of genome sequencing and de novo assembly for C. chinensis and demonstrates the feasibility of generating a large scale of sequence information and SSR loci isolation by Illumina paired-end sequencing. Our results provide a valuable resource for C. chinensis research. These novel markers are valuable for future genetic mapping, trait association, genetic structure and kinship among C. chinensis.

Introduction

The adzuki bean weevil, Callosobruchus chinensis (L.), is one of the most destructive pests of leguminous stored seeds in Asia. C. chinensis larvae utilize a variety of dried legume seeds as their hosts, primarily Vigna species and genera such as Cajanus and Lens [1], [2]. This insect often causes considerable damage to stored mungbean (Vigna radiata L.), cowpea (Vigna unguiculata L.), adzuki bean (Vigna angularis Ohwi & Ohashi), faba bean (Vicia faba L.), pea (Pisum sativum L.), chickpea (Cicer arietinum L.), soybean (Glycine max L. Merr.) and lotus seed (Nelumbo nucifere Gaertn.). Usually, this beetle causes 32∼64% Vigna seeds loss during transportation and storage and infestation rate may reach 100% with 3–5 months of storage [3], [4], which results in loss of mass and low germination rate and makes them unfit for human consumption or for agricultural and commercial use [5].

Microsatellites or simple sequence repeats (SSRs) are tandemly repeated motifs of one to six bases found in the nuclear genomes of all eukaryotes tested and are often abundant and evenly dispersed [6]–[8]. Microsatellite sequences are usually characterized by a high degree of length polymorphism, and are ideal single-locus co-dominant markers for genetical studies. Microsatellites are the most frequently used DNA markers in many areas of research because of their high abundance, multi-allelic nature, high polymorphism rates, and rapid detection of the alleles by wide variety of methods [9]–[11].

However, their availability and quality are limited by the difficulties of de novo development in organisms without available genomic information. Up to date, none of SSR loci as well as other makers such as AFLP, RAPD and AFLP in C. chinensis has been isolated and identified, which results in a large number of genetic information related to C. chinensis has not been revealed. The most commonly used procedure for microsatellite isolation is enrichment of genomic DNA in microsatellite motifs, followed by cloning and sequencing of the enriched DNA library by the Sanger method, which is difficult, time-consuming and costly. Enrichment methods use a few specific repeated motifs, generally selected without prior knowledge of their abundance in the genome [12], hence introducing potential bias in genome representativeness.

Recently developed next-generation sequencing (NGS) platforms such as SOLiD (ABI, Norwalk, CT), 454 GS FLX (Roche, Penzberg, Germany), and Illumina Genome Analyzer (Illumina, San Diego, CA) can facilitate high-throughput genome sequencing of both noncoding and coding regions, including large scale resequencing in well-characterized species or de novo transcriptome sequencing for species without reference sequences. These technologies are capable of generating a large number of reads at a relatively low cost. The huge amounts of sequence data produced on these high-throughput platforms can be used to identify a great quantity of genetic markers [13]–[17].

In the past few years, the 454 pyrosequencing has been preferred for non-model organisms [18]–[21] due to its longer read length than Illumina sequencing. With shorter read length, Illumina platform was at first confined to re-sequencing applications which rely on a reference sequence. Recently, with increased read length by Illumina technology improvement and development of new computational tools, short reads can be assembled and used for transcriptome or genome analysis. Illumina sequences now can produce moderately long reads (up to 150 bp with the GAIIx, and 100 bp with the HiSeq 2000) and accommodate paired-end sequencing from both ends of ∼200–600 bp fragments. There have also been massive increases in the number of reads obtained per Illumina sequencing run. Furthermore, compared with relatively constant cost of 454 sequencing, the cost of obtaining Illumina sequence data has dropped substantially [22]. De novo assemblies using sequence reads from Illumina technology have been reported in many non-model organisms without a reference sequence [23]–[27]. To take advantage of these advances, we utilized Illumina paired-end sequencing to isolate SSR loci rapidly and massively.

To the best of our knowledge, this is the first systematic report on development of microsatellite markers of adzuki bean weevil with de novo assembly using Illumina paired-end sequencing. The present study identified a large scale of putative SSR loci efficiently and inexpensively using Illumina HiSeq 2500 platform. The resulting SSR sequences were characterized and validated through successful amplification of randomly selected target loci across a selection of adzuki bean weevil genotypes from diverse geographic regions.

Materials and Methods

Insect Material

The adzuki bean weevil male adults for genome sequencing were collected from infected mungbean stored at the Institute of Crop Science (ICS), Chinese Academy of Agricultural Sciences (CAAS), Beijing. The C. chinensis genotypes for polymorphism detection and genetic diversity were collected from eight and eighteen different regions, respectively (Table 1 and Table 2).

Table 1. The information of 8 Callosobruchus chinensis genotypes used in polymorphism test of SSR markers.

Populationcode Number ofindividuals Occurrence location Collectiontime Host
DZ 30 Dengzhou, Henan 2012 mungbean
FC 30 Fuchuan, Guangxi 2012 mungbean
HH 30 Hohhot, Inner Mongolia 2012 mungbean
MT 30 Mengtougou, Beijing 2013 adzuki bean
QD 30 Qingdao, Shandong 2013 mungbean
TS 30 Tangshan, Hebei 2013 adzuki bean
UM 30 Urumuqi, Xinjiang 2012 mungbean
WL 30 Wulong, Chongqing 2012 mungbean

Table 2. The information of 18 Callosobruchus chinensis populations used in genetic diversity analysis.

