Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 May 8.
Published in final edited form as: Cell Rep. 2014 Apr 17;7(3):848–858. doi: 10.1016/j.celrep.2014.03.037

Impaired p32 regulation caused by the lymphoma-prone RECQ4 mutation drives mitochondrial dysfunction

Jiin-Tarng Wang 1, Xiaohua Xu 1, Aileen Y Alontaga 2, Yuan Chen 2, Yilun Liu 1,3
PMCID: PMC4029353  NIHMSID: NIHMS580009  PMID: 24746816

Abstract

Mitochondrial DNA (mtDNA) encodes genes important for ATP biogenesis. Therefore, changes in mtDNA copy number will have profound consequences on cell survival and proliferation. RECQ4 DNA helicase plays important roles in both nuclear and mtDNA synthesis. However, the mechanism that balances the distribution of RECQ4 in the nucleus and mitochondria is unknown. Here, we show that RECQ4 forms protein complexes with Protein Phosphatase 2A (PP2A), nucleophosmin (NPM) and mitochondrial p32 in different cellular compartments. Critically, the interaction with p32 negatively controls the transport of both RECQ4 and its chromatin-associated replication factor MCM10 from the nucleus to mitochondria. Amino acids (Ala420-Ala463), which are deleted in the most common cancer-induced RECQ4 mutation, are required for the interaction with p32. Hence, this RECQ4 mutant, which is no longer regulated by p32 and is enriched in the mitochondria, interacts with the mitochondrial replication helicase PEO1 and induces abnormally high levels of mtDNA synthesis.

Mitochondria are key cellular organelles that generate ATP for diverse cellular processes necessary to support cell growth, and deterioration of mitochondria and mtDNA contributes to the aging process (Lee and Wei, 2012). Furthermore, accumulating evidence also suggests there is an intimate connection between mitochondrial dysfunction and cancer development (Carew et al., 2004; D’Souza et al., 2007; Jeon et al., 2007; Lan et al., 2008). Because mtDNA copy number positively correlates with the rate of cell growth (Jeng et al., 2008), deregulated mtDNA synthesis could be a risk factor that contributes to carcinogenesis or sustains the rapid proliferation of cancer cells once they are established. For this reason, in recent years, mitochondria have gained attention both as a potential diagnostic tool and a therapeutic target for cancer therapy (Yu, 2011).

In mammals, the members of the conserved RECQ helicase family are important for nuclear DNA replication and damage repair, and have also been suggested to participate in mtDNA maintenance (de Souza-Pinto et al., 2010). Among the five RECQ helicases identified, RECQ4, which is an essential gene in vertebrates (Abe et al., 2011; Ickikawa et al., 2002), has been observed in both the nucleus and mitochondria (Chi et al., 2012; Croteau et al., 2012; Yin et al., 2004). Indeed, multiple regions of RECQ4 are required for its nuclear localization (Burks et al., 2007), and it was suggested that a potential mitochondrial targeting signal is located within the first 20 amino acids (De et al., 2012). Mutations in RECQ4 have been linked to three clinical diseases that have premature aging phenotypes and a predisposition to develop osteosarcoma and lymphoma (Liu, 2010). Through its unique N-terminus, RECQ4 forms chromatin-specific protein complexes that contain the essential nuclear replication factors, MCM10 and the CDC45-MCM2-7-GINS (CMG) helicase (Xu et al., 2009) and initiate DNA replication (Im et al., 2009; Sangrithi et al., 2005; Thangavel et al., 2010). In addition to reducing nuclear DNA replication, RECQ4 deficiency decreases mtDNA copy number and the energy production capacity of mitochondria (Chi et al., 2012; Croteau et al., 2012). However, the molecular mechanism that balances the distribution of RECQ4 in the nucleus and mitochondria remains to be defined.

In this study, we identified three novel RECQ4 interacting proteins: PP2A, NPM and mitochondrial p32. We determined that p32 promotes the nuclear localization of RECQ4 by suppressing its transport to mitochondria. Importantly, the most common cancer-associated RECQ4 mutation, c.1390+2delT, which deletes Ala420-Ala463 (Siitonen et al., 2009), produces a protein that cannot interact with p32. Individuals homozygous or compound heterozygous for this Internal Deletion (ID) in the RECQ4 protein develop RAPADILINO syndrome, and 40% of these patients develop cancers that are primarily lymphomas. We found that the RECQ4 ID mutant protein relocalized from the nucleus to mitochondria, where it accumulated. As a consequence, an excess amount of RECQ4 mutant protein was able to interact with the mitochondrial replication helicase PEO1 and led to an increase in mtDNA synthesis, and an enhanced use of the glycolysis pathway in preference to oxidative phosphorylation (OXPHOS). Our data provide a novel insight into how the intracellular location of RECQ4 is regulated and its potential link to cancer etiology.

RESULTS

The lymphoma-prone RECQ4 ID mutant protein is catalytically active

Ala420-Ala463 residues, which are unique to primates and are missing in the lymphoma-prone RECQ4 ID mutant, are located between the essential N-terminus and the conserved Superfamily Helicase Domain II (SFII; Figure 1A–B). Structure predictions using GOR4 Secondary Structure Prediction Tool and GlobPlot suggest that these residues are disordered and unlikely to affect the folding of the adjacent domains. Indeed, we found that purified recombinant RECQ4 ID protein have ATPase activity similar to the WT RECQ4 protein (Figures 1C–D). RECQ4 also exhibits a strong single-stranded DNA (ssDNA) annealing activity and can efficiently carry out ATP-dependent DNA strand-exchange reaction, such that the 32P-labeled strand of a splayed arm substrate is dissociated as a ssDNA product and replaced by an unlabeled ssDNA containing the same sequence (Figure 1E)(Xu and Liu, 2009). Previously, we showed that RECQ4 possessed dual DNA strand-exchange activities, one of which is controlled by the SFII, and the other is located within the N-terminal domain (Xu and Liu, 2009). We found that suppressing the SFII domain, by introducing the K508R mutation, weakened but did not abolish the DNA strand exchange activity (Figure 1F–G), indicating that the SFII and the N-terminal domain of the RECQ4 ID mutant are both catalytically active.

Figure 1. The lymphoma-prone RECQ4 ID mutant is catalytically active.

Figure 1

Open in a new tab

(A) Schematic diagrams of wildtype (WT) RECQ4 and the lymphoma-associated RECQ4 ID mutant, which lacks residues A420–A463. The conserved SFII helicase domain is shown in light grey.

(B) Sequence alignment of the human RECQ4 (A420–A463 a.a.) with the corresponding regions of the M. mulatta and M. musculus RECQ4 proteins. Conserved residues are shown in black.

(C) Recombinant WT RECQ4 and ID proteins purified from E. coli separated by SDS-PAGE and stained with Coomassie blue.

(D) Comparison of the ATPase activities of the WT RECQ4 and ID proteins in the presence ssDNA.

(E) DNA strand exchange activities of the WT RECQ4 and ID proteins were measured using 32P-end labeled splayed arm substrates in the presence or absence of unlabeled oligos containing the identical sequence to the 32P-end labeled strand of the splayed arm substrates. X01 strand of the splay arm substrate was labeled with 32P.

(F) Recombinant RECQ4 ID and ID-K508R (KR) double mutants purified from E. coli then separated by SDS-PAGE and stained with Coomassie blue.

(G) DNA strand exchange activities of the RECQ4 ID and ID-K508R (KR) proteins were measured as described in (E).

