Skip to main content
NCBI home page
Journal of Anatomy logoLink to Journal of Anatomy
. 2014 Apr 2;224(6):732–736. doi: 10.1111/joa.12183

Identification of G protein-coupled estrogen receptor in human and pig spermatozoa

V Rago 1, F Giordano 1, E Brunelli 2, D Zito 1, S Aquila 1, A Carpino 1,✉
PMCID: PMC4025899  PMID: 24697543

Abstract

Estrogens are known to influence functional properties of mammalian spermatozoa inducing rapid responses through the classical estrogen receptors (ERα and ERβ). Recently, the G protein-coupled estrogen receptor (GPER) has been identified as mediator of fast non-genomic estrogen effects in different cells. This work investigated the expression of GPER in human and pig spermatozoa using immunofluorescence, Western blot analysis and RT-PCR. GPER was found to be confined to the mid-piece of human sperm cells, whereas it was detected in the acrosomal region, the equatorial segment and the mid-piece of pig spermatozoa. Furthermore, in the male gametes of both species, the immunoblots of sperm extracts revealed a band at ∼42 kDa, consistent with the GPER molecular weight, and RT-PCR detected the GPER transcripts. This is the first report demonstrating the expression of GPER in human and pig mature sperm cells and evidencing its species-specific cellular localization.

Keywords: estrogens, G protein-coupled estrogen receptor, human spermatozoa, pig spermatozoa

Introduction

Estrogens are able to control capacitation and acrosome reaction in different mammalian spermatozoa through rapid pathways (Luconi, 2006). The effects of estrogens on target cells can be mediated by the classical estrogen receptors (ERs), which act either as transcriptional factors in the nucleus or by inducing rapid non-genomic responses through intracellular secondary messengers (Acconcia & Kumar, 2006; Pedram et al. 2007). To date, the expression of ERα and ERβ in ejaculated spermatozoa has been reported only in the human and in the pig (Aquila et al. 2004; Solakidi et al. 2005; Rago et al. 2007) Therefore, the ERs are candidates to mediate the fast estrogen signalling in both these male gametes. However, the presence of alternative estrogen receptors in mature sperm cells has also been hypothesized. In fact, some biological effects of estradiol on human (Adeoya-Osiguwa et al. 2003) and mouse (Rossato et al. 2005) spermatozoa were not inhibited by tamoxifen, ruling out the involvement of ERs. Besides the ERs, estrogens can elicit rapid effects through the seven-transmembrane receptor associated to a G protein, GPER (GPR30). GPER has been recognized as mediator of rapid responses to estrogens in different cell types (Olde & Leeb-Lundberg, 2009) but its expression in sperm cells is still unknown. In addition, the signalling cascade activated by GPER includes the release of intracellular calcium (Prossnitz et al. 2008), an event which can be strictly related to sperm capacitation and acrosome reaction (Publicover et al. 2007); this consideration supports a possible GPER presence in mature sperm cells. The aim of the present paper was to investigate the expression of GPER in human and pig spermatozoa at different levels: immunolocalization, mRNA and protein level.

Material and methods

Chemicals

Reagents were purchased from Sigma Aldrich (Milan, Italy), unless otherwise indicated. Two anti-GPER primary antibodies were used: rabbit polyclonal LS-A4271 (MBL International Corporation, USA) mapping within the 3rd extracellular domain of human GPER and rabbit polyclonal K19 (sc-48524-R) mapping within an internal region of human GPER (Santa Cruz Biotechnology, USA). Blocking peptides were LS-P4271 and sc-48524P, respectively. Goat anti-rabbit fluorescein isothiocyanate (FITC) conjugated IgG and horseradish peroxidase conjugated IgG (Santa Cruz Biotechnology) were used as secondary antibodies. Rabbit polyclonal anti β-actin (Santa Cruz Biotechnology) was also used as loading control. TRIzol RNA isolation reagent was provided from Invitrogen Life Technologies, Italy. Oligonucleotide primers for GPER were purchased from Dasit Science, Italy. Oligonucleotide primers for GPHD were provided by Invitrogen Life Technologies.

Semen samples

Human semen samples from six health voluntary donors with normal semen parameters (World Health Organization, 2010) were provided by UNICAL, Health Center (Rende, CS, Italy). Individual samples were centrifuged on a discontinuous Percoll density gradient (80 to 40%) to remove bacteria and debris (World Health Organization, 2010).

