Ubiquitin C-terminal Hydrolase L1 Interacts with Choline Transporter in Cholinergic Cells

Abstract

Ubiquitin carboxyl-terminal hydrolase L1 (UCHL1) is a deubiquitinating enzyme, which is highly expressed in neuronal cells. Previous studies have indicated that UCHL1 is involved in cognitive function, neurodegenerative diseases, and neuromuscular junction development. Acetylcholine (Ach) is a critical neurotransmitter in these functions. Yet, the effect of UCHL1 on the cholinergic system has not been reported. In this study, using a cholinergic neuronal cell line, SN56, as an in vitro model, we detected the physical interaction of UCHL1 and high affinity choline transporter (CHT), which is a key protein regulating Ach re-synthesis. Reduction of UCHL1 by siRNA gene knockdown significantly increased poly-ubiquitinated CHT and decreased native CHT protein level, but did not affect CHT mRNA expression. Biotinylation assay showed that UCHL1 is localized only in the cytosol of the cells and that the gene knockdown of UCHL1 significantly reduced cytosolic CHT but had no significant effect on membrane CHT level. These data provide novel and potentially important evidence that UCHL1 may play a role in the regulation of cholinergic function by affecting CHT ubiquitination and degradation.

Introduction

Ubiquitin carboxyl-terminal hydrolase L1 (UCHL1) was originally found as a “brain specific protein”, named “PGP9.5,”[14] and later functionally confirmed as a ubiquitin hydrolase[29]. UCHL1 is highly expressed in both central and peripheral nervous systems and has been widely used as a neuronal marker[8]. UCHL1 is a member of UCH deubiquitinating enzymes (DUBs) family[20, 23]. As a DUB, UCHL1 was reported to cleave small but not large substrates from the C-terminal of ubiquitin[16], and to bind and stabilize mono-ubiquitin[21]. In addition, there is evidence that overexpressed and dimerized UCHL1 exhibits ubiquitin E3 ligase activity[17].

Evidence suggests that UCHL1 is essential for the proper development and function of nervous systems. Mice with a spontaneous deletion of exons 7 and 8 in the UCHL1 gene, also known as gracile axonal dystrophy (GAD) mice, lack a functional UCHL1 and develop an abnormal shuffling movement followed by hind-limb paralysis and early death[32]. A recent study further shows that UCHL1 gene knockout mice exhibit impaired structure and function of neuromuscular junction[5]. Additionally, altered UCHL1 has been linked to neurodegenerative diseases. In the brain of patients with Parkinson's and Alzheimer's disease (AD), UCHL1 protein level were reduced[6]. In an animal experiment, the administration of UCHL1 protein fused with HIV transactivator (TAT) protein provided a protective effect against beta-amyloid-induced decreases in synaptic function and contextual memory[11].

As an important neurotransmitter, acetylcholine (Ach) is particularly important in cognitive activities[27] and neuromuscular junction function[30]. Yet, whether UCHL1 has any effect on the Ach system in physiological and pathophysiological conditions has not been reported. High affinity choline transporter (CHT) is critical for Ach re-synthesis [26] and is essential for maintaining central and peripheral cholinergic function [1, 9]. CHT undergoes dynamic trafficking between plasma membrane and cytosol[3, 24, 25]. Given the role of UCHL1 in cognitive function, neurodegenerative diseases, and neuromuscular junction, it would be conceivable to speculate the potential link between the UCHL1 and CHT. In this short communication, we report novel evidence indicating the interaction of UCHL1 with CHT in a cholinergic cell line, SN56.

Methods

1, Cell culture and protein extraction

SN56 cholinergic neuronal cells were kindly provided by Dr. J. K. Blusztajn of Boston University School of Medicine. This cell line expresses major cholinergic components including choline acetyltransferase (ChAT), choline transporter (CHT), and vesicular acetylcholine transporter (VAChT)[2, 12, 22]. Cells were cultured in DMEM supplemented with L-glutamine, sodium pyruvate, 10% fetal bovine serum (FBS) and 1% penicillin and streptomycin. At the end of the treatments, cells were washed with pre-chilled PBS, collected by scrapping, and lysed using RIPA buffer (10 mM sodium phosphate, pH 7.6, 80 mM NaCl, 0.5% sodium deoxycholate, 0.2% sodium fluoride, and 1% NP-40) with freshly added protease inhibitors cocktail (Pierce Inc. Rockford, IL). After centrifugation at 10,000 x g for 10 minutes at 4 °C, cell lysate supernatant was collected. Protein concentration was assayed using a BCA kit (Pierce) and normalized.