The lymphoma-prone RECQ4 ID mutant protein supports DNA replication

We next determined the effect of the RECQ4 ID mutant on cell growth and nuclear DNA replication. First we generated 293T, U2OS and HT1080 cell-lines that stably expressed a RECQ4 shRNA, which, as expected, reduced the proliferation rate of the cells (Figure 2A–B, S1A–B). The stable RECQ4 shRNA-knockdown cells were then transfected with shRNA-resistant plasmids that expressed either FLAG-tagged RECQ4 WT or the ID mutant protein at comparable levels (Figure 2C, S1C) and approximately 2–4 folds of the endogenous RECQ4 protein level (Figure S2A–B). Interestingly, the stable expression of RECQ4 ID, but not the WT protein, was toxic to HT1080 cells. Nevertheless, we found that expressing the ID mutant, but not the vector, facilitated the growth rate of the RECQ4 shRNA knockdown 293T and U2OS cells as efficiently as the WT protein (Figure 2D, S1C). Furthermore, cell cycle analysis confirmed that the RECQ4 ID cells progressed through S-phase at a similar rate to the cells expressing the WT protein (Figure S3).

Figure 2. The lymphoma-prone RECQ4 ID mutant forms chromatin-bound RECQ4-MCM complexes and supports cell growth.

Figure 2

Open in a new tab

(A) Protein levels of RECQ4 were analyzed using rabbit anti-RECQ4 antibody on western blots of whole cell extracts (WCE) prepared from HEK293T cells stably expressing a control vector or RECQ4 shRNA. Actin was used as the loading control.

(B) The effect of RECQ4 knockdown by shRNA on cell growth was measured in crystal violet cell proliferation assays.

(C) Protein levels of the WT RECQ4 and ID mutant were analyzed using rabbit anti-RECQ4 antibody on western blots of WCE prepared from RECQ4 shRNA knockdown cells that stably expressed vector alone, shRNA-resistant FLAG-RECQ4 WT or ID mutant protein.

(D) Cell proliferation rates were compared among RECQ4 shRNA knockdown cells complemented with either empty vector, an shRNA-resistant WT FLAG-RECQ4 expression construct or a plasmid expressing the FLAG-RECQ4 ID mutant protein from part C.

(E) Protein levels of RECQ4, MCM10, MCM2-7 (represented by MCM4 and MCM7), CDC45 and GINS (represented by SLD5 and PSF2) were analyzed on western blots of cytoplasmic (CE), nucleoplasmic (NE) and soluble chromatin-bound (CB) fractions that were prepared from WT RECQ4 or ID cells.

(F) Western blots of the immunopurified FLAG complexes from the soluble chromatin fractions (left 3 lanes) prepared from cells expressing vector, FLAG-RECQ4 WT or FLAG-RECQ4 ID. The immunopurified complexes were probed with antibodies to detect RECQ4, MCM10, MCM2-7 (MCM7), CDC45 and GINS (SLD5).

Human RECQ4 localizes to both the cytoplasm and the nucleus (Burks et al., 2007; Yin et al., 2004) (Figure S2C). Consistent with this, we found that the exogenously expressed FLAG-RECQ4 WT also localized to the cytoplasm and nucleus in various human cell lines (Figure S2D). Previously it was suggested that the Ala420-Ala463 residues may contain a potential nuclear retention signal (Burks et al., 2007). Indeed, we saw a decreased amount of RECQ4 ID on human chromatin, and a proportional increase of the protein in the cytoplasm (Figure 2E, top 2 panels). Immunofluorescent microscopy also showed the nuclear localization of RECQ4 ID mutant was reduced (Figure S4). However, despite the reduction, the mutant was still able to form a complex with the MCM proteins on DNA (Figure 2F). Furthermore, a higher percentage of the RECQ4 ID protein bound to chromatin was in complexes with nuclear replication factors, compared to the WT protein (Figure 2F). We suggest that this increase in percentage could compensate for the decreased amount of RECQ4 ID that is chromatin-bound. Altogether, our results indicate that the lymphoma-prone RECQ4 ID mutant protein is capable of forming functional replication helicase complexes that support DNA synthesis and cell growth.

Mitochondrial dysfunction in cells expressing the RECQ4 ID mutant protein

RECQ4 has been implicated in mtDNA maintenance (Chi et al., 2012; Croteau et al., 2012). Indeed, the 293T cells we depleted of RECQ4 contained less mtDNA than control knockdown cells (Figure 3A). Therefore, we determined if the increased amount of the RECQ4 ID protein in the cytoplasm led to increased mitochondrial localization. The cytoplasmic (CE) fraction (Figure 2E) contained both cytosolic and mitochondrial proteins. Therefore, we further separated the cytoplasmic (CE) extract into cytosolic (Cyt) and mitochondrial (MT) proteins and found that the increased amount of RECQ4 ID protein was primarily located in mitochondria (Figure 3B, S5A–B). Trypsin proteolysis of intact mitochondria confirmed there was an increased amount of RECQ4 ID protein in the mitochondrial matrix (Figure 3C), which is where the mtDNA is located. This result raised the possibility that mtDNA synthesis could be abnormal in RECQ4 ID mutant cells. To test this hypothesis, we isolated mtDNA from WT- and ID- expressing cells that had been pulse labeled with BrdU to monitor DNA synthesis. PCR analysis confirmed that the mtDNA we prepared from these cells contained little contaminating nuclear DNA (Figure 3D). Western blotting using an anti-BrdU antibody showed that when equal amounts of purified mtDNA were compared, mtDNA isolated from the ID cells had higher levels of BrdU incorporated in it, than mtDNA from WT-expressing cells (Figure 3E). This result explained the increased mtDNA copy number we observed in RECQ4 ID cells compared to WT cells (Figure 3F, S5C–D). Interestingly, we found that the difference between the amount of mitochondrial WT and ID RECQ4 protein is greatest in HT1080 cells that are transiently transfected with the RECQ4 WT or ID mutant (Figure S5B). In addition, an elevated mtDNA copy number was observed within 2 days of the transient transfection (Figure S5D). These observations may explain why we were unsuccessful at establishing an HT1080 cell-line that stably expressed RECQ4 ID protein. There was also an increase in cytoplasmic MCM10 in the RECQ4 ID cells (Figure 2E), which was due to MCM10 also being enriched in the mitochondrial fraction (Figure 3C). Because RECQ4 normally interacts with MCM10 in the nucleus (Xu et al., 2009), the excess RECQ4 ID protein and MCM10 that localized to the mitochondria was most likely transported directly from the nucleus. Nevertheless, trypsin analysis indicated that MCM10 remained at the mitochondrial outer membrane and did not enter the matrix. (Figure 3C). On the other hand, the localization of p53 to the mitochondria, which is dependent on RECQ4 (De et al., 2012), was unchanged in RECQ4 ID-expressing cells (Figure 3B–C, S5A–B).

Figure 3. The lymphoma-associated RECQ4 ID mutant is enriched in mitochondria and promotes mtDNA synthesis.

Figure 3

Open in a new tab

(A) The copy number of mtDNA compared to genomic DNA was quantified in cells stably transfected with control or RECQ4 shRNA.

(B) Mitochondrial (MT) fractions were isolated from WT RECQ4 or ID cells by centrifuging the cytoplasmic (CE) extracts to pellet the mitochondria. The supernatant that was depleted of mitochondrial proteins was collected and designated as the cytosolic (Cyt) fraction. Protein levels of RECQ4, MCM2-7 (MCM4) and p53 were analyzed on western blots of the Cyt and MT fractions (5 μg per lane). VDAC1 was used as the loading control of MT.