Pig semen samples were obtained from six fertile male pigs (Sus scrofa domestica, Large White) kept at the Swine Artificial Insemination Center (Rende, CS, Italy). Individual fresh ejaculates were collected by the gloved hand method and filtered immediately by Universal Semen bags (Minitub, Tiefenbech, Germany). Semen was transported within ½  h to the laboratory, diluted 1 : 10 with Earle's balanced salt solution and centrifuged on a discontinuous Percoll density gradient (72%/90%) to remove bacteria and debris (Kuster et al. 2004).

Percoll-purified human and pig spermatozoa were diluted in Earle's balanced salt solution and specifically treated for immunofluorescence analysis, Western blot analysis, RNA isolation, reverse transcriptase-PCR.

Immunofluorescence labelling

Sperm cells were rinsed three times with 0.5 mm Tris-HCl buffer, pH 7.5 and allowed to settle onto slides in a humid chamber. The overlying solution was carefully pipetted off and replaced by absolute methanol for 7 min at −20 °C. After methanol removal, sperm cells were washed in Tris-buffered saline (TBS) containing 0.1% Triton X-100 and were treated for immunofluorescence. Two anti-human GPER, LS-A4271 (1 : 50) and K19 (1 : 200), were utilized as primary antibodies, and the anti-rabbit FITC conjugated IgG (1 : 80) as secondary antibody. Propidium iodide (PI) (12 μm L−1) was used for nuclear counterstaining. The specificity of anti-GPER antibodies was tested by pre-absorption of each primary antibody with an excess of the respective blocking peptide for 48 h at 4 °C (negative controls).

The slides were examined under a Leica TCS Saronno Palermo 2 confocal laser scanning microscope (LSM), observing a minimum of 200 spermatozoa × slide.

Western blot analysis

After Percoll removal, sperm samples were re-suspended in lysis buffer: 62.5 mm Tris-HCl (pH 6.8), 150 mm NaCl, 2% sodium dodecyl-sulphate (SDS), 1% Triton X-100, 10% glycerol, 1 mm phenylmethylsulphonyl fluoride, 0.2 mm Na3VO4, 1% aprotinin. Lysates were quantified using Bradford protein assay reagent. Equal amounts of protein (50 μg) were boiled for 5 min, separated under denaturing conditions by SDS-PAGE on 10% polyacrylamide Tris-glycine gels, and then electroblotted to nitrocellulose membrane. Non-specific sites were blocked with 5% non-fat dry milk in 0.2% Tween-20 in Tris-buffered saline (TBS-T) for 1 h at room temperature and incubated overnight with anti-human GPER (1 : 500) and anti-human β-actin (1 : 1000). Then, antigen-antibody complexes were detected by incubation of the membranes with the secondary antibody (anti-rabbit horseradish peroxidase-conjugated) at 22 °C for 1 h. The bound secondary antibodies were detected with the ECL Plus Western blotting detection system (Amersham, USA) according to the manufacturer's instructions. Each membrane was exposed to the film for 2 min. Protein extract from cultured SKBR3 (breast cancer cell line) was used as positive control for GPER.

RNA isolation, RT-PCR

Total RNA was extracted from human and pig spermatozoa with TRIzol RNA isolation reagent according to the manufacturer's protocol (homogenization, phase separation, RNA precipitation, RNA wash and dissolving) with minor differences between the two sperm species.

Before RT-PCR, RNA was incubated with ribonuclease-free deoxyribonuclease (DNAse) I in single-strength reaction buffer at 37 °C for 15 min. This was followed by heat inactivation of DNAse I at 65 °C for 10 min. Two micrograms of DNAse-treated RNA samples were reverse transcribed using M-MLV reverse transcriptase (Promega, USA) and 2 μL of RT products were then amplified. The applied PCR primers and the expected lengths of the resulting PCR products are the following: 5′ CTGGGGAGTTTCCTGTCTGA 3′ (forward) and 5′ GCTTGGGAAGTCACATCCAT 3′ (reverse) for human GPER with a product size of 155 bp; 5′ CCTGGACGAGCAGTATTACGATATC 3′ (forward) and 5′ TGCTGTACATGTTGATCTG 3′ (reverse) for mouse GPER with a product size of 380 bp. Cycling conditions were: 94 °C per 1 min, 58 °C per 1 min, 72 °C per 1 min for human GPER and 94 ° C per 1 min, 57 °C per 1 min, 72 ° C per 1 min for mouse GPER. Furthermore, GAPDH was amplified as internal control gene with a product size of 450 bp using the following primers: 5′ GACAACTTTGGTATCGTGGA 3′ (forward) and 5′ TACCAGGAAATGAGCTTGAC 3′(reverse). The PCR-amplified products were subjected to electrophoresis in 2% agarose gels, stained with ethidium bromide and visualized under UV transillumination.

