Abstract
Potato virus Y (PVY) is one of the most important viruses affecting potato (Solanum tuberosum) production. In this study, a novel hypersensitive response (HR) gene, Ny-2, conferring resistance to PVY was mapped on potato chromosome XI in cultivar Romula. In cultivars Albatros and Sekwana, the Ny-1 gene was mapped on chromosome IX. In cv. Romula, the local lesions appeared in leaves inoculated with the PVYN-Wi isolate at 20 and 28 °C; PVY systemic infections were only occasionally observed at the higher temperature. In cvs. Albatros and Sekwana, expression of the necrotic reaction to virus infection was temperature-dependent. PVYN-Wi was localized at 20 °C; at 28 °C, the systemic, symptomless infection was observed. We developed the B11.61600 marker co-segregating with Ny-2 and the S1d11 marker specific for the Ny-1 gene. Fifty potato cultivars were tested with markers B11.6 and S1d11 and marker SC895 linked to the Ny-1 gene in cv. Rywal. These results indicated the utility of these markers for marker-assisted selection of HR-like PVY resistance in potato breeding programs.
Keywords: Potato cultivars, PVY, Hypersensitivity, Mapping, Marker-assisted selection
Potato virus Y (PVY) is the most harmful virus infecting potato crops (Valkonen 2007). In potato cultivars, Ry genes confer extreme resistance (ER) to all PVY strains. Plants expressing ER typically remain symptomless, with extremely low viral accumulation in inoculated leaves (Valkonen et al. 1996; Hämäläinen et al. 1998). Three genes that confer ER resistance were identified in potato: the Ry sto gene (also designated as Ry-f sto) derived from S. stoloniferum on potato chromosome XII (Flis et al. 2005; Song et al. 2005); the Ry adg gene from S. tuberosum ssp. andigena on chromosome XI (Hämäläinen et al. 1997), and Ry chc from S. chacoense on chromosome IX (Sato et al. 2006). The hypersensitive response (HR) is another potato defense mechanism against PVY (Valkonen et al. 1996). The typical HR involves effective pathogen restriction in infected cells, which is associated with necrotic lesion generation at infection sites (Kang et al. 2005). Studies have shown that HR is responsible for limiting pathogen spread, which has the potential to result in systemic necrosis development (Valkonen et al. 1996). Rywal is the first potato cultivar in which temperature-dependent HR expression against PVYO and PVYN strains was detected. The Ny-1 gene was mapped on potato chromosome IX (Szajko et al. 2008). Here we report mapping of HR-like genes conferring resistance to PVY in potato cultivars Albatros, Sekwana, and Romula, and the development of PCR markers useful for marker-assisted selection in potato breeding programs.
Three potato cultivars, Albatros, Romula and Sekwana, were evaluated for resistance to the isolate PVYN-Wi (accession number Z70238). The PVYN-Wi status was verified using the protocol reported by Lorenzen et al. (2006). Potato plants were grown for 2 weeks under greenhouse conditions, and transferred 1 week prior to infection experiments to growth chambers under controlled environmental conditions (20 or 28 °C, 16 h light at 100 mol/s/m2, 8 h dark). For each cultivar, six plants were mechanically inoculated with a sap extracted from the tobacco plants that were infected with PVYN-Wi. Inoculated potato plants were divided into two groups; one group was incubated at 20 °C, the other at 28 °C. Water-treated detached leaves and plants were used as negative controls. Samsun tobacco plants inoculated with PVYN-Wi were used as positive controls. Hypersensitivity was visualized after 4–6 days. Nine days following inoculation, 1 g of inoculated and non-inoculated upper leaf samples from each of the plants was collected to detect the virus by RT-PCR, which was performed as described by Szajko et al. (2008) with minor modifications. In addition, ELISA tests were performed on inoculated and upper leaves 3 weeks post-inoculation at 20 °C. PVY monoclonal cocktail Bioreba AG kit (Reinach, Switzerland) was used. Experiments were repeated three times with similar results.