(C) Protein levels of RECQ4, MCM10, p53 and mitochondrial single-stranded binding protein (mtSSB) inside of the mitochondria were determined by trypsin digest of the intact mitochondria followed by mitochondrial lysis and western blotting. Proteins that were resistant to trypsin digest were localized inside the mitochondria. 25 μg of the mitochondrial extracts were used in each sample.

(D) PCR analysis to detect nuclear DNA (lower panel, Lamin B) and mtDNA (upper panel, mt D-loop) using DNA template prepared from total genomic DNA (lane 1), purified mtDNA from either RECQ4 WT or ID cells, with or without BrdU labeling (lanes 2–5). For mt D-loop PCR, 3 ng of DNA was used as template, whereas 60 ng of DNA was used for Lamin B PCR.

(E) Dot blot analysis for BrdU in the indicated amounts of mtDNA prepared from either RECQ4 WT or ID cells, with or without BrdU labeling.

(F) mtDNA copy number relative to genomic DNA was quantified in cells expressing either the WT RECQ4 or the ID mutant.

Overexpression of PEO1 leads to high mtDNA copy number and mtDNA deletions (Ylikallio et al., 2010), suggesting that rapid mtDNA synthesis could contribute to mtDNA mutagenesis. Because mtDNA encodes components of the OXPHOS complex required for ATP production, increasing the mtDNA copy number could affect the expression or function of the OXPHOS pathway. We used magnetic resonance (NMR) to analyze the metabolites of total cell extracts, which allowed us to quantitatively measure mitochondria-associated metabolites, such as intermediates of the tricarboxylic citric acid (TCA) cycle that are present at high cellular concentrations. We found that the cellular concentration of malate, NADH, oxoglutarate and ATP were decreased in RECQ4 ID cells compared to WT cells (Figure 4A–B, S6). In contrast, lactate and amino acid levels were increased in ID cells (Figure 4A–B, S6), indicating that function of mitochondria is reduced in RECQ4 ID cells, and there is an elevated rate of glycolysis in the cytosol (Figure 4C). This phenomenon is known as Warburg effect and is frequently observed in cancer cells (Vander Heiden et al., 2009).

Figure 4. RECQ4 WT and ID cells exhibit different mitochondrial metabolic profiles.

Figure 4

Open in a new tab

(A) Representative 1H NMR spectra of the hydrophilic metabolites extracted from the wild type (WT, green) and ID mutant (red) cells with expanded upfield (top) and downfield (bottom) regions. The intensity scale of the downfield region is increased in order to show the resonances clearly.

(B) Concentrations of the metabolites that have statistically significant differences (p < 0.05) between the wild type (green) and the ID mutant cells (red). For plotting convenience, the concentrations of oxypurinol shown are 10-fold lower than the actual concentrations.

(C) Schematic diagram of the metabolic pathways affected by the RECQ4 ID mutant. The red and blue arrows represent increased and decreased metabolite concentrations in the ID mutant cells compared to the wild type cells.

Novel protein-protein interactions with human RECQ4

Our data indicate that the 44 amino acids missing from the lymphoma-prone RECQ4 ID mutant are required to block its transport from the nucleus to the mitochondria, and we hypothesized that this negative regulation was accomplished via protein-protein interactions. To identify novel factor(s) that regulate the localization of RECQ4 to mitochondria, we performed a large-scale immunopurification of FLAG-RECQ4 WT protein as previously described (Xu et al., 2009), except that we used the non-chromatin fractions (e.g., a combination of cytoplasmic and nucleoplasmic extracts; Figure 5A). We used 293T cells without FLAG protein expression to subtract out non-specific polypeptides in the immunoprecipitated sample (Figure 5A, left lane), and we identified PP2A, NPM and mitochondrial p32 as the most abundant co-purified proteins (Figure 5B, S7). Using antibodies specific to RECQ4, we further confirmed that PP2A, NPM and p32 co-purified with the endogenous RECQ4 proteins in 293T cells (Figure 5C).

Figure 5. Distinct RECQ4 protein complexes identified from different cellular compartments.

Figure 5

Open in a new tab

(A) Purification and identification of non-chromatin bound FLAG-RECQ4 complexes from human cells. The immunopurified FLAG-RECQ4 complexes were separated on 4–15% gradient SDS-PAGE, and then silver stained.

(B) List of the polypeptides that were reproducibly identified in non-chromatin-bound RECQ4 complexes by mass spectrometry (left), number of peptides detected (center) and their corresponding molecular weight (right). Only those polypeptides that were not present in the control immunoprecipitation without FLAG expression, and were specific to the RECQ4 complex are listed.

(C) Western blots of the input (left) and immunopurified protein complexes isolated using control IgG (center) or RECQ4-specific antibodis (right), probed with antibodies to detect RECQ4, MCM10, PP2A, NPM and p32.

(D) Protein levels of NPM, p32, PP2A and MCM10 were analyzed on western blots of cytosolic (Cyt), mitochondrial (MT), nucleoplasmic (NE) and soluble chromatin (CB) fractions prepared from HEK293T cells. Tubulin, VDAC1, Lamin A and Histone H3 were used as markers for Cyt, MT, NE, and CB respectively.

(E–H) Western blots of the input (left 2 lanes) and FLAG-RECQ4 WT complexes immunopurified (right 2 lanes) from whole cell extracts (WCE) and (E) Cyt, (F) MT, (G) NE and (H) CB fractions probed with antibodies to detect the presence of RECQ4, MCM10, PP2A, NPM and p32.

PP2A is a serine/threonine phosphatase that is important for regulating cell growth (Janssens and Goris, 2001), and cell fractionation revealed that majority of PP2A was cytosolic (Figure 5D). NPM is an essential and multifunctional chaperone protein that is known to shuttle among several cellular compartments, including the nucleolus, nucleoplasm and cytoplasm (Falini et al., 2007). NPM has been implicated in regulating centrosome duplication, chromatin remodeling, ribosome biogenesis and maintaining genome stability (Lindstrom, 2011). We found that NPM was predominantly detected in the nucleoplasmic (NE) fraction and on the chromatin (CB; Figure 5D). The p32 protein, also known as gC1qR or HABP1, primarily resides in the mitochondria (Figure 5D), where it is thought to regulate mitochondrial innate immune responses, oxidative phosphorylation for ATP biogenesis and protein localization to the mitochondria, such as in the case of tumor suppressor ARF (Fogal et al., 2010; Itahana and Zhang, 2008; Muta et al., 1997; West et al., 2011). Nonetheless, even though each of these novel RECQ4 interacting proteins seemed to concentrate in distinct cellular compartments, they appeared to be mobile and could also be present in multiple cellular compartments (Figure 5D).

We next determined the cellular compartments in which RECQ4 interacted with these proteins by immunopurifying FLAG-RECQ4 from the cytosol (Cyt), mitochondria (MT), nucleoplasm (NE) and chromatin (CB). When compared with RECQ4 complexes purified from whole cell extracts (WCE), we asked which RECQ4 interacting proteins were enriched in RECQ4 complexes purified from specific cellular compartments. We found that PP2A, which is primarily located in the cytosol (Figure 5D), was mainly detected in the cytosolic RECQ4 complex (Figure 5E). The most stable interaction between p32 and RECQ4 was found in the mitochondria (Figure 5F). NPM, which was mostly found in the nucleus, interacted with RECQ4 primarily in the nucleoplasm (Figure 5G) but could also associate with chromatin-bound RECQ4 (Figure 5H). Previously, NPM was not detected in purified RECQ4 chromatin-bound complexes, which were isolated after a standard 2-hr benzonase digestion of the chromatin pellet (Xu et al., 2009). Chromatin-bound RECQ4-NPM complex was only detected when the chromatin was digested with benzonase overnight, suggesting that chromatin-bound RECQ4-NPM complexes are likely to be tightly associated with condensed regions of the chromosomes, such as heterochromatin. Interestingly, even though MCM10 preferentially interacted with RECQ4 on chromatin (Figure 5H), a weak amount of MCM10 was detected in the mitochondrial RECQ4 complex (Figure 5F). This is consistent with our observation that suggests MCM10 can be co-transported to the mitochondria with RECQ4.