Results

Immunolocalization

A green intense fluorescence revealed GPER in the sperm mid-piece of human spermatozoa; the tail and the head were unstained (Fig. 1A). A green brilliant light localized GPER in the mid-piece, in the equatorial segment and in the acrosomal region of pig sperm cells (Fig. 2A). The nuclear region and the tail showed no fluorescence. Negative controls (inserts) were immunonegative in both species.

Figure 1.

Figure 1

Open in a new tab

Expression of GPER in human spermatozoa (A) Green immunofluorescence labeling in the sperm mid piece (arrow heads). Sperm heads show the iodure propidium red stain. The insert show the control spermatozoa. (B) Iimmunoblots of protein extracts from the six human sperm samples (lane 1–6), positive control (lane C). β actin as loading control. (C) RT-PCR results in two representative human sperm samples (lane 1–2), negative control (lane-), and markers (lane M). GAPDH (450 bp) is the internal control.

Figure 2.

Figure 2

Open in a new tab

Expression of GPER in pig spermatozoa (A) Green immunofluorescence in the mid-piece (arrowhead), in the equatorial segment (short arrow) and in the acrosome (long arrow) of sperm cells. Sperm heads show the propidium iodide red stain. The insert show the control spermatozoa. (B) Immunoblots of protein extracts from six pig sperm samples (lane 1–6), positive control (lane C), β-actin as loading control. (C) RT-PCR results in two representative pig sperm samples (lane 1–2), negative control (lane-), and markers (lane M). GAPDH (450 bp) is the internal control.

The same results were obtained using the two different primary antibodies (LS-A4271 and K19). The immunofluorescence assays were repeated six times with similar results.

Western blot

One band corresponding to the molecular weight value ∼42 kDa has been revealed by the anti-GPER antibody in both human (Fig. 1B) and pig (Fig. 2B) sperm samples (lanes 1–6). This band co-migrated with the positive control (SKBR3) (lane C).

RT-PCR

Reverse PCR detected GPER mRNA in both human (Fig. 1C) and pig (Fig. 2C) spermatozoa. The primer sequences were based on the human gene sequence in human sperm cells and on the mouse gene sequence in pig spermatozoa. RT-PCR amplification revealed the expected PCR product sizes of 155 and 380 bp in human and pig spermatozoa, respectively.

Discussion

Rapid responses to estrogens are involved in the regulation of the main mammalian sperm functional properties. Estrogen promotion of capacitation and acrosome reaction have been reported in mouse (Adeoya-Osiguwa et al. 2003) and in boar ejaculated sperm cells (Ded et al. 2010), while an inhibitory role of estradiol on acrosome reaction was evidenced in human spermatozoa under physiological conditions (Vigil et al. 2008, 2011). However, whether these fast responses are mediated only by the classical ERs or also by alternative receptors remains to be elucidated.

Previous studies demonstrated that human and pig male gametes are a target for estrogens, evidencing the expression of the classical ERs in these cells. In the human, ERβ was prevalently identified in the sperm mid-piece, whereas some discrepancies were reported for ERα which was localized in the sperm mid-piece or the equatorial region (Aquila et al. 2004; Solakidi et al. 2005). In the pig, ERα was found in the sperm mid-piece and ERβ in the acrosome region (Rago et al. 2007).

In this work we demonstrated the expression of the G-protein coupled receptor, GPER, in human and in pig spermatozoa using different approaches. Immunolocalization experiments revealed GPER in different sperm compartments of both species, whereas the immunoblots from sperm protein extracts showed one band at ∼42 kDa, consistent with GPER molecular weight. These data were confirmed by RT- PCR analysis which detected GPER mRNA in both human and pig spermatozoa, evidencing the GPER transcripts at 155 and 380 bp, respectively.