Populationcode Number ofindividuals Occurrence location Collectiontime Host
BB 20 Bobai, Guangxi 2012 mungbean
BD 20 Baoding, Hebei 2013 adzuki bean
DX 20 Daxin, Guangxi 2012 mungbean
DZ 20 Dengzhou, Henan 2012 mungbean
HF 20 Hefei, Anhui 2012 mungbean
HH 20 Hohhot, Inner Mongolia 2012 mungbean
JC 20 Jiangchuan, Yunnan 2012 mungbean
LC 20 Lingchuan, Shanxi 2013 adzuki bean
LL 20 Luliang, Yunnan 2012 mungbean
LS 20 Lishui, Jiangsu 2013 adzuki bean
MC 20 Mengcheng, Anhui 2012 mungbean
QD 20 Qingdao, Shandong 2013 mungbean
QJ 20 Qianjiang, Chongqing 2012 mungbean
RD 20 Rudong, Jiangsu 2012 adzuki bean
TS 20 Tangshan, Hebei 2013 adzuki bean
UM 20 Urumuqi, Xinjiang 2012 mungbean
XY 20 Xinye, Henan 2012 adzuki bean
YY 20 Yangyuan, Hebei 2013 mungbean

DNA Isolation, Quantification and Qualification

Total genomic DNA of single male adult with belly removal was extracted with TIANamp Genomic DNA Kit according to the manufacturer’s instructions (TIANGEN, Beijing, China). The quality of extracted DNA was monitored on 1.5% agarose gels. DNA purity was checked using the NanoPhotometer spectrophotometer (IMPLEN, San Diego, CA). DNA concentration was measured using Qubit DNA Assay Kit in Qubit 2.0 Flurometer (Life Technologies, San Diego, CA). Fragment distribution of DNA library was measured using the DNA Nano 6000 Assay Kit of Agilent Bioanalyzer 2100 system (Agilent Technologies, San Diego, CA).

DNA Library Preparation for Sequencing

A total amount of 3 µg genomic DNA per sample was used as input material for the DNA sample preparation. Sequencing libraries were generated using Illumina Truseq DNA Sample Preparation Kit (Illumina, San Diego, CA) following manufacturer’s recommendations and x index codes were added to attribute sequences to each sample. Briefly, fragmentation was carried out by hydrodynamic shearing system (Covaris, Woburn, MA) to generate <800 bp fragments. Remaining overhangs were converted into blunt ends via exonuclease/polymerase activities and enzymes were removed. After adenylation of 3′ ends of DNA fragments, Illumina PE adapter oligonucleotides were ligated to prepare for hybridization. In order to select DNA fragments of preferentially 500 bp in length, agarose electrophoresis was performed (120V, 40 min, 1.5% agarose) and adapter-ligated constructs derived from 620 bp to 670 bp was separated. After purification using spin column (QIAGEN, Dusseldorf, Germany), DNA fragments with ligated adapter molecules on both ends were selectively enriched using Illumina PCR Primer (F: 5′-AATGATACGGCGACCACCGAGA-3′ and R: 5′-CAAGCAGAAGACGGCATACGAGT-3′) Cocktail in a PCR reaction with 10 cycles. Products were purified using AMPure XP system (Beckman Coulter, Beverly, MA) and quantified using the Agilent high sensitivity DNA assay on the Agilent Bioanalyzer 2100 system.

Clustering and Sequencing

The clustering of the index-coded samples was performed on a cBot Cluster Generation System using TruSeq PE Cluster Kit v3-cBot-HS (Illumia, San Diego, CA) according to the manufacturer’s instructions. After cluster generation, the library preparations were sequenced on an Illumina Hiseq 2500 PE150 platform (Illumina, San Diego, CA) and 150 bp paired-end reads were generated. The sequencing data have been submitted to the National Center for Biotechnology Information (NCBI) short read archive (SRA) and given the accession numbers SRR949786 and SRR952345.

Data Filtering, De Novo Assembly and Decontamination

Before the genome assembly, we carried out a stringent filtering process of raw sequencing reads. The reads with more than 10% of bases with a quality score of Q<20, or the paired reads if the N content of a single read exceeds 10% of the read length, ambiguous sequences represented as “N” and adaptor contamination were removed. De novo genome assembly was performed by de Bruijn graph and SOAPdenovo [28] software package with the default settings except K-mer value. The high-quality reads were loaded into the computer, and then de Bruijn graph data structure was used to represent the overlap among the reads. After adjusting for various parameters, an 87-mer assembly was finally selected. In order to ensure the accuracy and validity of the SSR search, the contigs less than 500 bp length were filtered out.

In view of the fact that some Wolbachia strains are the endosymbionts living in the cytoplasm of bean beetles, such as C. chinensis and Callosobruchus analis [29], [30], the sequencing data of C. chinensis were likely to be contaminated with Wolbachia’s sequences, hence decontamination had to be performed. First, re-assembly should be performed after removal of the Wolbachia sequences from the valid sequencing data. Specifically, based on the distribution plot of contig depth and GC content, contigs with a depth greater than 50× (contamination contigs) were extracted and cut into the 87-mer fragments. The fragments were aligned with the valid sequence data and the matched reads were removed. Second, the reassembled C. chinensis genome was aligned with records in bacterial and fungal genome databases and the matched contigs were also removed.