The interaction of the lymphoma-associated RECQ4 ID mutant protein with mitochondrial p32 is defective

We next determined if the interaction of RECQ4 with PP2A, NPM or p32 was altered by the RECQ4 ID mutation. We found that PP2A and NPM co-purified with both the RECQ4 WT and ID proteins, but p32 failed to co-purify with the ID mutant (Figure 6A, S5E–F). The loss of the p32 interaction coincided with a significant increase of the mitochondrial replication helicase PEO1 in the purified RECQ4 ID complexes (Figure 6A, S5E–F). This result suggested the possibility that the interaction of RECQ4 with p32 and PEO1 is mutually exclusive. Using purified recombinant GST-p32, or GST-PEO1 bound to the glutathione beads, incubated with either purified recombinant RECQ4 WT and ID mutant protein (Figure 6B), we confirmed that GST-p32 was able to directly interact with RECQ4 WT but not the ID mutant (Figure 6C, lanes b–c). Furthermore, the interaction with p32 mapped to the RECQ4 N-terminus (Figure 6B, 1–492 a.a.; Figure 6C, lane e), which contains the 44 amino acids that are missing in the ID mutant. In contrast, both RECQ4 WT and ID mutant interacted with PEO1 (Figure 6C, lanes f–g). Even though the N-terminal fragment of RECQ4 exhibited a strong interaction with PEO1, a weaker interaction was also detected using a C-terminal fragment in vitro (Figure 6B, 450–1208 a.a.; Figure 6C, lanes h–i).

Figure 6. The lymphoma-associated RECQ4 ID mutant cannot interact with p32.

Figure 6

Open in a new tab

(A) Western blots of the immunopurified FLAG complexes from whole cell extracts (WCE) (left 3 lanes), prepared from cells expressing vector, FLAG-RECQ4 WT or FLAG-RECQ4 ID. The immunopurified complexes were probed with antibodies to detect RECQ4, MCM10, NPM, PP2A, p32 and PEO1.

(B) Schematic diagrams of RECQ4 WT and fragments used in the in vitro pull-down experiments shown in (C). The conserved SFII helicase domain is shown in light grey.

(C) Western blots of the recombinant FLAG-RECQ4 WT and fragments before (upper) and after (center) pull-down, using purified recombinant GST, GST-p32 and GST-PEO1 (bottom) bound to the glutathione beads.

(D) Western blots of the recombinant FLAG-RECQ4, GST-p32, and GST-MCM10 before (upper 3 panels) and after (center 3 panels) pull-down, using purified recombinant CBD and CBD-PEO1 bound to the chitin beads (bottom panel).

To test if p32 can affect the interaction between RECQ4 and PEO1, purified recombinant PEO1 protein tagged with chitin-binding domain (CBD) and anchored on chitin beads were incubated with recombinant RECQ4, p32 or the RECQ4-p32 complex. As expected, CBD-PEO1 was able to pull down FLAG-RECQ4, but it failed to do so if RECQ4 was pre-incubated with p32 (Figure 6D, compare lanes e and g). In contrast, MCM10, which interacts with the N-terminus of RECQ4 (Xu et al., 2009), did not block the RECQ4-PEO1 interaction (Figure 6D, compare lanes e and i). Interestingly, we found that PEO1 also interacted directly with p32 and MCM10 in vitro, but only the PEO1-p32 interaction was significantly weakened in the presence of RECQ4 (Figure 6D, lanes f–i). These results reveal a unique function for p32 in negatively regulating the RECQ4-PEO1 interaction.

p32 negatively regulates transport of RECQ4 to mitochondria

Next we tested if p32 played a role in controlling the transport of RECQ4 to the mitochondria. Indeed, depleting p32 by siRNA increased the amount of RECQ4 and MCM10 in mitochondria and there was a corresponding decrease in nuclear RECQ4 and MCM10 levels (Figure 7A–B). Interestingly, in NPM-depleted cells, p32 accumulated in the cytosolic fraction, which resulted in a modest decrease in the amount of mitochondrial p32 (Figure 7C). This observation reveals an unexpected functional interaction between NPM and p32 that has not been previously described and provides an explanation for the slight but noticeable increase of RECQ4 in the mitochondria of NPM knockdown cells (Figure 7A). Importantly, because the RECQ4 ID mutant protein fails to interact with p32, it can no longer be regulated by p32, and therefore, as expected, depleting p32 had little effect on the localization and accumulation of the RECQ4 ID mutant to the mitochondria (Figure 7A). Indeed, unlike cells expressing RECQ4 WT proteins, depleting p32 from cells expressing RECQ4 ID mutant did not significantly increase the mtDNA copy number (Figure 7D). Altogether, these results demonstrate a function for p32 in controlling the amount of RECQ4 that was transported to the mitochondria.

Figure 7. The lymphoma-associated RECQ4 ID mutant cannot be regulated by mitochondrial p32.

Figure 7

Open in a new tab

(A) Protein levels of NPM, p32 and RECQ4 were analyzed on western blots of WCE (top 4 panels) and mitochondria (MT, bottom 2 panels) prepared from HEK293T cells that expressed either RECQ4 WT or ID proteins, and were treated with control, NPM or p32 siRNA. Actin and VDAC1 were used as loading controls for WCE and MT respectively.

(B) Protein levels of RECQ4 and MCM10 in cytosolic (Cyt), mitochondrial (MT) and nuclear (NE/CB) fractions prepared from control or p32 siRNA-treated cells were analyzed on western blots. MCM4, VDAC1 and Histone H3 were used as loading controls.

(C) Protein levels of p32 in cytosolic (Cyt), mitochondrial (MT) and nuclear (NE/CB) fractions prepared from control or NPM siRNA-treated cells were analyzed on western blots. Actin, VDAC1 and Histone H3 were used as loading controls.

(D) The copy number of mtDNA relative to genomic DNA was quantified in RECQ4 WT and ID cells that were transfected with control or p32 siRNA.

DISCUSSION

Nuclear DNA and mtDNA synthesis are known to be coordinated during the cell cycle (Chatre and Ricchetti, 2013). Mammalian RECQ4 is an essential enzyme involved in both nuclear DNA and mtDNA synthesis (Croteau et al., 2012; Liu, 2010). Our study demonstrates that the Ala420-Ala463 residues, which are missing in the most common and highly cancer-prone RECQ4 ID mutation, play a crucial role in balancing the distribution of RECQ4 between the nucleus and mitochondria, and provides an explanation for the decreased nuclear retention observed previously for this RECQ4 mutant (Burks et al., 2007). We provide evidence that supports our conclusion that the excess RECQ4 ID mutant proteins found in the mitochondria were transported from the nucleus. First, the increased amount of RECQ4 ID mutant protein in the mitochondria was accompanied by decreased levels of chromatin-bound ID protein (Figure 2E–F, 3B–C). Second, MCM10, which is the primary protein that interacts with RECQ4 on human chromatin, also showed increased mitochondrial localization in RECQ4 ID cells (Figure 3C). Finally, we identified three novel proteins (PP2A, NPM, p32) that interacted with RECQ4 in various cellular compartments (Figure 5) and showed that the RECQ4 ID mutant cannot bind to p32 in human cells (Figure 6A). Loss of p32 binding led to an accumulation of the RECQ4 mutant protein in the mitochondria, an enhanced level of interaction of RECQ4 ID with the mitochondrial replication helicase PEO1, and increases in mtDNA synthesis. Consistent with a role for p32 as a negative regulator of RECQ4 transport from the nucleus to the mitochondria, depleting p32 is also sufficient to disrupt the balance of the nuclear and mitochondrial distribution of WT RECQ4 and MCM10 (Figure 7A–B).