To our knowledge, this is the first report on GPER expression in mammalian mature male gametes, as GPER was previously localized only in testicular germ cells of some mammalian species. In rodent testis, GPER was evidenced in mouse germ cells (Sirianni et al. 2008) and in rat isolated pachitene spermatocytes and round spermatids (Chimento et al. 2010, 2011). Conversely, conflicting results were reported in germ cells of normal human testis, where GPER was not found (Rago et al. 2011), weakly expressed (Franco et al. 2011) or clearly identified (Chevalier et al. 2012).

The present study identified GPER exclusively in the sperm mid-piece of human male gametes. The mid-piece is formed by a mitochondrial spiral around the proximal axoneme and it can be considered the powerhouse of a sperm. Therefore, the GPER presence in this cellular site could be involved in the estrogen signalling related to the sperm energy status which, in turn, modulates the main functional properties of sperm.

Concerning pig spermatozoa, GPER was identified in different cell compartments: mid-piece, acrosomal region and equatorial segment. Therefore, in pig spermatozoa GPER is expressed in cell compartments, where the estrogen signalling can be related to the acquisition of fertilizing ability. In fact, the mid-piece may be associated to the sperm energy requirement, the acrosome cap contains lysosomal enzymes dissolving the matrix around the egg, and the equatorial segment is a post-acrosomal region involved in sperm–egg plasma membrane fusion.

As reported above, the classical ERs were identified in the mid-piece/acrosome region of human and pig spermatozoa (Aquila et al. 2004; Solakidi et al. 2005; Rago et al. 2007) and GPER could be specifically co-localized in some sperm compartments of both species. This consideration leads to the hypothesis that there are interactions between GPER and classical ERs, as a cross-talk between the two receptor systems appears to be possible (Prossnitz & Barton, 2009). In fact, GPER and ERs are co-expressed in rat testicular germ cells; particularly in primary rat pachytene spermatocytes, GPER and ERα are both involved in the estrogen activation of rapid signalling pathways controlling apoptosis (Chimento et al. 2010). In addition, the inter-play between GPER and ERα in epithelium and stroma of normal human endometrium has suggested a functional collaboration of the two receptors in endometrial biology (Dennis et al. 2009).

Finally, considering our results and previous reports, it is possible to hypothesize that rapid responses to estrogens in sperm cells may be mediated either by GPER and ERs, or by a combination of both receptor types. The use of selective GPER ligands (agonists/antagonists such as G1, G15 (Rosano et al. 2012) or MIBE (Lappano et al. 2012) could help clarify the involvements of specific receptors in estrogen modulation of the functional properties of sperm.

Furthermore, a new attention should be paid to the effects of estrogenic compounds (phytoestrogens, xenoestrogens, environmental estrogens) on sperm physiology. Humans and pigs are chronically exposed to these endocrine disruptors, which are known to bind classical ERs, influencing sperm capacitation and acrosome reaction (Adeoya-Osiguwa et al. 2003; Mohamed et al. 2011; Park et al. 2011). Some of them, such as soy isoflavones (included in conventional pig feed and present in human diet), have been recognized as GPER activators in cultured cells (Maggiolini et al. 2004; Thomas & Dong, 2006). Therefore, estrogenic compounds could also bind GPER in sperm cells with the potential to alter sperm functions.

Conclusion

The present work demonstrated the expression of the estrogen receptor GPER in human and pig spermatozoa, suggesting a possible involvement of this receptor in the mediation of rapid responses to estrogens. GPER cellular expression sites were species-specific but they were related to the acquisition of sperm fertilizing ability in both species.

Acknowledgments

The authors thank Prof. Antonietta Martire for reviewing the English of this manuscript. This work was supported by MIUR (ex-60% -2012).

Conflict of interest

The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.

Authors' contributions

V.R. carried out immunofluorescence expriments and data analysis. F.G. carried out Western blot analysis. E.B. carried out microscopical analysis. D.Z. carried out RT-PCR analysis. S.A. performed a critical revision of the manuscript. A.C. is the author responsible for the conception, design, analysis and interpretation of data as well as drafting the manuscript.