SSR Loci Search and Primer Design

Potential SSR markers were detected among the assembled genome using the MISA tool [31] (http://pjrc.ipk-gatersleben.de/misa/). We searched for SSRs with motifs ranging from monoto hexa-nucleotides in size. The minimum of repeat units were set as follows: ten repeat units for mono-nucleotide, six for dinucleotides and five for tri-, tetra-, penta- and hexa-nucelotides. Mono-nucleotide repeats were discarded in that it was difficult to distinguish genuine mono-nucleotide repeats from polyadenylation products and some mono-nucleotide repeats were generated by base mismatch or sequencing errors. Primer pairs were designed using Primer3 [32] (http://fokker.wi.mit.edu/primer3/) with default parameters.

SSR Marker Polymorphism Detection and Assessment

Five hundred randomly selected primer pairs were synthesized (Sangon Biotech, Beijing, China) for polymorphism detection among 8 C. chinensis genotypes (Table 1). Polymerase chain reactions (PCR) were carried out in 10 µL reaction volumes containing 10 mmol/L Tris-HCl pH 8.3, 50 mmol/L KCl, 1.5 mM MgCl, 250 mM each of dNTPs, 0.2 M of each primers, 0.5 U Taq polymerase (Dingguo, Beijing, China) and 30 ng of DNA template. Reactions were performed using a GeneAmp PCR System 9700 thermal cycler (ABI, Norwalk, CT) programmed as 94°C for 4 min, followed by 35 cycles of 94°C for 30 s, 50–60°C (it depends optimized annealing temperature) for 30 s and 72°C for 60 s. The final extension was performed at 72°C for 10 min. The PCR products were analyzed by electrophoresis on 8.0% non-denaturing polyacrylamide gels and silver stained [33]. The band sizes were determined roughly based on 100 bp DNA ladder (TIANGEN, Beijing, China).

The genotyping data was subsequently used to determine genetic relationships among 18 diverse C. chinensis populations collected from different regions (Table 2). The number of alleles (Na), expected heterozygosity (He), observed heterozygosity (Ho) and Shannon’s information index (I) were calculated using POPGEN1.32 software [34], [35]. Using the MEGA 4 software, based on Nei’s genetic distance, a phylogenetic tree was constructed using the neighbor-joining clustering method [36].

Results

Illumina Sequencing and Quality Control

The paired-end sequencing yielded 2×150-bp reads from either end of the DNA fragment. In this study, a total of 32 Gb of raw sequencing data, comprising 106,888,024 raw sequencing reads were generated from a 300 bp insert library. After stringent quality assessment and data filtering, 94,560,852 (88.47%) clean reads with Q20 bases (those with a base quality greater than 20) were deemed as high quality reads and used for further analysis. The sequences have been deposited in NCBI. Output data are shown in Table 3, in which Bpis2 was an additional sequencing data, indicating it was a high-quality (Q20≥96%, Q30≥91%) sequencing and had a normal sequencing error rate (0.04–0.06%) (Figure S1 and Figure S2).

Table 3. Summary of adzuki bean weevil sequencing data output.

Samples ID Rawreads Effectiverate (%) Clearreads Q20 (%) Q30 (%) GCContent (%)
Bpis1 52,566,784 88.64 46,595,197 98.81; 96.42 96.38; 91.83 36.76; 36.75
Bpis2 54,321,240 88.30 47,965,654 98.73; 96.27 96.16; 91.47 36.75; 36.74

Notes: Effective rate (%) = clear reads/raw reads×100, Q20 and Q30 refer to the values of quality of sequencing data.

In order to detect whether the sequences were contaminated by endosymbiont sequences, part of the valid sequencing data were analyzed by BLAST against NCBI nucleotide database (NT) and found that 1.54% and 1.57% of the sequencing data were associated with the genus Wolbachia, respectively, indicating that bacterial contamination was present in the samples. Therefore, decontamination has to be performed in order for veritable assembly of the C. chinensis genome.

Genome De Novo Assembly and Decontamination

The 94,560,852 high-quality clean reads were used to assemble the genome of C. chinensis with SOAPdenovo software. According to the overlapping information of high-quality reads, an 87-mer assembly was finally selected and the assembled C. chinensis genome was generated with the total length of 499,585,451 bp, comprising of 405,744 contigs with an average length of 1237 bp, a N50 of 1439 bp, N90 of 608 bp and 36.47% of GC content.

The GC content scatterplot showing only one species will show a concentrated distribution. Taking account of sequencing data probably contained bases from the genus Wolbachia, the GC distribution was analyzed in order to determine whether the assembly contained contamination from non-target species or not. In the scatterplot of contigs depth against GC content, the points were divided into three parts (Figure S3). A BLAST analysis of the contigs sequence of each part to the nucleotide database showed that contigs with a depth greater than 50 were contaminated with bacteria.

To facilitate better and authentic assembly of the C. chinensis genome, decontamination analysis was carried out (Table S1 and Table 4). Finally, the assembled C. chinensis genome was obtained with the total length of 497,124,785 bp, comprising of 403,113 contigs (Table 5). The Adenine, thymine, cytosine and guanine content and the abundance in C. chinensis genome are shown in Table 6. The coverage of contigs assembled with decontaminated clean reads reaches 99.12%, with an average sequencing depth of about 20× (Figure 1). A scatterplot of the sequencing depth against the GC content was generated and the vast majority of the points appeared in a relatively narrow range, indicating the final assembled genome was free of contamination (Figure 2).