Future work is needed to define the exact molecular mechanism by which p32 prevents RECQ4 and MCM10 from localizing to the mitochondria. p32 is also known to localize to the nucleus, although to a lesser extent, and participate in cellular processes that involve nuclear proteins (Brokstad et al., 2001). Possibly RECQ4-MCM10 transiently interact with p32 in the nucleus. We suggest that p32 could be a component of the protein shuttling system between mitochondria and the nucleus. In support of this, p32 promotes the nuclear import of adenovirus core protein V (Matthews and Russell, 1998) and the translocation of tumor suppressor ARF to mitochondria to activate p53-dependent apoptosis (Itahana and Zhang, 2008). Alternatively, the interaction of RECQ4 with p32 at mitochondria may provide a negative feedback signal or prevent interaction with other mitochondrial protein(s), such as PEO1, whose interaction with RECQ4 is mutually exclusive to p32 (Figure 6D), to limit the mitochondrial association and entry of RECQ4.

Interestingly, even though both RECQ4 and MCM10 can be found in mitochondria, only the RECQ4 protein was transported into the mitochondrial matrix; MCM10 remained mostly at the outer mitochondrial membrane (Figure 3C). It is possible that upon being transported to the mitochondria, RECQ4 dissociates from MCM10 via other protein-protein interaction(s), such as PEO1. However, when we tested the possibility that PEO1 may disrupt RECQ4-MCM10 interaction in vitro, this was not the case (Figure 6D). Alternatively, post-translational modifications might play a role in modulating the localization and interactions of RECQ4 with other proteins. In support of this, we have shown that the RECQ4-MCM10 interaction may be disrupted by potential CDK-dependent phosphorylation (Xu et al., 2009). We also observed that RECQ4 was present in multiple phosphorylation states in vivo (Wang and Liu, unpublished data). Similarly, RECQ4 phosphorylation may also regulate p32-RECQ4 interaction to allow limited amount of RECQ4 to enter mitochondria and promote mtDNA synthesis.

In addition to MCM10, RECQ4 promotes the mitochondrial localization of the p53 tumor suppressor (De et al., 2012). In this study, we reported that although the RECQ4 ID mutant accumulated in the mitochondria, the p53 level in mitochondria was unaffected (Figure 3B–C). It is worth mentioning that NPM blocks p53 from being transported to the mitochondria (Dhar and St Clair, 2009). Therefore, it would be of great interest to test if NPM prevents p53 mitochondrial transport through its interaction with RECQ4. This possibility would provide an explanation for why p53 levels at the mitochondria were unaffected in RECQ4 ID cells, because the RECQ4 ID mutant remained capable of interacting with NPM (Figure 6A).

In this study, we also revealed an unexpected functional interaction between p32 and NPM. We showed that NPM prevented the loss of p32 at mitochondria and the accumulation in the cytosol (Figure 7C). Cumulative literature provides evidence that both NPM and p32 interact with the ARF tumor suppressor (Chen et al., 2010; Itahana and Zhang, 2008), which is required for p53-mediated apoptosis. p32 promotes ARF localization to the mitochondria, which sensitizes the cells to p53-induced apoptosis (Itahana and Zhang, 2008). In the nucleus, NPM abolishes ULF-mediated degradation of ARF to activate the p53-mediated stress response (Chen et al., 2010). Further studies are needed to determine if NPM has a direct role in shuttling p32 from the cytosol to the mitochondria or if the shuttling is indirectly regulated through common interacting proteins, such as RECQ4 or ARF.

In summary, the importance of the interaction between p32 and RECQ4 is illustrated by the fact that the highly cancer-prone RECQ4 ID mutant failed to interact with p32, leading to increases in mtDNA copy number and mitochondrial dysfunction. Alterations to mtDNA content in cells can have profound effects on human diseases including aging and cancers. This study provides new insights into both the aging and cancer etiology of RECQ4 mutations.

EXPERIMENTAL PROCEDURES

Plasmids and proteins

The shRNA expression plasmid, pInduceMir3, was kindly provided by Dr. Stephen J. Elledge (Harvard University). To generate the pInduceMir3-RECQ4-shRNA plasmid, a DNA fragment containing the sequence, 5′-TGCTGTTGACAGTGAGCGCCGGCT CAACATGAAGCAGAAATAGTGAAGCCACAGATGTATTTCTGCTTCATGTTGA GCCGTTGCCTACTGCCTCGGA-3′, was PCR amplified and cloned into pInduceMir3 between the XhoI and EcoRI sites. The pCMV-FLAG-RECQ4 was generated as previously described (Xu et al., 2009). The shRNA-resistant FLAG-RECQ4 expressing plasmid, pCMV-FLAG-RECQ4-R, was generated by mutagenesis using the oligo 5′-ACAGGGGCAATTACGTTAGATTGAATATGAAACAAAAGCACTACGTGCGGGG CC-3′, and pCMV-FLAG-RECQ4 as the template. The mutagenesis primer 5′-CCAGTGTCCCCGGCCAGAGACGCCGGCTGAGG-3′, was used to generate shRNA-resistant pCMV-FLAG-RECQ4ID-R using pCMV-FLAG-RECQ4-R as the template and pET16b-RECQ4ID-FLAG using pET16b-RECQ4-FLAG as the template (Xu and Liu, 2009). pET16b-RECQ(450-1208)-FLAG, and pET16b-RECQ4(1-492)-FLAG were generated as previously described (Xu and Liu, 2009). The mutagenesis primer 5′-GCCTACAGGTGCCGGCAGGTCCCTGTGCTACCAGC-3′ was used to generate pET16b-RECQ4ID(K508R)-FLAG. To generate pGEX4T1-p32 or pGEX4T1-PEO1, p32 or PEO1 was PCR amplified from 293T cDNA library, and cloned into pGEX4T-1 (GE Healthcare) between the EcoRI and XhoI sites. pGEX4T1-MCM10 was generated as described previously (Xu et al., 2009). To generate pTXB1-PEO1, PEO1 was cloned into pTXB1 (New England BioLabs) between NdeI and XhoI sites. N-terminal His-tagged and C-terminal FLAG-tagged WT RECQ4, RECQ4ID, RECQID(K508R), RECQ(450-1208), and RECQ4(1-492) proteins were purified as previously described (Xu and Liu, 2009). GST-p32, GST-PEO1 and GST were purified as described for GST-MCM10 purification (Xu and Liu, 2009). CBD-PEO1 and CBD were expressed in Rosetta (DE3) pLysS cells by inducing with 0.1 mM isopropyl-β-D-thio-galactoside overnight at 4°C. Cell pellets were resuspended in buffer C (20 mM Tris pH8.0, 500 mM NaCl, 1 mM EDTA, 0.1% Triton X-100) plus 0.2 mg/ml lysozyme and 1x protease inhibitor cocktail (Roche) and lysed by sonication. After centrifuging, the supernatant was incubated with Chitin beads (New England BioLabs) for 2 hours at 4°C. The beads were washed extensively with buffer C and stored in buffer B (50 mM Tris pH8.0, 300 mM NaCl, 50% Glycerol, 1 mM DTT, 1% Triton X-100).

Antibodies

Rabbit anti-FLAG (F7425) was purchased from Sigma. Goat anti-Actin (sc1616), mouse anti-p53 (DO-1) (sc-126), rabbit anti-NPM (sc-5564), rabbit anti-Histone H3 (sc-10809), rabbit anti-CDC45 (sc-20685), mouse anti-CDC6 (sc-9964), mouse anti-α tubulin (sc-8035), mouse anti-GST (sc-138), rabbit anti- Lamin A/C (sc-20681) were purchased from Santa Cruz. Rabbit anti-VDAC1 (ab15895) and rabbit anti-MCM7 (ab52489) were purchased from Abcam. Rabbit anti-p32 (6502S) and rabbit anti-PP2Aα subunit (2039S) were purchased from Cell Signaling Technology. Rabbit anti-SLD5 (2079.00.02), rabbit anti-RECQ4 (2547.00.02) that were used in the co-immunoprecipitation experiments (Figure 5C) were purchased from Strategic Diagnostics Inc. Rat anti-BrdU (MCA2060T) was purchased from AbD Serotec. Rabbit anti-MCM10 (12251-1-AP) and rabbit anti- PSF2 (16247-1-AP) were purchased from Proteintech Group. Rabbit anti-MCM4 (A300-193A) was purchased from Bethyl Laboratories. Rabbit anti-PEO1 (ARP36483_P050) was purchased from AVIVA Systems Biology. Mouse anti-p84 (GTX70220) was purchased from GeneTex. Mouse anti-CBD (E80345) was purchased from New England Biolabs. Rabbit anti-dimethyl-Histone H3 (Lys36) (07-274) was purchased from MILLIPORE. Rabbit anti-RECQ4 used in western blot analyses (Figure 2A, 2C, 5C, S1, S2A, S2C) was generated as previously described (Xu et al., 2009). Rabbit anti-mtSSB was kindly provided by Dr. Valeria Tiranti (IRCCS Foundation Neurological Institute, Milan, Italy).

Cell culture, siRNA and cell proliferation assay

All cells were cultured in DMEM medium supplemented with 10% Fetal bovine serum (FBS) and streptomycin/penicillin (100 U/ml). NPM stealth siRNA 5′-UGCAAAGGAUGAGUUGCACAUUGUU-3′ and p32 stealth siRNA 5′-GACGAGGCUGAGAGUGACAUCUUCU-3′ were purchased from Invitrogen. The siRNAs (25 nM) were transfected using DharmaFECT 1 transfection reagent (Thermo Fisher Scientific Inc) for 48 h according to the manufacturer’s protocol. Stable shRNA expressing cell lines were established by transfecting the pInduceMir3 vector or pInduceMir3-RECQ4-shRNA, and selecting with 2 μg/ml puromycin. To establish WT FLAG-RECQ4 and ID stable 293T cell-lines, the RECQ4 shRNA stable cell line was cotransfected with pIREShyg3 (Clontech) and either pCMV-FLAG-RECQ4-R or pCMV-FLAG-RECQ4ID-R plasmid, then selected with 200 μg/ml hygromycin. To establish WT FLAG-RECQ4 and ID stable U2OS and HT1080 cell-lines, the RECQ4 shRNA stable cell line was transfected with pCMV-FLAG-RECQ4-R or pCMV-FLAG-RECQ4ID-R plasmid, then transformed cells were selected using 400 μg/ml G418. Single clones were picked and screened on western blots probed with the appropriate antibodies. Positive clones were further amplified to establish stable cell lines. Crystal violet cell proliferation assays were performed as previously described (Kueng et al., 1989).

ATPase and DNA strand exchange assays

DNA unwinding assays were performed as previously described (Xu and Liu, 2009). The ATPase activity was measured by incubating the purified recombinant RECQ4 proteins with 8 pmol ssDNA and 2.5× 102 μCi [γ-32P] ATP in a 10 μl reaction containing ATPase buffer (30 mM Tris pH7.5, 10% glycerol, 5 mM MgCl2, 50 μM cold ATP, 1 mM DTT, 100 μg/ml BSA) for 1 hr at 37 °C. The reactions were stopped by adding 5 μl of 0.5 M EDTA and separated by PEI-cellulose thin-layer chromatography plate using a solution of 0.8 M LiCl and 1 M formic acid, and incubating in a moist chamber for 1.5 hr. The percentage of ATPase hydrolysis was quantified using a phosphoimager.

Cell fractionation, immunopurification and mass spectrometry analysis

Cells were fractionated into cytosolic, nucleoplasmic and benzonase-treated soluble chromatin-bound fractions as previously described (Xu et al., 2009). To isolate the mitochondrial fraction, the cell pellet was resuspended in mitochondrial buffer (210 mM sucrose, 70 mM mannitol, 1 mM EDTA, 1 mM EGTA, 1.5 mM MgCl2, 10 mM Hepes (KOH) pH7.2) that contained EDTA-free protease inhibitors and phosphatase inhibitors, and incubated on ice for 30 min. After homogenization, cell lysates were centrifuged at 1,000 g for 5 min to pellet the intact cells and nuclei. The supernatant was further centrifuged at 10,000 g to pellet the mitochondria enriched heavy membrane fraction. The supernatant was collected as cytosol without mitochondria. The mitochondria enriched pellet was washed with mitochondrial buffer twice, then resuspended in mitochondrial lysis buffer (20 mM HEPES pH7.9, 1.5 mM MgCl2, 1 mM EDTA, 150 mM KCl, 0.1% NP40, 1 mM DTT, 10% glycerol) that contained 0.15 unit/ul Benzonase and EDTA-free protease inhibitors and phosphatase inhibitors, sonicated and incubated on ice for one hr. The supernatant was collected as the mitochondrial fraction. For trypsin analysis, intact mitochondria were isolated and incubated with 100 μg/ml trypsin in mitochondrial buffer for 20 minutes on ice. The trypsin-treated mitochondria were recovered by centrifuging, and trypsin was inactivated by adding 1X SDS-PAGE loading buffer. Immunopurification and mass spectrometry analysis of the FLAG-tagged RECQ4 and the endogenous RECQ4 complexes were performed as previously described (Xu et al., 2009).

mtDNA copy number

Total cellular DNA was isolated using the DNeasy Blood & Tissue Kit (Qiagen). Genomic DNA (Lamin B origin) and mtDNA (D-Loop) were quantified by real-time PCR using SYBR GREEN (POWER) PCR MASTER MIX (Life Technologies Corporation) and the ABI 7500 Fast Real-Time PCR System. All the reactions were run in triplicate. Relative mtDNA copy numbers were normalized with genomic DNA (Lamin B origin). The D-loop PCR primers were 5′-GTGGCTTTGGAGTTGCAGTT-3′ and 5′-GAAGCAGATTTGGGTACCAC-3′. The Lamin B origin primers were 5′-ATGAAGCGGATGTCTAAGAAAG-3′ and 5′-CGCCTGGGTCCTGTTTACAC-3′.

Mitochondrial DNA synthesis

RECQ4 shRNA-resistant expressing plasmids pCMV-FLAG-RECQ4-R and pCMV-FLAG-RECQ4ID-R were transfected into RECQ4 shRNA cells with continuum transfection reagent (Gemini Bio). After 48 hrs, cells were further incubated with or without 30 μM BrdU for 4 hrs. To prepare mtDNA, cells were harvested and mitochondria were isolated as described above. The mitochondria were then resuspended in DNA isolation buffer (10 mMris pH8.0, 10 mM EDTA, 0.5% SDS buffer, and 100 μg/ml protease K), incubated at 45°C for 5 hrs, then phenol-chloroform extracted and ethanol precipitated. The presence of genomic DNA contaminants was excluded by performing PCR analysis of Lamin B gene using primers, 5′-CTGCAGCTGGGGCTGGCATG-3′ and 5′-GACATCCGCTTCATTAGGGCAG-3′ for LAMIN B Ori locus (Xu et al., 2009). The indicated amounts of mtDNA were blotted onto a nitrocellulose membrane and vacuum dried for 2 hrs at 80°C as described (Terry brown, Current Protocols in Molecular Biology, Unit 2.9B DOI: 10.1002/0471142727.mb0209bs21). The membrane was then probed with mouse anti-BrdU antibody (MD5100, Invitrogen) and washed as for western blotting.

Metabolite measurement

The metabolites from the cells transfected with RECQ4 WT and ID mutant were extracted as previously described (Cano et al., 2010). The lyophilized, water-soluble metabolites were resuspended in 100% D2O containing 3.2 μM DSS (4,4-dimethyl-4-silapentane-1-sulfonic acid), which served as the 1H chemical shift reference and an internal concentration standard. Three replicates were prepared. NMR spectra were acquired at 25 °C on a Bruker Avance III spectrometer equipped with a cryoprobe operating at a 700.243 MHz 1H frequency. 1H NMR spectra were acquired with water presaturation during relaxation delay and using spoil gradient over 32k data points, spectral width of 13 kHz, 3 s relaxation delay and 2048 scans. The NMR spectra were processed using the Chenomx NMR Suite Processor (version 7.1, Chenomx Inc., Edmonton, Canada). The Chenomx NMR Suite Profiler software was used to identify and quantify the metabolites. The concentrations of the metabolites were converted from micromolar units to nmoles by multiplying the sample volume and adjusting for the number of cells in the sample.

Protein interactions in vitro

GST, GST-p32, GST-PEO1 or GST-MCM10 (4 nmole) bound to glutathione beads were blocked with 1 mg/ml BSA in buffer D (40 mM Tris pH7.4, 10% Glycerol, 0.1% Triton X-100, 1 mM EDTA, 150 mM NaCl, 1 mM DTT) for 1 hour at 4°C. His-and FLAG-tagged RECQ4 FL and fragments (0.4 nmole) were added and incubated for 2 hour at 4°C. The bound proteins were washed extensively with buffer D, boiled in SDS sample buffer, then separated by SDS-PAGE, and analyzed on western blots. For in vitro competition assays, the His- and FLAG-tagged RECQ4 FL (0.5 nmole) were incubated with or without p32 or MCM10 (0.5 nmole) in the presence of 2 ug BSA for 1.5 hour at 4°C, then added to BSA-blocked CBD of CBD-PEO1 (0.5 nmole) bound chitin beads and incubated a further 1.5 hour at 4°C. The bound proteins were washed extensively with buffer D, boiled in SDS sample buffer, separated on SDS-PAGE, and analyzed on western blots.

Supplementary Material

01

Highlights.

  • PP2A, NPM and p32 are the newly identified RECQ4 interacting proteins.

  • p32 negatively controls the transport of RECQ4 from the nucleus to mitochondria.

  • The lymphoma-prone RECQ4 Ala420-Ala463 mutation abolishes the p32 interaction.

  • The lymphoma-prone RECQ4 mutation leads to mitochondrial dysfunction.

Acknowledgments

We thank Dr. Margaret Morgan for her comments and expert editing of this manuscript. This work was supported by NIH R01 CA151245, Yale Comprehensive Cancer Center Pilot Research Grant, Elsa U. Pardee Foundation research grant to YL. The NMR study was supported by NIH R01 GM 086171 to YC.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Abe T, Yoshimura A, Hosono Y, Tada S, Seki M, Enomoto T. The N-terminal region of RECQL4 lacking the helicase domain is both essential and sufficient for the viability of vertebrate cells. Role of the N-terminal region of RECQL4 in cells. Biochim Biophys Acta. 2011;1813:473–479. doi: 10.1016/j.bbamcr.2011.01.001. [DOI] [PubMed] [Google Scholar]
  2. Brokstad KA, Kalland KH, Russell WC, Matthews DA. Mitochondrial protein p32 can accumulate in the nucleus. Biochem Biophys Res Commun. 2001;281:1161–1169. doi: 10.1006/bbrc.2001.4473. [DOI] [PubMed] [Google Scholar]
  3. Burks LM, Yin J, Plon SE. Nuclear import and retention domains in the amino terminus of RECQL4. Gene. 2007;391:26–38. doi: 10.1016/j.gene.2006.11.019. [DOI] [PubMed] [Google Scholar]
  4. Cano KE, Li YJ, Chen Y. NMR metabolomic profiling reveals new roles of SUMOylation in DNA damage response. J Proteome Res. 2010;9:5382–5388. doi: 10.1021/pr100614a. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Carew JS, Nawrocki ST, Xu RH, Dunner K, McConkey DJ, Wierda WG, Keating MJ, Huang P. Increased mitochondrial biogenesis in primary leukemia cells: the role of endogenous nitric oxide and impact on sensitivity to fludarabine. Leukemia. 2004;18:1934–1940. doi: 10.1038/sj.leu.2403545. [DOI] [PubMed] [Google Scholar]
  6. Chatre L, Ricchetti M. Prevalent coordination of mitochondrial DNA transcription and initiation of replication with the cell cycle. Nucleic Acids Res. 2013;41:3068–3078. doi: 10.1093/nar/gkt015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chen D, Shan J, Zhu WG, Qin J, Gu W. Transcription-independent ARF regulation in oncogenic stress-mediated p53 responses. Nature. 2010;464:624–627. doi: 10.1038/nature08820. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chi Z, Nie L, Peng Z, Yang Q, Yang K, Tao J, Mi Y, Fang X, Balajee AS, Zhao Y. RecQL4 cytoplasmic localization: implications in mitochondrial DNA oxidative damage repair. Int J Biochem Cell Biol. 2012;44:1942–1951. doi: 10.1016/j.biocel.2012.07.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Croteau DL, Rossi ML, Canugovi C, Tian J, Sykora P, Ramamoorthy M, Wang ZM, Singh DK, Akbari M, Kasiviswanathan R, et al. RECQL4 localizes to mitochondria and preserves mitochondrial DNA integrity. Aging Cell. 2012;11:456–466. doi: 10.1111/j.1474-9726.2012.00803.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. D’Souza AD, Parikh N, Kaech SM, Shadel GS. Convergence of multiple signaling pathways is required to coordinately up-regulate mtDNA and mitochondrial biogenesis during T cell activation. Mitochondrion. 2007;7:374–385. doi: 10.1016/j.mito.2007.08.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. De S, Kumari J, Mudgal R, Modi P, Gupta S, Futami K, Goto H, Lindor NM, Furuichi Y, Mohanty D, Sengupta S. RECQL4 is essential for the transport of p53 to mitochondria in normal human cells in the absence of exogenous stress. J Cell Sci. 2012;125:2509–2522. doi: 10.1242/jcs.101501. [DOI] [PubMed] [Google Scholar]
  12. de Souza-Pinto NC, Aamann MD, Kulikowicz T, Stevnsner TV, Bohr VA. Mitochondrial helicases and mitochondrial genome maintenance. Mech Ageing Dev. 2010;131:503–510. doi: 10.1016/j.mad.2010.04.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Dhar SK, St Clair DK. Nucleophosmin blocks mitochondrial localization of p53 and apoptosis. J Biol Chem. 2009;284:16409–16418. doi: 10.1074/jbc.M109.005736. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Falini B, Nicoletti I, Bolli N, Martelli MP, Liso A, Gorello P, Mandelli F, Mecucci C, Martelli MF. Translocations and mutations involving the nucleophosmin (NPM1) gene in lymphomas and leukemias. Haematologica. 2007;92:519–532. doi: 10.3324/haematol.11007. [DOI] [PubMed] [Google Scholar]
  15. Fogal V, Richardson AD, Karmali PP, Scheffler IE, Smith JW, Ruoslahti E. Mitochondrial p32 protein is a critical regulator of tumor metabolism via maintenance of oxidative phosphorylation. Mol Cell Biol. 2010;30:1303–1318. doi: 10.1128/MCB.01101-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Ickikawa K, Noda T, Furuichi Y. Preparation of the gene targeted knockout mice for human premature aging diseases, Werner syndrome, and Rothmund-Thomson syndrome caused by the mutation of DNA helicases. Nippon Yakurigaku Zasshi. 2002;119:219–226. doi: 10.1254/fpj.119.219. [DOI] [PubMed] [Google Scholar]
  17. Im JS, Ki SH, Farina A, Jung DS, Hurwitz J, Lee JK. Assembly of the Cdc45-Mcm2-7-GINS complex in human cells requires the Ctf4/And-1, RecQL4, and Mcm10 proteins. Proc Natl Acad Sci U S A. 2009;106:15628–15632. doi: 10.1073/pnas.0908039106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Itahana K, Zhang Y. Mitochondrial p32 is a critical mediator of ARF-induced apoptosis. Cancer cell. 2008;13:542–553. doi: 10.1016/j.ccr.2008.04.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Janssens V, Goris J. Protein phosphatase 2A: a highly regulated family of serine/threonine phosphatases implicated in cell growth and signalling. Biochem J. 2001;353:417–439. doi: 10.1042/0264-6021:3530417. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Jeng JY, Yeh TS, Lee JW, Lin SH, Fong TH, Hsieh RH. Maintenance of mitochondrial DNA copy number and expression are essential for preservation of mitochondrial function and cell growth. J Cell Biochem. 2008;103:347–357. doi: 10.1002/jcb.21625. [DOI] [PubMed] [Google Scholar]
  21. Jeon JP, Shim SM, Nam HY, Baik SY, Kim JW, Han BG. Copy number increase of 1p36.33 and mitochondrial genome amplification in Epstein-Barr virus-transformed lymphoblastoid cell lines. Cancer genetics and cytogenetics. 2007;173:122–130. doi: 10.1016/j.cancergencyto.2006.10.010. [DOI] [PubMed] [Google Scholar]
  22. Kueng W, Silber E, Eppenberger U. Quantification of cells cultured on 96-well plates. Analytical biochemistry. 1989;182:16–19. doi: 10.1016/0003-2697(89)90710-0. [DOI] [PubMed] [Google Scholar]
  23. Lan Q, Lim U, Liu CS, Weinstein SJ, Chanock S, Bonner MR, Virtamo J, Albanes D, Rothman N. A prospective study of mitochondrial DNA copy number and risk of non-Hodgkin lymphoma. Blood. 2008;112:4247–4249. doi: 10.1182/blood-2008-05-157974. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lee HC, Wei YH. Mitochondria and aging. Adv Exp Med Biol. 2012;942:311–327. doi: 10.1007/978-94-007-2869-1_14. [DOI] [PubMed] [Google Scholar]
  25. Lindstrom MS. NPM1/B23: A Multifunctional Chaperone in Ribosome Biogenesis and Chromatin Remodeling. Biochemistry research international. 2011;2011:195209. doi: 10.1155/2011/195209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Liu Y. Rothmund-Thomson syndrome helicase, RECQ4: on the crossroad between DNA replication and repair. DNA Repair (Amst) 2010;9:325–330. doi: 10.1016/j.dnarep.2010.01.006. [DOI] [PubMed] [Google Scholar]
  27. Matthews DA, Russell WC. Adenovirus core protein V interacts with p32--a protein which is associated with both the mitochondria and the nucleus. The Journal of general virology. 1998;79(Pt 7):1677–1685. doi: 10.1099/0022-1317-79-7-1677. [DOI] [PubMed] [Google Scholar]
  28. Muta T, Kang D, Kitajima S, Fujiwara T, Hamasaki N. p32 protein, a splicing factor 2-associated protein, is localized in mitochondrial matrix and is functionally important in maintaining oxidative phosphorylation. J Biol Chem. 1997;272:24363–24370. doi: 10.1074/jbc.272.39.24363. [DOI] [PubMed] [Google Scholar]
  29. Sangrithi MN, Bernal JA, Madine M, Philpott A, Lee J, Dunphy WG, Venkitaraman AR. Initiation of DNA replication requires the RECQL4 protein mutated in Rothmund-Thomson syndrome. Cell. 2005;121:887–898. doi: 10.1016/j.cell.2005.05.015. [DOI] [PubMed] [Google Scholar]
  30. Siitonen HA, Sotkasiira J, Biervliet M, Benmansour A, Capri Y, Cormier-Daire V, Crandall B, Hannula-Jouppi K, Hennekam R, Herzog D, et al. The mutation spectrum in RECQL4 diseases. Eur J Hum Genet. 2009;17:151–158. doi: 10.1038/ejhg.2008.154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Thangavel S, Mendoza-Maldonado R, Tissino E, Sidorova JM, Yin J, Wang W, Monnat RJ, Jr, Falaschi A, Vindigni A. Human RECQ1 and RECQ4 helicases play distinct roles in DNA replication initiation. Mol Cell Biol. 2010;30:1382–1396. doi: 10.1128/MCB.01290-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Vander Heiden MG, Cantley LC, Thompson CB. Understanding the Warburg effect: the metabolic requirements of cell proliferation. Science. 2009;324:1029–1033. doi: 10.1126/science.1160809. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. West AP, Shadel GS, Ghosh S. Mitochondria in innate immune responses. Nature reviews Immunology. 2011;11:389–402. doi: 10.1038/nri2975. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Xu X, Liu Y. Dual DNA unwinding activities of the Rothmund-Thomson syndrome protein, RECQ4. EMBO J. 2009;28:568–577. doi: 10.1038/emboj.2009.13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Xu X, Rochette PJ, Feyissa EA, Su TV, Liu Y. MCM10 mediates RECQ4 association with MCM2-7 helicase complex during DNA replication. EMBO J. 2009;28:3005–3014. doi: 10.1038/emboj.2009.235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Yin J, Kwon YT, Varshavsky A, Wang W. RECQL4, mutated in the Rothmund-Thomson and RAPADILINO syndromes, interacts with ubiquitin ligases UBR1 and UBR2 of the N-end rule pathway. Hum Mol Genet. 2004;13:2421–2430. doi: 10.1093/hmg/ddh269. [DOI] [PubMed] [Google Scholar]
  37. Ylikallio E, Tyynismaa H, Tsutsui H, Ide T, Suomalainen A. High mitochondrial DNA copy number has detrimental effects in mice. Hum Mol Genet. 2010;19:2695–2705. doi: 10.1093/hmg/ddq163. [DOI] [PubMed] [Google Scholar]
  38. Yu M. Generation, function and diagnostic value of mitochondrial DNA copy number alterations in human cancers. Life Sci. 2011;89:65–71. doi: 10.1016/j.lfs.2011.05.010. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01
NIHMS580009-supplement-01.pdf (9.7MB, pdf)

RESOURCES