At 20 °C, cvs. Albatros and Sekwana exhibited a hypersensitive response to PVYN-Wi infection in inoculated leaves. The virus was not detected in the upper, non-inoculated leaves. At 28 °C, systemic symptomless infections were observed. In cv. Romula, the local necrotic lesions appeared at 20 and 28 °C. Occasionally, HR failed to restrict PVY progression to upper, non-inoculated leaves of cv. Romula grown at 28 °C. Albatros (A) and Sekwana (Se) were crossed with the PVY-susceptible Dutch cultivar Accent (Ac) to obtain mapping populations A × Ac and Se × Ac with 42 and 58 F1 individuals, respectively. A segregating F1 population R × F was established consisting of 52 individuals derived from a cross between cv. Romula (R) and Polish cultivar Felka (F). Two tuber-derived plants per each F1 individual clone representing populations A × Ac, Se × Ac, and R × F were screened for HR to PVYN-Wi infection at 20 °C. Plants which developed necrotic symptoms 6 days post-inoculation were classified as resistant. The following ratios of resistant to susceptible plants were detected: A × Ac − 24:18, Se × Ac − 30:28, and R × F − 24:28. The segregation ratios of 1:1 (χ2 = 0.85, P = 0.35; χ2 = 0.07, P = 0.79; and χ2 = 0.31, P = 0.58, respectively) confirmed the presence of single, dominant genes for HR to PVY in simplex states in all three resistant cultivars.
Five markers, S1d11, GP129, U38666, ShkB, and Nl27, were amplified in 20 μl of 20 mM Tris–HCl pH 8.4, 50 mM KCl, 1.5 mM MgCl2, 0.1 mM of each dNTP, 0.2 μM of each primer, 1 U Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA), and 30 ng genomic DNA. MgCl2 concentration was increased to 3 mM for amplification of three markers: U276927, TG186, and TG591. In addition, 1 U of DreamTaq™ DNA polymerase and 1× buffer containing 2 mM MgCl2 (Fermentas, Vilnius, Lithuania) were used for marker B11.6. The following PCR parameters were employed: initial denaturation at 94 °C for 60 s followed by 40 cycles of denaturation at 93 °C for 25 s, annealing at 54 − 62 °C for 35 s (Table 1), and extension at 72 °C for 90 s, with a final extension at 72 °C for 5 min. The sequence characterized amplified region (SCAR) marker SC895 (NCBI GenBank accession EF555209) was amplified as described by Szajko et al. (2008). The At3g24050 (SGN U270244) marker was co-amplified with SC895 as an internal PCR control. At3g24050 primers comprised forward: 5′-CCTCTGGGGCCGAAAACACT-3′ and reverse: 5′-TCCATCACGAGCGAACACCAC-3′.
Table 1.