Table 4. Re-assembly of adzuki bean weevil genome after decontamination.

Sample ID Totallength(bp) Contigs number N50 (bp) N90 (bp) GC(%)
Bpis 499,585,451 403,617 1,439 608 36.48

Table 5. Final assembly of adzuki bean weevil genome.

Sample ID Totallength(bp) Contigsnumber N50 (bp) N90 (bp) GC(%)
Bpis 497,124,785 403,113 1,432 606 36.48

Table 6. The base content in adzuki bean weevil genome.

Base Type Number (bp) % of Genome
Adenine (A) 157,892,519 31.76
Thymine (T) 157,873,741 31.76
Cytosine (C) 90,693,363 18.24
Guanine (G) 90,665,162 18.24
GC 36.48%
Total 497,124,785

Figure 1. Distribution of sequencing depth.

Figure 1

Figure 2. Distribution between GC content and sequencing depth.

Figure 2

Identification of SSR Loci

After MISA analysis, a total of 6,593 potential simple sequence repeats (SSRs) were identified with the length of 12–64 bp. The majority of the SSR sequences were from 12 to 25 bp in length, accounting for 98.62% of the total identified SSR loci (Figure 3). Of these, the most frequently detected SSR sequences in C. chinensis consisted of the motif of trinucleotide repeats, with 70.02% of abundance, followed by tetranucleotide (16.35%) and dinucleotide repeats (11.80%) (Figure 4A). The length of SSR motifs ranged from 2 to 6 bp and the most common type of SSR motifs comprised tetranucleotide repeats, followed by pentanucleotide and trinucleotide (Figure 4B). More than 6800 SSR loci were detected and a total of 6,303 primer pairs were designed by Primer3 (Table S2) for future assessment of validity by locus amplification.

Figure 3. Distribution between SSR length and number of SSRs.

Figure 3

Figure 4. Distribution of SSR motif.

Figure 4

(A) Distribution between SSR motif and number of SSRs. (B) Distribution between SSR motif and number of SSR motif type.

Validation of SSR Assay

Five hundred primer pairs were randomly selected to evaluate the rate of amplication and polymorphism in 8 diverse C. chinensis genotypes, of which 403 pairs (80.6%) successfully amplified clear fragments and 365 pairs (73.0%) produced PCR amplicons with the expected size. Of these, 196 pairs (39.2%) were polymorphic among 8 genotypes of C. chinensis (Figure 5 and Table S3). The genetic relationship among 18 diverse C. chinensis populations from different regions were performed using 20 polymorphic SSR pairs randomly selected from 196 pairs (Figure 6 and Table 7). The number of alleles (Na) per locus ranged from 4 to 13 with an average of 7.35, the expected heterozygosity (He) ranged from 0.0591 to 0.7868, and the observed heterozygosity (Ho) varied from 0.0075 to 0.6815. Shannon’s information index (I) values ranged from 0.1659 to 1.6831 with an average of 0.9545 (Table 8). Based on to Nei’s genetic distance, the dendrogram generated from the cluster analysis showed the genetic relationship among 18 C. chinensis populations. As shown in Figure 7, the 18 populations were classified into three distinct genetic groups at the genetic distance of 0.14 or so. The majority of populations were grouped into cluster I (RD, HF, OJ, BD, MC, DZ, LS, LC, UM, CQ, QD, YY and DX), while cluster II and cluster III included merely 2 (XY and HH) and 3 (TS, JC and BB) populations, respectively.

Figure 5. Polymorphism of primer CCM46 among 8 Callosobruchus chinensis genotypes.

Figure 5

Figure 6. SSR PCR amplification patterns of 20 Callosobruchus chinensis individuals from RD population using primer CCM46.

Figure 6

(M is the 100 bp DNA ladder marker).

Table 7. Characteristics of 20 polymorphic SSR markers used in genetic diversity analysis (F = forward primer, R = reverse primer, Size = size of cloned allele, Ta = annealing temperature).

Primer F (5′–3′) R (5′–3′) Size (bp) Ta (°C)
CCM1 TTGGTGCTAACGTACATGAAATGAA CTCGCATAACGACTTCATGGATTT 155 58
CCM2 CAGGACTGGACTGGACATGTGATA TGCTCAGCCTAATTCAACCTGTTT 156 55
CCM19 AGCTATCCTCATAATTGCTCACGG CCTCCTTATAAGTGCATTTGTTTGC 138 56
CCM25 AAACTCTTGCGTTAATTGTGCCAT TTTACTTGATGACTTGGCAGAGCC 99 55
CCM27 TGTGTTCTATCTAGCGTGACTGGG ATGCTTGTACATTTTGACTTGCCA 158 55
CCM29 CAATGGCATGTCCACCACTACT GATAAGCAATTGCCTCTTATCCCA 146 55
CCM40 AGGGGATATCGTGTTCTCTGTTCA GATCGAACCTCGAAGCAGAAGTT 115 55
CCM46 AACGGACAGACAGAGAGATAGTCAA TCTGTTTGTTTGCCTGTTTGC 134 55
CCM49 GTTGACCGTTGGACAATAAAGCTA TGTCACTACAATCGATTCGTCTCAT 145 55
CCM56 CCTAAGAGTTTCGTTTTTGCATGG GGCAAATTGAGCTCAGCATTAGAT 110 55
CCM65 GTACCGCGGGTACCTACGTACTTT GTGTTTACCGTTTTCAAACGCAG 81 55
CCM66 GGGCTAATCGCACAACTGTAAATC AAATAGCCAGGAGCTAGACTTCGC 141 58
CCM83 AGGGTTTTTCCCGTTTAACGATATT CGGATCTGGAAGCAGTTTTGTTTA 140 57
CCM108 ACTTAAATTACCCGGTGACGTGAA AACTTTTGTAAATCGCGCTCAAAG 131 55
CCM118 TTAATTCTGGTCCTGTTCCGTTTT TCTTCTAATCCCATGACTAGCTTCAC 130 55
CCM125 AGCGTGTTAAAAAGAGAGTGGACG TATTATTCTGCAGATGTGCCGCT 144 57
CCM149 CTTTGCAGTTACGAGAGACAGGGT TGCCAACCTTCTATAAGAACACGG 139 57
CCM154 TTGATCCTTTTCCTCCCAATAAAA TTCGTCCTCATATAGCACAAATGTT 145 53
CCM180 TACAACTGTAAATGGCGTTTGGCT GGCATTTCAACAAAAGTACGCTTC 116 55
CCM189 GGAAGTTGCATATGTGAAGTCCAA AGGATGCATTCTGTGTCATCTGTT 107 56