References

  1. Acconcia F, Kumar R. Signaling regulation of genomic and nongenomic functions of estrogen receptors. Cancer Lett. 2006;238:1–14. doi: 10.1016/j.canlet.2005.06.018. [DOI] [PubMed] [Google Scholar]
  2. Adeoya-Osiguwa SA, Markoulaki S, Pocock V, et al. 17β-Estradiol and environmental estrogens significantly affect mammalian sperm function. Hum Reprod. 2003;18:100–107. doi: 10.1093/humrep/deg037. [DOI] [PubMed] [Google Scholar]
  3. Aquila S, Sisci D, Gentile ME, et al. Estrogen receptor (ER)α and ERβ are both expressed in human ejaculated spermatozoa: evidence of their direct interaction with phosphatidylinositol-3-OH kinase/Akt pathway. J Clin Endocrinol Metab. 2004;89:1443–1451. doi: 10.1210/jc.2003-031681. [DOI] [PubMed] [Google Scholar]
  4. Chevalier N, Vega A, Bouskine A, et al. GPR30, the non-classical membrane G protein related estrogen receptor, is overexpressed in human seminoma and promotes seminoma cell proliferation. PLoS ONE. 2012;7:e34672. doi: 10.1371/journal.pone.0034672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chimento A, Sirianni R, Delalande C, et al. 17β-estradiol activates rapid signaling pathways involved in rat pachytene spermatocytes apoptosis through GPR30 and ERα. Mol Cell Endocrinol. 2010;320:136–144. doi: 10.1016/j.mce.2010.01.035. [DOI] [PubMed] [Google Scholar]
  6. Chimento A, Sirianni R, Zolea F, et al. GPER and ESRs are expressed in rat round spermatids and mediate oestrogen-dependent rapid pathways modulating expression of cyclin B1 and Bax. Int J Androl. 2011;34(5 Pt 1):420–429. doi: 10.1111/j.1365-2605.2010.01100.x. [DOI] [PubMed] [Google Scholar]
  7. Ded L, Dostalova P, Dorosh A, et al. Effect of estrogens on boar sperm capacitation in vitro. Reprod Biol Endocrinol. 2010;8:87. doi: 10.1186/1477-7827-8-87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Dennis MK, Burai R, Ramesh C, et al. In vivo effects of a GPR30 antagonist. Nat Chem Biol. 2009;5:421–427. doi: 10.1038/nchembio.168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Franco R, Boscia F, Gigantino V, et al. GPR30 is overexpressed in post-puberal testicular germ cell tumors. Cancer Biol Ther. 2011;11:609–613. doi: 10.4161/cbt.11.6.14672. [DOI] [PubMed] [Google Scholar]
  10. Kuster CE, Hess RA, Althouse CG. Immunofluorescence reveals ubiquitination of retained distal cytoplasmic droplet on ejaculated porcine spermatozoa. J Androl. 2004;25:340–347. doi: 10.1002/j.1939-4640.2004.tb02798.x. [DOI] [PubMed] [Google Scholar]
  11. Lappano R, Santolla MF, Pupo M, et al. MIBE acts as antagonist ligand of both estrogen receptor α and GPER in breast cancer cells. Breast Cancer Res. 2012;14:R12. doi: 10.1186/bcr3096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Luconi M. Rapid responses to estrogens. MT Med Reprod. 2006;8:119–127. [Google Scholar]
  13. Maggiolini M, Vivacqua A, Fasanella G, et al. The G protein-coupled receptor GPR30 mediates c-fos up-regulation by 17β-estradiol and phytoestrogens in breast cancer cells. J Biol Chem. 2004;279:27008–27016. doi: 10.1074/jbc.M403588200. [DOI] [PubMed] [Google Scholar]
  14. Mohamed el-SA, Park YJ, Song WH, et al. Xenoestrogenic compounds promote capacitation and an acrosome reaction in porcine sperm. Theriogenology. 2011;75:1161–1169. doi: 10.1016/j.theriogenology.2010.11.028. [DOI] [PubMed] [Google Scholar]
  15. Olde B, Leeb-Lundberg LM. GPR30/GPER1: searching for a role in estrogen physiology. Trends Endocrinol Metab. 2009;20:409–416. doi: 10.1016/j.tem.2009.04.006. [DOI] [PubMed] [Google Scholar]