CAPS markers used in genetic linkage maps
| Chromosome no. | Marker name | Accession no. | Primer sequence (5′–3′) | T a (°C) | Amplicon size (bp) | Restriction enzyme | Marker size (s) (bp) |
|---|---|---|---|---|---|---|---|
| IX | S1d11 | AJ489115 |
f: GCCAAAAAGGGTAGGAAAAATG r: TCATCTTCACGAATCGGACTAAA |
54 | 400 | MnlI | 390 |
| TG591 | SGN-M462 |
f: TCCAATCCGATGACCTCTG r: AGCTGCAAATCTACTCGTG |
54 | 450 | XapIa | 260 | |
| HaeIIIb | 310 | ||||||
| GP129 | AJ487342 |
f: GTGGTAGCAAAGTATTCATC r: CGTTATCTGGACTCCTTTAG |
54 | 500 | XapI | 500 | |
| U38666 | SGN-U38666 |
f: AGCTGCCGTGTCCTGTATCA r: ACTCATGTTCACGCCACTTTCTTA |
56 | 600 | DdeI | 550,600 | |
| U276927 | SGN-U276927 |
f: GCATTAGCGCAATTGGAATCCC r: GGAGAGCATTAGTACAGCGTC |
54 | 1,250 | DdeI | 430 | |
| TG186 | SGN-M561 |
f: AACGGTGTACGAGATTTTAC r: ACCTACATAGATGAACCTCC |
54 | 600 | AluI | 490 | |
| XI | ShkB | M95201 |
f: CATCTTCTCCATAACCCTTTACC r: GCTCACAGTTCTCCACAAAATC |
56 | 1,100 | NlaIII | 1,000 |
| Nl27 | AJ009720 |
f: CGGGAGTAGGCAAAACGACAATAGCAA r: ACTCAATCCTATATCAGCTCCAAAATCACAG |
62 | 750 | HinfI | 310 | |
| B11.6 | AC238172 |
f: ATAGCTTCAGGTCGGGAGATTTGT r: GATTGGGCTGCTGCTGTGG |
60 | 1,800 | EcoRI | 1,600 |
f forward, r reverse
aUsed for mapping of Ny-1 in cv. Albatros
bUsed for mapping of Ny-1 in cv. Sekwana
Nine cleaved amplified polymorphic sequence (CAPS) markers were employed for mapping (Table 1). Four markers, TG591, S1d11, U38666, and TG186, exhibited utility in mapping the HR gene on potato chromosome IX in cv. Albatros. TG591 and S1d11, as well as GP129 and U276927, confirmed the presence of the HR gene in the same region of chromosome IX in cv. Sekwana (Fig. 1). The infection symptoms and the map positions of the PVY resistance loci in these cultivars were similar to those described for the Ny-1 gene in cv. Rywal (Szajko et al. 2008). The HR genes in cvs. Albatros and Sekwana were therefore designated Ny-1. However, further molecular studies are necessary to determine whether Ny-1 in cvs. Albatros, Rywal, and Sekwana reside at the same resistance locus, or whether these cultivars carry PVY resistance genes located at different loci on potato chromosome IX. Three DNA markers, Nl27, ShkB, and B11.6, were useful for mapping the HR-like gene Ny-2 for PVY resistance on chromosome XI in cv. Romula (Fig. 1), in a resistance hotspot containing genes for qualitative and quantitative resistance to pathogens. The Ry adg gene for ER to PVY has been previously mapped to this chromosome region (Hämäläinen et al. 1997). However, the diagnostic marker RYSC3 for the Ry adg gene (Kasai et al. 2000) was not amplified in cv. Romula.
Fig. 1.

Positions of the loci Ny-1 on chromosome IX in cvs. Albatros and Sekwana and Ny-2 on chromosome XI cv. Romula. Genetic distances in cM are shown on the left. The map distances were calculated from recombination frequencies between DNA markers and resistance loci
Fifty potato cultivars (Table 2), bred in Poland, Germany, and The Netherlands, were tested for the presence of the SCAR marker SC895 and two CAPS markers, S1d11 and B11.6. Markers TG591 and Nl27 were not informative. Pedigree information (available for most cvs. at http://www.plantbreeding.wur.nl/potatopedigree/) shows that these cultivars represent various potato genetic backgrounds. They were classified into three groups: ER (extreme resistance to PVY), HR (hypersensitive), and S (susceptible). DNA of seven ER German cultivars (Assia, Barbara, Esta, Heidrun, Pirola, Ute, and Wega) were received from the Max Planck Institute for Plant Breeding Research, courtesy of Dr. C. Gebhardt. The remaining 43 were classified for PVY resistance at Młochów as previously described (Flis et al. 2005; Witek et al. 2006; Szajko et al. 2008; Valkonen et al. 2008). SC895, S1d11, and B11.6 were not detected in the sixteen cvs. susceptible to PVY and eighteen cvs. that expressed ER to PVY. In cvs. Mors and Syrena, which were also negative for all three markers, recombination events or the presence of another source of HR against PVY might be possible. SC895 was specific only to cv. Rywal. Therefore, this marker has potent utility for PVY resistance selection in progeny originated from the Rywal-derived source. The possibility that Ny-1 and Ny-2 genes are involved in resistance to PVY in the corresponding cvs. Koga, Neptun, Niagara, and Korona should be supported by additional genetic studies. Detection of the B11.6 marker in six cvs. from the ER group might be explained by epistatic expression of the Ry gene over Ny genes, where both types of PVY resistance genes are present in these cultivars, but the hypersensitive response is not induced. In diploid potato, this interaction type was exhibited between the PVY resistance genes Ry adg and Ny adg (Valkonen et al. 1994).