Table 8. Informativeness of SSR loci following amplification from 18 geographically diverse Callosobruchus chinensis populations in China.

Locus Na He Ho I
CCM1 9.0000 0.7455 0.2171 1.5977
CCM2 6.0000 0.0801 0.0597 0.2283
CCM19 4.0000 0.2564 0.2340 0.5288
CCM25 8.0000 0.5384 0.1929 1.0222
CCM27 13.0000 0.4222 0.2587 0.8954
CCM29 4.0000 0.3424 0.3885 0.6624
CCM40 6.0000 0.4502 0.3372 0.9405
CCM46 7.0000 0.6956 0.5059 1.4290
CCM49 7.0000 0.5437 0.5075 0.9823
CCM56 13.0000 0.6890 0.6815 1.5153
CCM65 4.0000 0.5212 0.3583 0.8078
CCM66 6.0000 0.2339 0.0800 0.5297
CCM83 9.0000 0.3247 0.2939 0.6864
CCM108 8.0000 0.5260 0.3360 0.9079
CCM118 9.0000 0.7868 0.3386 1.6831
CCM125 7.0000 0.4158 0.0075 0.7910
CCM149 5.0000 0.0591 0.0361 0.1659
CCM154 6.0000 0.6179 0.3431 1.1863
CCM180 9.0000 0.7292 0.4826 1.4833
CCM189 7.0000 0.5422 0.3034 1.0475

Notes: Number of alleles (Na), expected heterozygosity (He), observed heterozygosity (Ho) and Shannon’s information index (I).

Figure 7. Dendrogram for 18 populations of Callosobruchus chinensis in China based on 20 SSR loci (Population code see table 2).

Figure 7

Discussion

This study demonstrated that Illumina paired-end sequencing is capable of identifying massive numbers of potentially PCR-amplifiable SSR loci with relative low-cost. We find that on a read-by-read basis, Illumina paired-end sequences are effective for developing SSR markers in non-model organism such as C. chinensis. Compared with Roche GS FLX, the Illumina platform was originally utilized in the organisms with reference genomes [37]–[40]. With the rapid development of various NGS technologies along with a series of novel assembly methods in recent years, de novo sequencing and assembly of genome or transcriptome have been successfully used for model [41], [42] and non-model organisms [43]–[46]. Consistent with previous reports, the results from this research also suggested that short reads from Illumina sequencing can be effectively assembled and used for SSR marker development or gene identification in non-model organisms. In this study, more than 94 million high-quality clean reads were used to assemble the genome of C. chinensis. This large dataset resulted in a sequencing depth with an average of 20 folds. Finally, the adzuki bean weevil genome with length of 497,124,785 bp was obtained, comprising 403,113 contigs by means of quality-filtering, assembly, decontamination and reassembly.

No molecular maker is available in C. chinensis to date. In the previous research, based on the sequence variations of mitochondrial DNA (mtDNA), cytochrome coxidase I gene (COI), and the second internal transcribed spacer of nuclear ribosomal DNA (rDNA ITS2) rather than molecular marker, genetic relationship among C. chinensis populations was analyzed [47], [48], which was relatively time-consuming, costly and inconvenient. Nowadays, polymorphic SSR markers play an important role in genetic diversity research, linkage map construction, identification of varieties, comparative genomics and related analysis. The genome sequencing and assembly provided plenty of sequences for developing numerous markers in C. chinensis. We performed a general screen on C. chinensis genome for the presence of microsatellites. Based on the de novo assembled genome, a total of 6,593 potential SSRs were isolated and identified with the most common SSR motifs of trinucleotide, tetranucleotide and dinucleotide repeats. The majority of the SSR sequences ranged from 12 to 25 bp in length, which was reasonable and similar to other reports [49], [50]. Given the types of SSR motifs and the large number of SSR loci identified in our study, future SSR marker isolation may be preferentially focused on those composing of trinucleotide repeats which have been demonstrated to be highly polymorphic and stably inherited in the human genome [51]–[53]. The tri-, tetra-, and dinucleotide repeats mostly contributed to the major proportion of SSRs in this study, while a very small share was contributed by penta- and hexa-nucleotide repeats.