2, TUBE assay and CHT immunoprecipitation

Tandem Ubiquitin Binding Entities (TUBEs, LifeSensors, Inc. Malvern, PA) are novel, sensitive approaches of affinity isolation of ubiquitinated proteins [13]. Cell lysate samples with the normalized protein concentration were loaded into a tube containing pre-equilibrated TUBE1 beads or control beads and incubated at 4°C overnight with rotation. The beads were then collected by centrifugation at 3,000 x g for 1 minute. The supernatant sample was removed from the beads and saved as the “unbound” sample. The beads were washed twice with 1 ml TBST each, and re-suspended with RIPA buffer containing BME loading butter. The bound proteins were eluted by boiling for 10 minutes. The “pull-down” samples, along with “total input” and “unbound” samples were subjected to standard immunoblotting.

For immunoprecipitation (IP), the cell lysate sample with normalized protein concentration was loaded into a 1.7 ml tube and incubated with a rabbit-anti CHT antibody (a custom antibody[10] produced by Genemed Synthesis, San Antonio, TX), or equal amount of rabbit IgG as control, at 4 °C for 1 hour. The mixture was transferred into a tube containing pre-washed Protein G-agarose beads and incubated overnight at 4°C with rotation. Beads were collected by centrifugation and washed twice with PBS. The bound proteins were eluted into RIPA buffer containing BME loading buffer by boiling for 10 minutes. Pull-down samples were subject to immunoblotting.

3, UCHL1 gene knockdown

The siRNA reagents were purchased from Integration DNA Technologies, Inc. (Coralville, Iowa). Two microliters of 20 µM stock siRNA targeting UCHL1 or control siRNA were diluted in 100 μl of Opt-MEM medium (Life Technologies, Co., Grand Island, NY), further mixed with 100 μl of Opt-MEM containing 4 μl of Lipofectamin RNAiMax (Life Technologies, Co.), and incubated at room temperature for 5 minutes. The siRNA mixture was then added into SN56 cells in a culture dish with 1.8 ml medium. After 24 to 48 hours of treatment, cells were lysed for immunoblotting, subject to biotinylation, or for RNA isolation.

4, Semi-quantitative RT-PCR

After 48 hours of treatment with siRNA targeting UCHL1 or control siRNA, cells were washed with PBS and subject to RNA isolation using TRIzol reagent (Life Technologies Co.) and RNA clean-up kit (ZYMO Research, Orange, CA). RT-PCR was carried out as described in our previous publication[15]. The primers were purchased from Integration DNA Technologies, Inc. For CHT (gene accession number NM_053521.1), the forward primer was ATTGATTGATCGCCTCGCCC and reverse primer AGCCCAAGCTAGACCACAAC; For beta actin (gene accession number NM_031144.3), forward primer ACCCGCGAGTACAACCTTCT; and reverse primer ATGGCTACGTACATGGCTGG.

5, Plasma membrane protein biotinylation

Cells were washed with pre-chilled PBS containing 1 mM CaCl₂ and 1 mM MgCl₂, and incubated with 1.5 mg/ml sulfo-NHS-biotin (Pierce, Inc.) for 1 hour at room temperature. Excessive biotinylating reagents were removed by incubating with 100 mM pre-chilled glycine in PBS, followed by three washes with cold PBS/Ca²⁺-Mg²⁺. Cells were then lysed in RIPA buffer containing protease inhibitor cocktail (Pierce, Inc). Following centrifugation at 5000 x g for 5 minutes at 4 C, the supernatants were incubated with prewashed Neutravidin beads (Pierce, Inc) with rotation at room temperature for 1 hour. The beads were pulled down by centrifugation at 3000 x g for 1 minute. The supernatants were saved as cytosolic samples. The beads were washed with PBS twice and the bound plasma membrane proteins were eluted into RIPA buffer containing BME loading buffer by boiling for 10 minutes. The samples were subject to immunoblotting.

6, Western blot

Cell lysate samples from above experiments were mixed with loading buffer, boiled, and subjected to standard SDS-PAGE and transfer procedures as described previously[15]. Immunoblotting was conducted using primary antibodies against ubiquitin (Sigma-Aldrich, St. Louis, MO), CHT (a custom antibody[10] produced by Genemed Synthesis, San Antonio, TX), UCHL1, actin or GAPDH (Santa Cruz Inc. CA) and appropriate secondary antibodies conjugated with fluorescent dyes. The bands were detected using an Odyssey scanner (LICOR Inc, Lincoln, NE) and quantified using NIH ImageJ software.

7, Data analysis

The quantification of immunoblotting bands were first normalized as relative densities against loading control (actin or GAPDH) bands and then calculated as the ratio of treatment group versus control group. All quantified data were expressed as mean ± standard deviation (SD). Data were analyzed and compared using single factor ANOVA. The statistical significances between the compared groups were determined by p value equal or less than 0.05. Sample sizes (n) were indicated in individual figures.