Table 2.
Distribution of markers SC895, S1d11, and B11.6 in potato cultivars
| Response to PVY | Potato cultivar | Presence of markers | ||
|---|---|---|---|---|
| SC895 | S1d11 | B11.6 | ||
| HR | Rywal | + | − | − |
| Albatros, Koga, Neptun, Niagara, Sekwana | − | + | − | |
| Korona, Romula | − | − | + | |
| Mors, Syrena | − | − | − | |
| ER | Gabi, Jasia, Maryna, Santé, Ślęza, Sonda | − | − | + |
| Ania, Assia, Baszta, Beata, Barbara, Danusia, Dunajec, Esta, Fregata, Heidrun, Hinga, Kuba, Nimfy, Pirola, Umiak, Ursus, Ute, Wega | − | − | − | |
| S | Accent, Balbina, Delikat, Drop, Felka, Grot, Karatop, Karlena, Oda, Orłan, Pirol, Tara, Tokaj, Triada, Wawrzyn, Wolfram | − | − | − |
HR hypersensitive response, ER extreme resistance, S susceptible, + presence of marker; − absence of marker
In cultivated potato, a cross between a clone possessing two resistance alleles and a susceptible clone, or between two simplex resistant parents, resulted in a large percentage of resistant clones in F1 generations (Solomon-Blackburn and Mackay 1993). The PCR-based markers developed in this study might facilitate the production of PVY-resistant tetraploid potato clones with double HR gene doses, or the combination of HR and ER resistance factors, thereby improving breeding efficiency for PVY resistance in cultivated potato.
Acknowledgments
We thank Professor M. Chrzanowska for help with selection of the cultivars for this study and Professor E. Zimnoch-Guzowska for helpful comments on the manuscript. The research was supported by The National Centre for Research and Development in Poland, Grant NR12 0002/06/2009.
References
- Flis B, Hennig J, Strzelczyk-Żyta D, Gebhardt C, Marczewski W. The Ry-fsto gene from Solanum stoloniferum for extreme resistant to Potato virus Y maps to potato chromosome XII and is diagnosed by PCR marker GP122718 in PVY resistant potato cultivars. Mol Breed. 2005;15:95–101. doi: 10.1007/s11032-004-2736-3. [DOI] [Google Scholar]
- Hämäläinen JH, Watanabe KN, Valkonen JPT, Arihara A, Plaisted RL, Pehu E, Miller L, Slack SA. Mapping and marker-assisted selection for a gene for extreme resistance to potato virus Y. Theor Appl Genet. 1997;94:192–197. doi: 10.1007/s001220050399. [DOI] [Google Scholar]
- Hämäläinen JH, Sorri VA, Watanabe KN, Gebhardt C, Valkonen JPT. Molecular examination of a chromosome region that controls resistance to potato Y and A potyviruses in potato. Theor Appl Genet. 1998;96:1036–1043. doi: 10.1007/s001220050836. [DOI] [Google Scholar]
- Kang B-Ch, Yeam I, Jahn MM. Genetic of plant virus resistance. Ann Rev Phytopathol. 2005;43:581–621. doi: 10.1146/annurev.phyto.43.011205.141140. [DOI] [PubMed] [Google Scholar]
- Kasai K, Morikawa Y, Sorri VA, Valkonen JPT, Gebhardt C, Watanabe KN. Development of SCAR markers to the PVY resistance gene Ryadg based on a common feature of plant disease resistance genes. Genome. 2000;43:1–8. doi: 10.1139/gen-43-1-1. [DOI] [PubMed] [Google Scholar]