In this study, 6,303 SSR markers were developed and a total of 500 primer pairs were used for assessment of the assembly quality and validity of markers. Of these, 365 pairs produced PCR amplicons with the expected size and 196 pairs were polymorphic among 8 C. chinensis genotypes. Most of the SSR primers generated high quality amplicons, suggesting that the genome sequencing and assembly were accurate, and SSR makers are valid and applicable.

Genetic diversity analysis among 18 different geologic populations based on 20 polymorphic SSR loci confirmed validity and usability of polymorphic SSR markers (Table 7). The average number of alleles and Shannon’s information index were 7.35 and 0.9545, respectively among the 20 microsatellite loci indicating that these primers provided abundant polymorphic information in 18 populations and uniform distribution of allele frequencies. Hence the genetic diversity analysis based on these SSR markers is reliable and informative. Gene heterozygosity is considered to be an optimum parameter to measure genetic variation within populations [54]. The average expected heterozygosity was 0.4760, suggesting moderate genetic diversity among the samples, which was likely to be caused by their high adaptability and frequent communication. Based on 20 polymorphic SSR loci, genetic relationship among 18 populations was clearly shown in dendrogram graph in spite that the level of genetic structure variation among populations was modest (Figure 7), indicating relatively high resolution power of SSR makers and applicability in phylogenetics.

All in all, development of SSR markers is useful to elucidate the population genetic structure, and to monitor migration and biotype abundance among adzuki bean weevil or sibling species such as cowpea weevil (Callosobruchus maculatus Fabricius) populations. In the meantime, these markers could be used for linkage map construction, gene mapping. Furthermore, the assembled genome will be beneficial to further research such as gene identification, annotation, and so on, which will certainly accelerate the research progress in molecular biology and genetics of adzuki bean weevil and find new measures to control it.

Conclusion

In this work, we reported a major advance in the identification of large numbers of informative SSR loci in C. chinensis. This is a great attempt to study genomic information and develop SSR markers of C. chinensis without reference genome using Illumina paired-end sequencing technology. Based on the de novo assembly genome, we developed 6,303 SSR markers, and some of which were verified their validity among diverse C. chinensis genotypes and populations. These results fully demonstrate that Illumina paired-end sequencing is a rapid and cost-effective approach for SSR markers development in non-model organism.

Supporting Information

Figure S1

Distribution of sequencing quality (Q20 and Q30 refer to the values of quality of sequencing data).

(PDF)

Figure S2

Distribution of sequencing error rate.

(PDF)

Figure S3

Distribution of GC content and contig depth.

(PDF)

Table S1

Decontamination of valid sequencing data.

(DOC)

Table S2

The primer pairs of Callosobruchus chinensis designed successfully by Primer3.

(XLS)

Table S3

Characteristics of 196 polymorphic SSR markers developed in Callosobruchus chinensis L.

(DOC)

Acknowledgments

We thank Beijing Novogene Bioinformatics Co., Ltd for the assistance in raw data processing. We also thank Dr. Tao Yang, Dr. Gang-gang Guo and Dr. Jing Wu for useful suggestions in data analyses and submission.