  16. Park YJ, Mohamed el-SA, Kwon WS, et al. Xenoestrogenic chemicals effectively alter sperm functional behavior in mice. Reprod Toxicol. 2011;32:418–424. doi: 10.1016/j.reprotox.2011.09.011. [DOI] [PubMed] [Google Scholar]
  17. Pedram A, Razandi M, Sainson RCA, et al. A conserved mechanism for steroid receptor translocation to the plasma membrane. J Biol Chem. 2007;282:22278–22288. doi: 10.1074/jbc.M611877200. [DOI] [PubMed] [Google Scholar]
  18. Prossnitz ER, Barton M. Signaling, physiological functions and clinical relevance of the G protein-coupled estrogen receptor GPER. Prostaglandins Other Lipid Mediat. 2009;89:89–97. doi: 10.1016/j.prostaglandins.2009.05.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Prossnitz ER, Arterburn JB, Smith HO, et al. Estrogen signaling through the transmembrane G protein-coupled receptor GPR30. Annu Rev Physiol. 2008;70:165–190. doi: 10.1146/annurev.physiol.70.113006.100518. [DOI] [PubMed] [Google Scholar]
  20. Publicover S, Harper CV, Barratt C. [Ca2+]i signalling in sperm – making the most of what you've got. Nat Cell Biol. 2007;9:235–242. doi: 10.1038/ncb0307-235. [DOI] [PubMed] [Google Scholar]
  21. Rago V, Aquila S, Panza R, et al. Cytochrome P450arom, androgen and estrogen receptors in pig sperm. Reprod Biol Endocrinol. 2007;5:23. doi: 10.1186/1477-7827-5-23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Rago V, Romeo F, Giordano F, et al. Identification of the estrogen receptor GPER in neoplastic and non-neoplastic human testes. Reprod Biol Endocrinol. 2011;9:135. doi: 10.1186/1477-7827-9-135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Rosano C, Lappano R, Santolla MF, et al. Recent advances in the rationale design of GPER ligands. Curr Med Chem. 2012;19:6199–6206. [PubMed] [Google Scholar]
  24. Rossato M, Ferigo M, Galeazzi C, et al. Estradiol inhibits the effects of extracellular ATP in human sperm by a non genomic mechanism of action. Purinergic Signal. 2005;1:369–375. doi: 10.1007/s11302-005-1172-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Sirianni R, Chimento A, Ruggiero C, et al. The novel estrogen receptor, G protein-coupled receptor 30, mediates the proliferative effects induced by 17β-estradiol on mouse spermatogonial GC-1 cell line. Endocrinology. 2008;149:5043–5051. doi: 10.1210/en.2007-1593. [DOI] [PubMed] [Google Scholar]
  26. Solakidi S, Psarra AM, Nikolaropoulos S, et al. Estrogen receptors alpha and beta (ERalpha and ERbeta) and androgen receptor (AR) in human sperm: localization of ERbeta and AR in mitochondria of the midpiece. Hum Reprod. 2005;20:3481–3487. doi: 10.1093/humrep/dei267. [DOI] [PubMed] [Google Scholar]
  27. Thomas P, Dong J. Binding and activation of the seven-transmembrane estrogen receptor GPR30 by environmental estrogens: a potential novel mechanism of endocrine disruption. J Steroid Biochem Mol Biol. 2006;102:175–179. doi: 10.1016/j.jsbmb.2006.09.017. [DOI] [PubMed] [Google Scholar]
  28. Vigil P, Toro A, Godoy A. Physiological action of oestradiol on the acrosome reaction in human spermatozoa. Andrologia. 2008;40:146–151. doi: 10.1111/j.1439-0272.2007.00814.x. [DOI] [PubMed] [Google Scholar]
  29. Vigil P, Orellana RF, Cortes ME. Modulation of spermatozoon acrosome reaction. Biol Res. 2011;44:151–159. [PubMed] [Google Scholar]
  30. World Health Organization. WHO Laboratory Manual for the Examination and Processing of Human Semen. 5th. Cambridge, UK: Cambridge University Press; 2010. [Google Scholar]

Articles from Journal of Anatomy are provided here courtesy of Anatomical Society of Great Britain and Ireland

RESOURCES