- Lorenzen JH, Piche LM, Gudmestad NC, Meacham T, Shiel P. A multiplex PCR assay to characterize Potato virus Y isolates and identify strain mixtures. Plant Dis. 2006;90:935–940. doi: 10.1094/PD-90-0935. [DOI] [PubMed] [Google Scholar]
- Sato M, Nishikawa K, Komura K, Kosaka K. Potato virus Y resistance gene, Rychc, mapped to the distal end of potato chromosome 9. Euphytica. 2006;149:367–372. doi: 10.1007/s10681-006-9090-y. [DOI] [Google Scholar]
- Solomon-Blackburn RM, MacKay GR. Progeny testing resistance to potato virus Y: a comparison of susceptible potato cultivars for use in test-crosses with resistant parents. Potato Res. 1993;36:327–333. doi: 10.1007/BF02361799. [DOI] [Google Scholar]
- Song YS, Hepting L, Schweizer G, Hartl L, Wenzel G, Schwarzfischer A. Mapping of extreme resistance to PVY (Rysto) on chromosome XII using anther-culture-derived primary dihaploid potato lines. Theor Appl Genet. 2005;111:879–887. doi: 10.1007/s00122-005-0010-7. [DOI] [PubMed] [Google Scholar]
- Szajko K, Chrzanowska M, Witek K, Strzelczyk-Żyta D, Zagórska H, Gebhardt C, Hennig J, Marczewski W. The novel gene Ny-1 on potato chromosome IX confers hypersensitive resistance to Potato virus Y and is an alternative to Ry genes in potato breeding for PVY resistance. Theor Appl Genet. 2008;116:297–303. doi: 10.1007/s00122-007-0667-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Valkonen JPT. Viruses: economical losses and biotechnological potential. In: Vreugdenhil D, Bradshaw J, Gebhardt C, Govers F, Taylor M, MacKerron D, Ross H, editors. Potato biology and biotechnology: advances and perspectives. Amsterdam: Elsevier; 2007. pp. 619–641. [Google Scholar]
- Valkonen JPT, Slack SA, Plaisted RL, Watanabe KN. Extreme resistance is epistatic to hypersensitive resistance to potato virus YO in a Solanum tuberosum ssp. andigena-derived potato genotype. Plant Dis. 1994;78:1177–1180. doi: 10.1094/PD-78-1177. [DOI] [Google Scholar]
- Valkonen JPT, Jones RAC, Slack SA, Watanabe KN. Resistance specificity to viruses in potato: standardization of nomenclature. Plant Breed. 1996;115:433–438. doi: 10.1111/j.1439-0523.1996.tb00952.x. [DOI] [Google Scholar]
- Valkonen JPT, Wiegmann K, Hämäläinen JH, Marczewski W, Watanabe KN. Evidence for utility of the same PCR-based markers for selection of extreme resistance to Potato virus Y controlled by Rysto of Solanum stoloniferum derived from different sources. Ann Appl Biol. 2008;152:121–130. doi: 10.1111/j.1744-7348.2007.00194.x. [DOI] [Google Scholar]
- Witek K, Strzelczyk-Żyta D, Hennig J, Marczewski W. A multiplex PCR approach to simultaneously genotype potato towards the resistance alleles Ry-fsto and Ns. Mol Breed. 2006;18:273–275. doi: 10.1007/s11032-006-9021-6. [DOI] [Google Scholar]