Funding Statement

This work was supported by the Public Welfare Special Fund (2060302-2-13) from Institute of Crop Sciences, CAAS and Modern Agro-industry Technology Research System (CARS-09) from the Ministry of Agriculture of China. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Nahdy MS, Ellis RH, Silim SN, Smith J (1998) Field infestation of pigeonpea (Cajanus cajan (L.) Millsp.) by Callosobruchus chinensis (L.) in Uganda. J Stored Prod Res 34: 207–216. [Google Scholar]
  • 2. Shinoda K, Yoshida T, Okamoto T (1991) Two wild leguminous host plants of the adzuki bean weevil, Callosobruchus chinensis (L.) (Coleoptera: Bruchidae). Appl Entomol Zool 26: 91–98. [Google Scholar]
  • 3. Mishra D, Shukla AK, Tripathi KK, Singh A, Dixit AK, et al. (2006) Efficacy of application of vegetable seed oils as grain protectant against infestation by Callosobruchus chinensis and its effect on milling fractions and apparent degree of dehusking of legume-pulses. J Oleo Sci 56: 1–7. [DOI] [PubMed] [Google Scholar]
  • 4. Chaubey MK (2008) Fumigant toxicity of essential oils from some common spices against pulse beetle, Callosobruchus chinensis (Coleoptera: Bruchidae). J Oleo Sci 57: 171–179. [DOI] [PubMed] [Google Scholar]
  • 5.Talekar NS (1988) Biology, damage and control of bruchid pests of mungbean. In Mungbean: Proceedings of the 2nd International Symposium. Edited by Shanmugasundaram S and McLean BT. AVRDC, Tainan, Taiwan. 329–342.
  • 6. Tautz D, Renz M (1984) Simple sequence repeats are ubiquitous repetitive components of eukaryotic genomes. Nucleic Acids Res 12: 4127–4138. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Lagercrantz U, Ellegren H, Andersson L (1993) The abundance of various polymorphic microsatellite motifs differs between plants and vertebrates. Nucleic Acids Res 21: 1111–1115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Ellegren H (2004) Microsatellites: simple sequences with complex evolution. Nat Rev Genet 5: 435–445. [DOI] [PubMed] [Google Scholar]
  • 9. Sunnucks P (2000) Efficient genetic markers for population biology. Trends Ecol Evol 15: 199–203. [DOI] [PubMed] [Google Scholar]
  • 10. Choudhary S, Sethy NK, Shokeen B, Bhatia S (2009) Development of chickpea EST-SSR markers and analysis of allelic variation across related species. Theor Appl Genet 118: 591–608. [DOI] [PubMed] [Google Scholar]
  • 11. Dutta S, Kumawat G, Singh BP, Gupta DK, Singh S, et al. (2011) Development of genic-SSR markers by deep transcriptome sequencing in pigeonpea [Cajanus cajan (L.) Millspaugh]. BMC Plant Biology 11: 17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Castoe TA, Poole AW, Gu W, Jason de Koning AP, Daza JM, et al. (2010) Rapid identification of thousands of copperhead snake (Agkistrodon contortrix) microsatellite loci from modest amounts of 454 shotgun genome sequence. Mol Ecol Resour 10: 341–347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Ossowski S, Schneeberger K, Clark RM, Lanz C, Warthmann N, et al. (2008) Sequencing of natural strains of Arabidopsis thaliana with short reads. Genome Res 18: 2024–2033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Varshney RK, Nayak SN, May GD, Jackson SA (2009) Next-generation sequencing technologies and their implications for crop genetics and breeding. Trends Biotechnol 27: 522–530. [DOI] [PubMed] [Google Scholar]
  • 15. Bai X, Zhang W, Orantes L, Jun TH, Mittapalli O, et al. (2010) Combining next-generation sequencing strategies for rapid molecular resource development from an invasive aphid species, Aphis glycines . PLoS One 5: e11370. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Garg R, Patel RK, Tyagi AK, Jain M (2011) De novo assembly of chickpea transcriptome using short reads for gene discovery and marker identification. DNA Res 18: 53–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Malausa T, Gilles A, Meglecz E, Blanquart H, Duthoy S, et al. (2011) High-throughput microsatellite isolation through 454 GS-FLX Titanium pyrosequencing of enriched DNA libraries. Mol Ecol Resour 11: 638–644. [DOI] [PubMed] [Google Scholar]
  • 18. Natarajan P, Parani M (2011) De novo assembly and transcriptome analysis of five major tissues of Jatropha curcas L. using GS FLX titanium platform of 454 pyrosequencing. BMC Genomics 12: 191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Parchman TL, Geist KS, Grahnen JA, Benkman CW, Buerkle CA (2010) Transcriptome sequencing in an ecologically important tree species: assembly, annotation, and marker discovery. BMC Genomics 11: 180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Wang H, Zhang H, Wong YH, Voolstra C, Ravasi T, et al. (2010) Rapid transcriptome and proteome profiling of a non-model marine invertebrate, Bugula neritina . Proteomics 10: 2972–2981. [DOI] [PubMed] [Google Scholar]
  • 21. Shahin A, van Gurp T, Peters SA, Visser RG, van Tuyl JM, et al. (2012) SNP markers retrieval for a non-model species: a practical approach. BMC Research Notes 5: 79. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Castoe TA, Poole AW, de Koning AP, Jones KL, Tomback DF, et al. (2012) Rapid microsatellite identification from Illumina paired-end genomic sequencing in two birds and a snake. PloS One 7: e30953. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Feldmeyer B, Wheat CW, Krezdorn N, Rotter B, Pfenninger M (2011) Short read Illumina data for the de novo assembly of a non-model snail species transcriptome (Radix balthica, Basommatophora, Pulmonata), and a comparison of assembler performance. BMC Genomics 12: 317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Mizrachi E, Hefer CA, Ranik M, Joubert F, Myburg AA (2010) De novo assembled expressed gene catalog of a fast-growing Eucalyptus tree produced by Illumina mRNA-Seq. BMC Genomics 11: 681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Li D, Deng Z, Qin B, Liu X, Men Z (2012) De novo assembly and characterization of bark transcriptome using Illumina sequencing and development of EST-SSR markers in rubber tree (Hevea brasiliensis Muell. Arg.). BMC Genomics 13: 192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Fu N, Wang Q, Shen HL (2013) De novo assembly, gene annotation and marker development using Illumina paired-end transcriptome sequences in celery (Apium graveolens L.). PloS one 8: e57686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Wang Z, Fang B, Chen J, Zhang X, Luo Z, et al. (2010) De novo assembly and characterization of root transcriptome using Illumina paired-end sequencing and development of cSSR markers in sweet potato (Ipomoea batatas). BMC Genomics 11: 726. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Li R, Zhu H, Ruan J, Qian W, Fang X, et al. (2010) De novo assembly of human genomes with massively parallel short read sequencing. Genome Res 20: 265–272. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Kondo N, Shimada M, Fukatsu T (1999) High prevalence of Wolbachia in the adzuki bean beetle Callosobruchus chinensis (Coleoptera: Bruchidae). Zool Sci 16: 955–962. [Google Scholar]