Results

1, TUBE pull-down and CHT IP

As shown in Figure 1 panel A, poly-ubiquitinated proteins at the high molecular range were markedly enriched in the TUBE1 pulled-down fraction sample (Figure 1A, top panel, lane 4) versus the sample pulled down by control beads (lane 2), indicating the efficacy of ubiquitin affinity pull-down by TUBE. Immunoblotting for CHT detected bands at the high molecular range in the TUBE1 pull-down sample but not in the control beads pull-down sample (Figure 1A, bottom panel, lane 4 vs 2), indicating that poly-ubiquitinated CHT proteins were pulled down by TUBE. According to the manufacturer's instruction, TUBE1 has higher affinity for K63 linkages over other ubiquitin lysine linkages such as K48, whereas TUBE2 has equal affinity for all types of linkages. Accordingly, we also conducted a pull-down assay using TUBE2 and received similar results as TUBE1 (data not shown). The type of ubiquitin linkage attached to CHT remains to be further verified using linkage-specific antibodies.

Figure 1. TUBE pull-down and CHT IP pull-down A: TUBE pull-down.

Western blot for ubiquitin (top) shows the poly-ubiquitinated proteins in the total input sample (total lane), enriched poly-ubiquitinated proteins in the TUBE1 pull-down sample (TUBE1 lane), and consequently reduced poly-ubiquitination signal in the supernatant sample after TUBE1 pull-down (TUBE Unbound lane). Western blot for CHT (bottom) shows the CHT signal at high molecular range, which is enriched in the TUBE1 pull-down sample (TUBE1 lane) and consequently reduced in the TUBE1 unbound sample. B: CHT IP. Using the respective primary antibodies, western blot detected the ~55 kDa CHT band (top, lane 3, indicated by an arrow) and the ~25 kDa UCHL1 band (bottom, lane 3, indicated by an arrow). These bands were absent in the sample pulled down by the control beads (lane 2, top and bottom).

For CHT IP results as shown in Figure 1 panel B, immunoblotting detected CHT (Figure 1B, top panel) as well as UCHL1 (Figure 1B, bottom panel) proteins in the CHT antibody pull- down sample but not in the control IgG pull-down sample, suggesting a physical interaction between UCHL1 and CHT. In attempt for reciprocal IP pulling down of UCHL1, we have not yet found a commercially available UCHL1 antibody suitable for IP at this time.

2, The Effect of UCHL1 knockdown on CHT ubiquitination

The treatment with siRNA targeting UCHL1 significantly decreased UCHL1 protein level versus the treatment with control siRNA (Figure 2A). Consequently, the high molecular polyubiquitinated CHT was significantly increased, whereas the native CHT protein (~55 kDa band) level was significantly decreased. These results suggest UCHL1 may function as a DUB to negatively regulate CHT ubiquitination and degradation.

Figure 2. Altered poly-ubiquitinated and native CHT by UCHL1 knockdown.

A: Representative western blots (top) and quantitative data (bottom, bar graphs) show changes in poly-ubiquitinated CHT, native CHT (~55 kDa band), or UCHL1 proteins from SN56 cells that were treated with control siRNA (black bars) or siRNA targeting UCHL1(gray bars). The data were calculated as relative densities of the bands of interest against the band of Actin and further normalized as the ratios of the UCHL1 knockdown group vs the control group. (All groups n=14). B: Representative semi-quantitative RT-PCR (top) and quantitative data (bottom) show unchanged CHT mRNA expression between the control siRNA cells (black bar) and UCHL1 siRNA cells (gray bar). The data were calculated as relative densities (ratio) of the bands of CHT against the band of beta actin. (All groups n=3).

We also measured CHT mRNA expression using semi-quantitative RT-PCR. The result showed no significant difference between the groups treated with control siRNA or UCHL1 siRNA (Figure 2B), suggesting the reduction of CHT protein level is due to a post-translational mechanism.

3, The Effect of UCHL1 knockdown on cytosolic and membrane CHT

As assessed by biotinylation and immunoblotting in Figure 3, UCHL1 protein was solely present in the cytosolic sample and was significantly reduced in the cells treated with siRNA targeting UCHL1. The native CHT (~55 kDa band) was present in both cytosolic and membrane fractions. The cytosolic CHT protein was significantly reduced in the UCHL1 knockdown sample, which is consistent with the previous result. The level of plasma membrane CHT in UCHL1 siRNA treated cells was not statistically different versus the control siRNA group.

Figure 3. Effect of UCHL1 knockdown on cytosolic and membrane CHT.

Membrane and cytosolic proteins were separated by biotinylation. Representative western blots (left) and quantitative data (right bar graphs) show the changes in cytosolic CHT, membrane CHT, and UCHL1from SN56 cells treated with control siRNA (black bars) or siRNA targeting UCHL1 (gray bars). All groups n=11.

Discussion

UCHL1 was discovered as a prominent, neuronal DUB for over two decades[29] but its biological substrates remain to be defined[8]. Using an in vitro cholinergic cell model, this report provides novel evidence that UCHL1 may physically interact with CHT and functionally affect CHT ubiquitination and native CHT protein level. These data suggest that UCHL1 may function as a DUB targeting CHT in cholinergic neurons. Given the importance of CHT in Ach re-synthesis, these data suggest that UCHL1 may play an important role in regulating cholinergic function in both central and peripheral nervous systems.

CHT is functionally localized in the pre-synaptic membrane for the re-uptake of choline, which is the rate-limiting step for Ach re-synthesis[26, 27]. To date, the role of ubiquitin and ubiquitination in the regulation of cholinergic function and CHT is largely unknown. A few recent studies suggest that CHT may be ubiquitinated[31] and ubiquitination may be involved in oxidative stress induced protein degradation of CHT[7]. Using TUBE pull-down assay, our study provides novel evidence that CHT undergoes poly-ubiquitination. Furthermore, our results reveal that reduction of UCHL1 level by siRNA knockdown increases poly-ubiquitinated CHT and decreases the native CHT level. These results suggest that UCHL1 functions as a DUB to negatively regulate CHT ubiquitination. Thus, the reduction of UCHL1 leads to an increase in CHT poly-ubiquitination and consequently a decrease in native CHT proteins. Whether the increased poly-ubiquitination results in an increase in CHT protein degradation via the proteasome or lysosome systems remains to be further elucidated.

Recent studies reveal that CHT undergoes constant, dynamic trafficking between the plasma membrane and cytosol[10, 26]. Protein ubiquitination is critical in regulating protein trafficking [18]. To test the potential role of UCHL1 and ubiquitination in CHT trafficking, we assessed the CHT level in the plasma membrane using a biotinylation assay. The results showed that UCHL1 is solely present in the cytosol in this cell line. Additionally, the reduction of UCHL1 by siRNA knockdown significantly decreased cytosolic CHT protein but did not significantly alter the CHT level in the plasma membrane. It should be noted that this study only examined the effects of UCHL1 on membrane CHT at resting conditions. Whether and how UCHL1 affects CHT protein trafficking during excitation, choline accumulation, and other challenging conditions needs to be further examined.

Acetylcholine is a major neurotransmitter in the central nervous system, the autonomic nervous system, and the neuromuscular junction. The role of UCHL1 in regulating cholinergic function may have potentially important clinical implications. For example, previous studies have suggested that altered UCHL1 activity may be involved in Alzheimer's disease.[4, 28]. In the brains of patients with Alzheimer's disease, UCHL1 was down-regulated and the UCHL1 protein levels were inversely proportional to the number of neuron tangles [6, 11]. It is well-known that reduced cholinergic function is one of the hallmarks in Alzheimer's disease[19]. Whether the reduced UCHL1 may contribute to the impaired cholinergic function in Alzheimer's disease is certainly worth further investigation.

The results reported in this study are novel, interesting, and important for further investigation. Importantly, the functional significance of UCHL1 in regulating CHT function needs to be further investigated in appropriate physiological and pathophysiological models. SN56 is a widely used cholinergic cell line that expresses major cholinergic proteins and is a suitable in vitro model for studying the regulation and modifications of cholinergic proteins such as CHT. It would be important to confirm these findings in other cell lines, primary neurons, and in vivo models during normal and disease conditions. Additionally, as mentioned earlier, the effect of UCHL1 on CHT degradation and trafficking during excitation, stimulation, and pathological conditions needs to be further examined. The physical interaction of UCHL1 and CHT needs to be further confirmed by the reciprocal IP of both CHT and UCHL1. As the antibodies suitable for UCHL1 IP are not commercially available, establishing the co-expression of tagged UCHL1 and CHT would be essential for carrying out such experiments.

Nevertheless, the data from this study reveals a novel and potentially important role of UCHL1 in regulating CHT level. It opens a new direction for further investigations into the mechanisms regulating cholinergic function and dysfunction in the central and peripheral nervous systems.

Conclusion

The data from this study suggest that UCHL1 physically interacts with CHT and functions as a deubiquitinating enzyme to regulate CHT ubiquitination and protein level in cholinergic cells.

Highlights.

Effect of UCHL1 on CHT expression was examined in a cholinergic neuronal cell line, SN56.

TUBE pull-down assay indicated poly-ubiquitination of CHT.

CHT immunoprecipitation revealed physical interaction between UCHL1 and CHT.

Reduction of UCHL1 by siRNA gene knockdown significantly increased poly ubiquitinated CHT and decreased native CHT protein level.

UCHL1 was present in cytosol and reduction of UCHL1 reduced the cytosolic CHT but not the plasma membrane CHT.