  • 30. Kageyama D, Narita S, Imamura T, Miyanoshita A (2010) Detection and identification of Wolbachia endosymbionts from laboratory stocks of stored-product insect pests and their parasitoids. J Stored Prod Res 46: 13–19. [Google Scholar]
  • 31. Thiel T, Michalek W, Varshney RK, Graner A (2003) Exploiting EST database for the development and characterization of gen-derived SSR-markers in barley (Hordeum vulgare L.). Theor Appl Genet 106: 411–422. [DOI] [PubMed] [Google Scholar]
  • 32.Rozen S, Skaletsky H (1999) Primer3 on the WWW for general users and for biologist programmers. Bioinformatics methods and protocols. Humana Press. 365–386. [DOI] [PubMed]
  • 33. Creste S, Neto AT, Figueira A (2001) Detection of single sequence repeat polymorphism in denaturating polyacrylamide sequencing gels by silver staining. Plant Mol Biol Rep 19: 299–306. [Google Scholar]
  • 34. Kimura M, Crow JF (1964) The number of alleles that can be maintained in a finite population. Genetics 49: 725–738. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Lewontin RC (1972) The apportionment of human diversity. Evolutionary Biology 6: 381–398. [Google Scholar]
  • 36. Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4: 406–425. [DOI] [PubMed] [Google Scholar]
  • 37. Wang J, Wang W, Li R, Li Y, Tian G, et al. (2008) The diploid genome sequence of an Asian individual. Nature 456: 60–65. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Rosenkranz R, Borodina T, Lehrach H, Himmelbauer H (2008) Characterizing the mouse ES cell transcriptome with Illumina sequencing. Genomics 92: 187–194. [DOI] [PubMed] [Google Scholar]
  • 39. Mortazavi A, Williams BA, McCue K, Schaeffer L, Wold B (2008) Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nature Methods 5: 621–628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Nagalakshmi U, Wang Z, Waern K, Shou C, Raha D, et al. (2008) The transcriptional landscape of the yeast genome defined by RNA sequencing. Science 320: 1344–1349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Berger MF, Levin JZ, Vijayendran K, Sivachenko A, Adiconis X, et al. (2010) Integrative analysis of the melanoma transcriptome. Genome Res 20: 413–427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Wang B, Guo G, Wang C, Lin Y, Wang X, et al. (2010) Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing. Nucleic Acids Res 38: 5075–5087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Collins LJ, Biggs PJ, Voelckel C, Joly S (2008) An approach to transcriptome analysis of non-model organisms using short-read sequences. Genome informatics International Conference on Genome Informatics 21: 3–14. [PubMed] [Google Scholar]
  • 44. Wang QQ, Liu F, Chen XS, Ma XJ, Zeng HQ, et al. (2010) Transcriptome profiling of early developing cotton fiber by deep-sequencing reveals significantly differential expression of genes in a fuzzless/lintless mutant. Genomics 96: 369–376. [DOI] [PubMed] [Google Scholar]
  • 45. Zenoni S, Ferrarini A, Giacomelli E, Xumerle L, Fasoli M, et al. (2010) Characterization of transcriptional complexity during berry development in Vitis vinifera using RNA-Seq. Plant Physiol 152: 1787–1795. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Iorizzo M, Senalik DA, Grzebelus D, Bowman M, Cavagnaro PF, et al. (2011) De novo assembly and characterization of the carrot transcriptome reveals novel genes, new markers, and genetic diversity. BMC Genomics 12: 389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.XuJ J (2007) Molecular detection of geographic populations and interspecies genetic relationships of several important bean weevils (Coleoptera: Bruchidae). Dissertation, Yangzhou University, Yangzhou.
  • 48. Tuda M, Wasano N, Kondo N, Horng SB, Chou LY, et al. (2004) Habitat-related mtDNA polymorphism in the stored-bean pest Callosobruchus chinensis (Coleoptera: Bruchidae). B Entomol Res 94: 75–80. [DOI] [PubMed] [Google Scholar]
  • 49. An ZW, Zhao YH, Cheng H, Li WG, Huang HS (2009) Development and application of EST-SSR markers in Hevea brasiliensis Muell. Arg Hereditas 31: 311–319. [DOI] [PubMed] [Google Scholar]
  • 50. Yang T, Bao SY, Ford R, Jia TJ, Guan JP, et al. (2012) High-throughput novel microsatellite marker of faba bean via next generation sequencing. BMC Genomics 13: 602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Edwards A, Civitello A, Hammond HA, Caskey CT (1991) DNA typing and genetic mapping with trimeric and tetrameric tandem repeats. Am J Hum Genet 49: 746–756. [PMC free article] [PubMed] [Google Scholar]
  • 52. Gastier JM, Pulido JC, Sunden S, Brody T, Buetow KH, et al. (1995) Survey of trinucleotide repeats in the human genome: assessment of their utility as genetic markers. Hum Mol Genet 4: 1829–1836. [DOI] [PubMed] [Google Scholar]
  • 53. Sheffield VC, Weber JL, Buetow KH, Murray JC, Even DA, et al. (1995) A collection of tri- and tetranucleotide repeat markers used to generate high quality, high resolution human genome-wide linkage maps. Hum Mol Genet 4: 1837–1844. [DOI] [PubMed] [Google Scholar]
  • 54.Ott J (1991) Analysis of Human Genetic Linkage (Revised Edition). Johns Hopkins University Press, Baltimore.

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1

Distribution of sequencing quality (Q20 and Q30 refer to the values of quality of sequencing data).

(PDF)

Figure S2

Distribution of sequencing error rate.

(PDF)

Figure S3

Distribution of GC content and contig depth.

(PDF)

Table S1

Decontamination of valid sequencing data.

(DOC)

Table S2

The primer pairs of Callosobruchus chinensis designed successfully by Primer3.

(XLS)

Table S3

Characteristics of 196 polymorphic SSR markers developed in Callosobruchus chinensis L.

(DOC)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES