Skip to main content
PMC home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Jun 1.
Published in final edited form as: Dev Dyn. 2014 Apr 1;243(6):833–843. doi: 10.1002/dvdy.24123

FRIZZLED10 MEDIATES WNT1 AND WNT3A SIGNALING IN THE DORSAL SPINAL CORD OF THE DEVELOPING CHICK EMBRYO

Lisa M Galli 1, Roeben N Munji 1, Susan C Chapman 2, Ann Easton 1,#, Lydia Li 1,#, Ouma Onguka 1,#, Joseph S Ramahi 1,#, Rowena Suriben 1,#, Linda A Szabo 1,#, Camilla Teng 1,#, Baouyen Tran 1,#, Rami N Hannoush 3, Laura W Burrus 1,**
PMCID: PMC4031291  NIHMSID: NIHMS578587  PMID: 24599775

Abstract

Background

WNT1 and WNT3A drive a dorsal to ventral gradient of β-catenin dependent Wnt signaling in the developing spinal cord. However, the identity of the receptors mediating downstream functions remains poorly understood.

Results

In this paper, we show that the spatiotemporal expression patterns of FZD10 and WNT1/WNT3A are highly correlated. We further show that in the presence of LRP6, FZD10 promotes WNT1 and WNT3A signaling using an 8xSuperTopFlash reporter assay. Consistent with a functional role for FZD10, we demonstrate that FZD10 is required for proliferation in the spinal cord. Finally, by using an in situ proximity ligation assay, we observe an interaction between FZD10 and WNT1 and WNT3A proteins.

Conclusion

Together, our results identify FZD10 as a receptor for WNT1 and WNT3A in the developing chick spinal cord.

Keywords: Chick, FZD10, WNT1, WNT3A, LRP6, Palmitate

Introduction

The proper development of the spinal cord is required for the transmission of motor and sensory information to and from the brain and for the initiation of reflexes. Wnt signals have vital roles in multiple phases of spinal cord development, including 1) the closure of the neural plate to form the neural tube and 2) the production of the correct types, number, and distribution of neuronal cells in the developing neural tube. WNT1 and WNT3A are expressed in the dorsal most spinal cord and activate a gradient of Wnt signaling that extends mid way down the dorso-ventral (D/V) axis (Galli et al., 2007, Megason and McMahon, 2002). Wnts are capable of utilizing at least three distinct, but interrelated pathways, including one β-catenin dependent pathway and two β-catenin independent pathways including the planar cell polarity (PCP) and Ca2+ pathways (Axelrod, 2009, Barrow, 2006, Clevers, 2006, Coombs et al., 2008, Jenny and Mlodzik, 2006, Jones and Chen, 2007, Klein and Mlodzik, 2005, Kohn and Moon, 2005, Kuhl et al., 2000, Logan and Nusse, 2004, MacDonald et al., 2009, Moon et al., 2004, Nusse, 2005, van Amerongen and Nusse, 2009, Veeman et al., 2003a, Vladar et al., 2009, Wang and Nathans, 2007). The activation of particular Wnt signaling pathways is dictated by the complement of receptors and co-receptors on the cell surface as well as their relative affinities (Mikels and Nusse, 2006). Disruption of the dorsal to ventral β-catenin gradient mimics the phenotype of mice deficient for both WNT1 and WNT3A (Ikeya et al., 1997, Saint-Jeannet et al., 1997, Zechner et al., 2003, Zechner et al., 2007). Hence, WNT1 and WNT3A signal via β-catenin to control proliferation and cell type specification. However, the identity and role(s) of the Frizzled receptors mediating these effects remains poorly understood. This is, in part, due to the fact that soluble Wnt proteins are refractory to overexpression, purification, and manipulation.

Multiple lines of evidence implicate several Frizzled family members, including FZD 1, 2, 3, 6, 8 and 10, in mediating Wnt signaling in the dorsal spinal cord; however, the role of FZD10 requires clarification (Borello et al., 1999, Bourhis et al., 2010, Cauthen et al., 2001, Chesnutt et al., 2004, Deardorff et al., 2001, Fokina and Frolova, 2006, Garcia-Morales et al., 2009, Hollyday et al., 1995, Kawakami et al., 2000a, McCabe et al., 2007, Nunnally and Parr, 2004, Paxton et al., 2010, Rossi et al., 2007, Stenman et al., 2008, Summerhurst et al., 2008, Wang et al., 2006, Yan et al., 2009, Yu et al., 2010). Previous reports suggest that FZD10 synergizes with WNT1, but not WNT3A in an axis duplication assay in Xenopus (Garcia-Morales et al., 2009). Likewise, pull down experiments failed to detect an interaction between WNT3A and the FZD10 cysteine-rich domain (CRD) (Carmon and Loose, 2010). Although knockdown of FZD10 in Xenopus inhibits sensory neuron development in Xenopus (Garcia-Morales et al., 2009), no overt spinal cord phenotype has been observed in knockout mice for FZD10 (Mouse Genome Database: MGI:108460 and MGI:2136761).

LRP co-receptors often act in concert with Frizzled receptors (Brown et al., 1998, Hey et al., 1998, Pinson et al., 2000, Tamai et al., 2000, Wehrli et al., 2000). LRP5 and 6 are ubiquitously expressed in multiple stages of mouse development (Diez-Roux et al., 2011, Pinson et al., 2000, Stenman et al., 2008) and in early stages of frog development (Houston and Wylie, 2002). In later stages of development in the frog, LRP6 is enriched in the spinal cord and the brain (Houston and Wylie, 2002). Consistent with its expression in the spinal cord, mutations in LRP6 are associated with neural tube defects (Andersson et al., 2010, Bryja et al., 2009, Carter et al., 2005, Joiner et al., 2013, Kubota et al., 2008, Zhou et al., 2010).

In this study, we introduce the proximity ligation assay as a useful tool for the evaluation of ligand:receptor pairs. Using this tool in combination with other assays, we identify FZD10 as a receptor and LRP6 as a co-receptor for WNT1 and WNT3A in the developing chick spinal cord. First, we show specific spatiotemporal correlation between the expression of WNT1 and WNT3A with FZD10 in the developing spinal cord. Next, we show that FZD10 expression closely overlaps with the domain of WNT1 and WNT3A signaling via the β-catenin dependent pathway. We further show that FZD10 and LRP6 synergize with WNT1 and WNT3A to activate the SuperTopFlash reporter in HEK293T cells. A proximity ligation assay (PLA) was used to confirm that WNT1 and WNT3A interact with FZD10 in the presence or absence of overexpressed LRP6. Consistent with a role for FZD10 in mediating WNT1 and WNT3A activity in the dorsal spinal cord, we show that FZD10 is required for proliferation in the dorsal most quadrant of the chick spinal cord.

Results and Discussion

Whole mount in situ hybridization analysis of FZD10 expression in the developing chick embryo

Previous reports demonstrate that FZD10 is expressed in the developing tail bud, limb buds, and central nervous system in a number of model systems (Borello et al., 1999, Chesnutt et al., 2004, Deardorff et al., 2001, Endo et al., 2008, Garcia-Morales et al., 2009, Kawakami et al., 2000a, Kawakami et al., 2000b, McCabe et al., 2007, Nunnally and Parr, 2004, Paxton et al., 2010, Stenman et al., 2008, Summerhurst et al., 2008, Yan et al., 2009). We were particularly interested in the expression of FZD10 in the dorsal spinal cord, which suggested a possible role in mediating WNT1 and WNT3A signaling. As such, we sought to compare the spatiotemporal expression patterns of FZD10, WNT1, and WNT3A in the spinal cord of Hamburger and Hamilton (HH) stage 6-21 chick embryos (Hamburger and Hamilton, 1951). Prior to neural tube closure, FZD10, WNT1, and WNT3A are expressed in the neural folds (Fig 1A-D). Following neural tube closure, FZD10, WNT1, and WNT3A are all found in the spinal cord at HH10 (Fig 1E), HH14-16 (Fig 1F), HH18-21 (Fig 1G) embryos. Consistent with previous reports, we also observe that FZD10 and WNT3A have overlapping and/or adjacent expression in the tail bud and the limbs (Fig 1A-G) (Jin et al., 2001, Kawakami et al., 2000b, Kengaku et al., 1998).

Figure 1. Whole mount in situ hybridization shows that the timing and localization of WNT1, WNT3A, and FZD10 expression are highly correlated.

Figure 1

Open in a new tab

HH6-10 (A-E,), 14-16 (F), 8-21 (G), embryos were subjected to whole mount in situ hybridization with anti-sense digoxigenin labeled probes for FZD10, WNT1 and WNT3A. Abbreviations are as follows: hf = head fold, nf = neural folds, fb=forebrain, mb=midbrain, hb=hindbrain, sc = spinal cord, fl = forelimb; hl = hindlimb, and tb = tail bud.

Section in situ hybridization analysis of FZD10 expression in the developing chick spinal cord

WNT1 and WNT3A signal via a β-catenin dependent pathway in the spinal cord (Alvarez-Medina et al., 2008, Galli et al., 2007, Megason and McMahon, 2002). Thus, we sought to refine the relationship between FZD10, WNT1, and WNT3A expression and the β-catenin activity gradient. We measured the WNT1/3A activity gradient by introducing a β-catenin dependent reporter construct (BATGal) into the right side of the spinal cord (Maretto et al., 2003). As a control, embryos were simultaneously electroporated with a GFP-expressing construct to indicate the extent of integration of our constructs in the dorsal-ventral axis of the neural tube. Whereas the FZD10 expression pattern (Fig 2J) extends more ventrally than the region in which WNT1 and WNT3A transcripts are found (Fig 2B, F), FZD10 gene expression correlates closely with the β-catenin activity gradient observed in BAT-Gal electroporated embryos (Fig 2A, I).

Figure 2. The domain of FZD10 expression closely correlates with that of Wnt signaling activity.

Figure 2

Open in a new tab

Panels A, E, and I show the region in which β-catenin dependent Wnt signaling is active in HH18 embryos. GFP (A, E, green) labels successfully transfected cells and β-galactosidase expression (A, I, red) highlights the region of active β-catenin dependent signaling. The dashed line in (I) indicates the ventral limit of Wnt signaling activity. Transverse sections through the trunk of HH18 and 22 embryos shows that WNT1 and WNT3A transcripts are localized to the uppermost region of the dorsal spinal cord (B,C,F,G), whereas FZD10 transcripts are expressed throughout the dorsal half of the spinal cord (D,H,J, L). Sections from the hindlimb level (L), mid-trunk level (H), and forelimb level (D) are shown for the HH stage 22 embryo. The ventral limit of FZD10 expression is shown in HH18 embryos (J, dashed line). Note the ventral limit of nuclear β-catenin labeling in an HH22 embryo (K, dashed line) compares well with that of a FZD10 labeled embryo (L, dashed line). The inset in Panel K represents a magnified image of the boxed area and is included to demonstrate that the immunostaining is indeed nuclear. In Panels M-P, a construct encoding a constitutively activated variant of β-catenin and a nuclear variant of GFP was electroporated into HH stage 13 embryos. Tranverse sections of electroporated embryos were immunostained for β-catenin using conventional (M, O) and antigen retrieval protocols (P). The sections shown in Panels M-O and Panel P are serial sections. The insets in Panel O and P represents a magnified image of the boxed area and are included to demonstrate the differences observed for the subcellular localization of β-catenin using the two different protocols.

We then detected the β-catenin activity gradient by immunostaining for nuclear β-catenin, another hallmark of β-catenin dependent signaling (Funayama et al., 1995, Huber et al., 1996, Schneider et al., 1996) (Fig 2K). To enhance thedetection of nuclear β-catenin, we used a modification of the antigen retrieval protocol reported by Borello and colleagues (Borello et al., 2006, Brabletz et al., 2000, Brabletz et al., 2001). To ensure that our method effectively distinguished nuclear β-catenin, we overexpressed constitutively activated β-catenin (Tetsu and McCormick, 1999) along with nuclear GFP in the spinal cord and then immunostained for β-catenin using conventional and antigen retrieval protocols. Sections stained with the conventional protocol reveal staining that is primarily localized to the plasma membrane (Fig 2M, O). More intense staining is observed in cells that were successfully electroporated with the activated β-catenin (Fig 2O). In a serial section immunostained using the antigen retrieval protocol, cells transfected with activated β-catenin exhibit very bright nuclear staining, as was expected (Fig 2P). Importantly, nuclear staining of endogenous β-catenin (in non-transfected cells) was also enhanced using this method.

At HH stage 22, WNT1 and WNT3A expression persists exclusively in the roof plate (Fig 2C,G), while only minimal WNT1 is observed in the floor plate. FZD10 continues to be expressed throughout the dorsal half of the spinal cord in sections through the hindlimb (Fig 2L), mid-trunk (Fig 2H) and the forelimb levels (Fig 2D). Thus, the region in which nuclear β-catenin is brightest (Fig 2K) correlates well with FZD10 expression (Fig 2D, H, L).

In summary, these data are consistent with a model in which FZD10 mediates the biological activity of WNT1 and/or WNT3A in the dorsal neural tube. The expression of FZD10 correlates well with β-catenin dependent signaling activity readouts, with reduced signaling observed dorsally and a gradient that extends slightly beyond the dorsal half of the spinal cord.

Co-expression of FZD10 and LRP6 promotes β-catenin dependent signaling

LRP5 and LRP6 are required for β-catenin dependent Wnt signaling in many contexts (Joiner et al., 2013, Wehrli et al., 2000). Therefore, we evaluated whether the co-expression of LRP5 or LRP6 along with FZD10 might influence the activation of β-catenin dependent signaling as measured by the 8xSuperTopFlash reporter assay in HEK293T cells (Veeman et al., 2003b). Our data show that co-expression of LRP6 and FZD10 significantly promotes β-catenin dependent signaling as compared to expression of FZD10 or LRP6 alone (Fig 3A, p<0.0005). Whereas co-expression of LRP5 with FZD10 has minimal effect, it appears to be inhibitory when co-expressed with LRP6 and FZD10 (Fig 3A). We do not know the mechanism by which this occurs. As no Wnts were overexpressed for this experiment, we attribute the activity observed to expression of endogenous Wnts. However, we cannot rule out the unlikely possibility that FZD10 and LRP6 activate signaling in a ligand independent manner.

Figure 3. FZD10 and LRP6 promote signaling of WNT1 and WNT3A via a β-catenin dependent pathway in HEK293T cells.

Figure 3

Open in a new tab

HEK293T cells were cotransfected with the 8xSuperTopFlash reporter and renilla luciferase along with WNT1, WNT3A, LRP5, LRP6, and/or FZD10. (A) β-catenin dependent signaling was assessed after transfection of LRP5 or LRP6 in combination with FZD10. (B) FZD10 mediates WNT1 and WNT3A activity. Cells were also transfected with SuperFopFlash (with mutated TCF binding sites) as a negative control (left column). These experiments were performed a minimum of 3 times with 5 independent replicates each time (for a total of 15 data points). Error bars represent the standard error. Statistical significance was assessed with a Student’s t-test. Please note that scales shown for the Y axes in panels A and B are different

FZD10 and LRP6 together promote WNT1 and WNT3A signaling in a SuperTopFlash Reporter Assay

We then tested the capacity of FZD10 to mediate WNT1 and WNT3A activity using transient transfection of FZD10 into HEK293T cells using the 8xSuperTopFlash reporter assay (Fig 3B). Co-expression of FZD10 along with WNT1 or WNT3A inhibited Wnt signaling as compared to WNT1 or WNT3A alone (p<0.0005 and p<0.05, respectively). These data suggested the possibility that A) co-expression of FZD10 serves to uncouple WNT1:FZD10 or WNT3A:FZD10 complexes from endogenous proteins, such as LRP6, required for Wnt signal transduction, B) overexpressed FZD10 binds to WNT1/3A, but does not signal via the β-catenin pathway (thus rendering WNT1/3A unavailable to other endogenous receptors) or C) FZD10 is not a receptor for WNT1 and WNT3A. To distinguish between these possibilities, we next tested whether the co-expression of LRP6 along with FZD10 could promote WNT1 and WNT3A signaling activity. Consistent with the first model, co-expression of LRP6 along with FZD10 caused a significant increase in WNT1 and WNT3A signaling as compared to cells transfected with FZD10 and WNT1 or WNT3A (p<0.0005 for both) and cells transfected with LRP6 and WNT1 or WNT3A (p<0.0005 and p<0.05, respectively). As a negative control, we show that co-transfection of FZD10 and LRP6 along with WNT4 has no appreciable effect on signaling (Fig 3B).

FZD10 interacts with WNT1 and WNT3A

To test whether FZD10 interacts with WNT1 and WNT3A, we used an in situ proximity ligation assay (PLA) that detects protein-protein interactions within 40 nm distance (Soderberg et al., 2006). This assay required the use of primary antibodies against WNT1/3A and FZD10 that were generated in different organisms. We previously generated anti-WNT1 and WNT3A monoclonal antibodies in the mouse (Galli et al., 2007) and identified a commercially available FZD10 polyclonal antibody generated in rabbits. For this experiment, we co-transfected COS7 cells with FZD10, WNT1 or WNT3A, and/or LRP6. Species-specific secondary antibodies, called PLA probes, were then bound to the primary antibodies. Each PLA probe is linked with a unique oligonucleotide. When the PLA probes are localized to within 40 nm of one another, the two strands of oligonucleotides (designated PLUS and MINUS) interact through a subsequent addition of two other circle-forming DNA oligonucleotides (Gao and Hannoush, 2014, Soderberg et al., 2006). These oligonucleotides are joined by an enzymatic reaction and then subjected to a rolling circle amplification using DNA Polymerase to incorporate fluorophore-coupled nucleotides into the product, resulting in over 100-fold amplification of the circular DNA. Hybridization with the fluorophore-labeled complementary oligonucleotide allows for visualization of specific interacting proteins in ligand-receptor complexes of interest. Following the proximity ligation assay, we used conventional fluorescence immunolabeling to identify cells co-transfected with FZD10 and WNT1 or WNT3A (Fig. 4). All antibodies yielded staining characteristic of proteins in the secretory pathway, although minor non-specific FZD10 antibody nuclear staining in the nuclei was also observed.

Figure 4. FZD10 protein interacts with WNT1 and WNT3A in COS7 cells.

Figure 4

Open in a new tab

COS7 cells were co-transfected as indicated with a combination of FZD10 and WNT1, WNT3A, WNT3A S209A and/or LRP6. WNT1 (A, B, H), WNT3A (C, D), WNT3A S209A (J) and FZD10 (A-G, J) positive cells are detected as expected. The proximity ligation assay was carried out using polyclonal antibodies against FZD10 and monoclonal antibodies against WNT1 or WNT3A (A-H). PLA “PLUS” and “MINUS” secondary antibodies were added to all samples. After the PLA, cells were also immunolabeled for WNT1 or WNT3A (green) and FZD10 (red) using conventional secondary antibodies and DAPI was used to visualize the nuclei. PLA positive punctae are shown in red (A-D, J). Images were collected via confocal microscopy. Representative images from 10 different fields are shown.

Cells co-transfected with FZD10 and WNT1 or WNT3A showed positive PLA punctae in the presence or absence of overexpressed LRP6 (Fig. 4A-D). Quantitation of these data showed a similar number of PLA punctae when WNT1 and FZD10 are co-expressed in the presence or absence of exogenous LRP6. However, there seemed to be a slight reduction in the number of punctae corresponding to a WNT3A:FZD10 interaction when these proteins were expressed without exogenous LRP6 (p < 0.05, Fig 5). Thus, our data indicate that WNT1/WNT3A and FZD10 are able to interact in the absence of exogenous LRP6. Upon omission of the WNT1 or WNT3A cDNA, the numbers of punctae were reduced to background levels (Fig 4E, G, Fig 5). Likewise, omission of the anti-WNT1 (Fig 4F, Fig 5) or the anti-FZD10 antibody (Fig 4 H, I, Fig 5) resulted in minimal punctae being observed in the presence of only one of the two required antibodies (Fig 4F, H, I, Fig 5).

Figure 5. Quantitation of PLA punctae shows that LRP6 is not required for the interaction between WNT1/WNT3A and FZD10.

Figure 5

Open in a new tab

PLA punctae were quantitated using Adobe Photoshop and NIH ImageJ. Unless otherwise indicated, a minimum of 2 independent experiments was performed for each condition, with a total of 7-18 cells being analyzed. A single experiment was carried out for cells co-transfected with WNT1 and FZD10 in the absence of exogenous LRP6 (5 cells analyzed) and for cells co-transfected with WNT1, FZD10 and LRP6, but lacking the anti-WNT1 antibody (4 cells analyzed). Error bars indicated +/− standard error. A Student’s t-test was used to analyze statistical significance. The asterisk indicates that p < 0.05.

It has been recently reported that the palmitate moiety on WNT3a is important, but not essential, for binding to FZD8 (Janda et al., 2012). To test whether the palmitoylation of WNT3A is required for binding to FZD10, we performed the PLA using a WNT3A construct in which the palmitoylated serine residue (S209) was substituted with an alanine residue. Consistent with the results of Janda and colleagues, WNT3A S209A continues to associate with FZD10 in the PLA, indicating that palmitoylation is not absolutely required for binding in this context (Fig 4J, Fig 5). However, it is important to note that it is not yet possible to assess the affinity of the WNT/FZD interaction using the PLA.

FZD10 knockdown causes a reduction in proliferation in the dorsal quandrant of the spinal cord

WNT1 and WNT3A drive a dorsal to ventral proliferation gradient in the developing spinal cord (Dickinson et al., 1994, Ikeya et al., 1997, Megason and McMahon, 2002). To test the requirement of FZD10 for proliferation, we introduced FZD10 morpholino into the chick spinal cord via electroporation. As the FZD10 antibody used in the PLA studies above does not detect endogenous FZD10 protein (data not shown) we needed to develop a method to ensure that the FZD10 morpholino inhibited the translation of FZD10 transcripts. To do this, we first generated a pCIG construct engineered to overexpress a bi-cistronic transcript encoding a truncated FZD10-myc variant (containing the target sequences) and a nuclear GFP variant (Megason and McMahon, 2002). We then electroporated this construct into the spinal cord along with control or FZD10 morpholinos. Using a protocol developed in our lab, we were able to deliver the expression construct to both sides of the spinal cord while delivering the morpholinos to only the left side. GFP expression was used to assess the efficiency of transfection on both sides of the spinal cord while FZD10-myc expression was used to evaluate the ability of morpholinos to inhibit translation of FZD10. Thus, by comparing the expression of FZD10-myc expression on the right (no morpholino) and left sides (with morpholino) of the spinal cord in sections with roughly equal GFP expression on both sides, we were able to assess the efficiency of our morpholinos.

Using this approach, we show that the presence of control morpholino on the left side has little or no effect on the levels of FZD10-myc (Fig 6A-C). By contrast, co-electroporation of FZD10-myc with FZD10 morpholinos shows a substantial reduction in the levels of FZD10-myc protein on the left side of the spinal cord as compared to the right (Fig 6D-F). Though we do not observe complete inhibition of translation, the inhibition is notable in light of the fact that the FZD10-myc protein is undoubtedly expressed at much higher levels than endogenous FZD10.

Figure 6. FZD10 is required for proliferation in the dorsal most quadrant of the spinal cord.

Figure 6

Open in a new tab

To demonstrate that the FZD10 morpholino is able to inhibit the translation of FZD10, we engineered a bi-cistronic construct designed to simultaneously express a truncated form of FZD10 tagged with a myc epitope (FZD10-myc) and nuclear GFP. GFP fluorescence was used to assess transfection level, whereas expression of the myc tag was used to assess inhibition of translation via FZD10 morpholino. Co-electroporation of the FZD10-myc construct and control morpholino result in the expression of GFP (green) on both sides of the spinal cord, showing that both sides have been successfully transfected with the FZD10-myc construct (panel A, B). The morpholino (also in green) is also observed on the left side of the spinal cord, but is not detected with the exposures shown here. Immunostaining with the anti-myc antibody (red) shows that the levels of FZD10-myc are very similar on both sides of the spinal cord for control morpholino (panel C). By contrast, co-electroporation of FZD10 morpholino along with the FZD10-myc construct significantly reduced the levels of FZD10-myc on the left side of the spinal cord (panels D-F). DAPI (blue) was used to visualize nuclei (Panels A and D). Embryos electroporated with FZD10 morpholino were sectioned and immunostained with anti-phosphohistone H3 (white) and β-catenin (red) (Panels G-I). β-catenin immunostaining was carried out using a conventional protocol, which primarily detects β-catenin localized to the plasma membrane. The spinal cord was divided into 4 quandrants along the dorsal-ventral axis for counting (Panel I). Quantitation of the proliferation data are shown in Panel J. The proliferation index represents the number of proliferative cells divided by the area of the quadrant. These data represent 39 sections taken from 6 different embryos. Error bars show +/− standard error. A Student’s t-test was performed to assess statistical significance. The asterisk indicates that p < 0.05 for quadrant 1.

We then assessed whether FZD10 is required for proliferation in the spinal cord by electroporating the FZD10 morpholino into the left side of the spinal cord (Fig 6 G-I). Consistent with a reduction in proliferation, embryos electroporated with FZD10 morpholino consistently showed a reduction in the overall size of the left side of the spinal cord. To detect differences in proliferation on either side of the midline, we counted the number of proliferative cells marked by anti-phospho histone H3 (Hendzel et al., 1997, Wei et al., 1999), in four equally spaced quadrants along the dorsal to ventral axis (Fig 6I). To normalize the number of mitotic cells back to the total number of cells, we divided the number of mitotic cells in a quadrant by the area in that quadrant to generate a ‘proliferative index’. This method of normalization is valid because we have previously determined that cell size in the spinal cord is uniform at this stage of development (Galli et al., 2006). These data show that FZD10 is required for proliferation in the dorsal-most quadrant of the developing spinal cord and are consistent with a role for FZD10 in mediating the biological activity of WNT1 and WNT3A in vivo.

In summary, our results demonstrate that FZD10 expression overlaps with that of WNT1 and WNT3A in the developing chick spinal cord and that FZD10 is capable of mediating WNT1 and WNT3A signaling. We further show that although LRP6 is not needed for binding of WNT1 or WNT3A to FZD10, it is required for efficient β-catenin dependent signaling via this complex. Given that LRP6 is ubiquitously expressed at multiple stages of mouse development (Diez-Roux et al., 2011), we think it highly likely that it is also present in the chick spinal cord. These data suggest possible roles for FZD10 the development of the dorsal spinal cord. However, as Fzd10 knockout mice have no overt phenotype (Mouse Genome Database: MGI: 2136761), it seems likely that at least one other Frizzled family member can compensate for the loss of FZD10 (Borello et al., 1999, Bourhis et al., 2010, Deardorff et al., 2001, Endo et al., 2008, Hollyday et al., 1995, Janda et al., 2012, Kawakami et al., 2000a, Nunnally and Parr, 2004, Parr et al., 1993, Summerhurst et al., 2008, Tamai et al., 2000, Wang et al., 2006, Yan et al., 2009). Though FZD4 and 9 are the most closely related to FZD10, neither has been linked to dorsal spinal cord development. Of the other Frizzled family members implicated in the development of the dorsal spinal cord, the expression of FZD8 (in the mouse) is most closely aligned with what we observed for FZD10 (Borello et al., 1999, Summerhurst et al., 2008). We suspect that similar compensation would have been observed in our FZD10 knockdown experiment if we had extended it over a longer time frame. Our results also highlight the utility of PLA to predict specific Wnt/Frizzled interactions. The value of this simple approach is tremendous as it overcomes technical issues relating to Wnt production, solubility and activity that have historically hindered classic binding studies.

Experimental Procedures

We thank Randy Moon for supplying 8xSuperTopflash and 8xSuperFopflash (negative control) (Veeman et al., 2003b). We thank Elena Frolova for partial chick WNT1 cDNA (Fokina and Frolova, 2006), Frank McCormick for the constitutively activated form of β-catenin (Tetsu and McCormick, 1999), Tsutomu Nohno for partial chick WNT3A cDNA (Kawakami et al., 2000a), Xi He for human LRP5 and LRP6 (Tamai et al., 2000) and Michael Stark for FZD10 (Stark et al., 2000).

Materials

Fugene HD Transfection Reagent, Dual Luciferase Reporter Assay System (Promega); Lipofectamine 2000 (Invitrogen); Duolink PLA In Situ Kit (Sigma); COS7 and HEK293T cells (ATCC); fertile eggs (Petaluma Farms).

Antibodies

Mouse anti-WNT1 5F1-G11-D1 and mouse anti-WNT3A 3E9-1B11-H3 were made in the Burrus lab and used at a 1:10 dilution (Galli et al., 2007). The FZD10 polyclonal antibody was acquired from Aviva (ARP41263) and was used at a 1:333 dilution. The β-galactosidase antibody (JIE7) was from the Developmental Studies Hybridoma Bank and was used at a 1:100 dilution. The β-catenin antibody (used at 1:1000 dilution) was from Sigma (C-7207). The Phospho Histone H3 antibody was from Millipore and used at 1:1000 dilution. Cy2-anti-mouse, Cy3-anti-mouse and Cy3-anti-rabbit secondary antibodies were from Jackson Immunoresearch Labs.

Morpholinos

The GenBank accession number for the sequence used to design the chick FZD10 morpholino is AF224320. FZD10 (5’CAGGTTCCCTGCGGCTGGCCCCATG 3′) and control (5’CCTCTTACCTCAGTTACAATTTATA 3′) morpholinos were purchased from Gene Tools.

Constructs

The myc-tagged soluble version of chick FZD10 was created by ligating the cysteine-rich domain of chick FZD10 into pcDNA3.1 resulting in a fusion protein containing the amino acids 1-215 of chick FZD10 along with myc and his6 epitope tags. This cDNA was then subcloned into pCIG to generate FZD10-myc. A constitutively activated form of β-catenin was also subcloned into pCIG for use in electroporations (Tetsu and McCormick, 1999).

In situ hybridizations

Whole mount and section in situ hybridizations were carried out as previously described (Baranski et al., 2000, Chapman et al., 2002, Galli et al., 2007, Terry et al., 2000).

In ovo electroporations

For the BAT-Gal studies (Fig 2), the spinal cords of HH12-13 chick embryos were electroporated with psiSTRIKE (Promega) containing an inert (scrambled) insert and BAT-Gal (Maretto et al., 2003) constructs as previously described (Galli et al., 2007). psiSTRIKE expresses hmGFP under the control of a CMV promoter while BAT-Gal expresses β-galactosidase under the control of a promoter with multiple TCF sites. β-galactosidase expression was visualized by immunostaining. Images were collected via confocal microscopy.

The pCIG construct encoding activated β-catenin and nuclear GFP was electroporated as previously described (Galli et al., 2007).

For the knockdown experiments, we electroporated the spinal cord of HH stage 11-14 embryos with FZD10 or control morpolinos (final concentration = 0.5-1.0 mM) and/or pCIG.FZD10CRD-myc/his (final concentration = 3.75 mg/ml DNA). Using platinum electrodes, 3 × 50 ms pulses were delivered at 30V with the positive electrode on the right side and the negative electrode on the left side of the embryo. For experiments using morpholinos in combination with pCIG.FZD10-myc, the electrodes were then reversed for an additional 3 pulses. Embryos were incubated overnight at 39°C and processed as previously described. Embryos for control and FZD10 morpholinos were electroporated on the same day.

8xSuperTopflash Assay

Transfections of HEK293T cells and luciferase measurements were performed as previously described (Galli and Burrus, 2011). Briefly, HEK293T cells were transfected with Lipofectamine 2000 according to manufacturer’s protocol and incubated overnight. The cells were lysed and subjected to Dual Luciferase Assay as per manufacturer’s protocol.

Immunostaining

Total β-catenin was detected by use of a previously reported “conventional” staining protocol (Galli et al., 2007). Because β-catenin is most abundant at the plasma membrane, this protocol primarily detected β-catenin at the plasma membrane.

We used an antigen retrieval protocol to enhance the immunostaining of nuclear β-catenin (Borello et al., 2006, Brabletz et al., 2000, Brabletz et al., 2001). HH22 – 23 embryos were harvested, fixed, and cryosectioned. Slides were washed to remove the OCT and then immersed in 0.01 M citric acid, pH 6, in a 250 ml plastic slide holder that was then placed in a beaker with water and microwaved for 5 minutes on high and 30 minutes on low. After cooling, slides were blocked for 30 min at room temperature in Tris buffered saline (0.05 M Tris pH 7.4 with 0.15 M NaCl) containing 3% sheep serum before incubating with anti-β-catenin antibody (diluted 1:1000 in the blocking buffer) overnight at room temperature. The next day the slides were washed 3 times in Tris buffered saline, blocked for 15 minutes, and then incubated for 2 hours with anti-mouse IgG IgM Cy3 (diluted 1:200 in blocking buffer) at room temperature. After washing, slides were post fixed in 4% paraformaldehyde, washed, and mounted in slowfade.

Chick embryos electroporated with pCIG.FZD10-myc, in combination with FZD10 or control morpholinos, were sectioned and immunostained with anti-myc using a conventional immunostaining protocol (Galli et al., 2007). DAPI was used to visualize nuclei. Images were collected on a Zeiss LSM 710 confocal microscope.

In Situ Proximity Ligation Assay

Transfections of COS7 cells were carried out with Fugene according to manufacturer’s instructions. Cells were transfected with WNT1, WNT3A, FZD10, and/or LRP6. We used WNT1 or WNT3A monoclonal antibodies developed in our laboratory and a commercial FZD10 polyclonal antibody for this assay (Galli et al., 2007). The proximity ligation assay was carried out as per manufacturer’s instructions using a kit designed to fluoresce in the far-red region of the spectrum (Olink Bioscience). After the PLA, conventional secondary antibodies were added to immunolabel WNT1, WNT3A and FZD10. Cy2 coupled anti-mouse antibody was used for WNT1 and WNT3A while Cy3 labeled anti-rabbit antibody was used for FZD10. Images were collected via confocal microscopy.

We used Adobe Photoshop CS6 in combination with NIH ImageJ to count PLA positive punctae. After outlining WNT/FZD10 positive cells in Adobe Photoshop, the PLA channel was then copied and pasted into a new Photoshop document and saved in a PNG format. We then ran a macro on the png file in ImageJ that highlighted the area we wanted to count and saved that image as a tif file in a new folder. Using modified parameters defined in our laboratory, we used the Image-Based Tool for Counting Nuclei (ITCN) to count PLA punctae.

Proliferation Analysis

For the proliferation analysis, embryos electroporated with FZD10 morpholinos were sectioned and immunostained with anti-phospho histone H3 and anti-β-catenin using a conventional protocol (Galli et al., 2007). Whereas the phospho histone H3 antibodies marked cells in late G2 and M phase, the β-catenin antibodies primarily marked the plasma membranes. Images were either collected on a Nikon Eclipse E600 with a SPOT RTslider camera or on a Nikon C1 confocal microscope. Images were then processed in Photoshop where a quadrant grid was pasted and resized over the spinal cord. The number of phospho histone H3 positive cells was manually counted. The gridded image was then opened in SPOT Advanced 3.5.6 to measure the area of the individual quadrants.

Bullet Points.

  • The domain of WNT1 and WNT3A expression overlaps with that of FZD10 in the developing spinal cord.

  • The domain in which WNT1 and WNT3A signaling is active coincides with the domain of FZD10 expression in the dorsal spinal cord.

  • In the presence of LRP6, FZD10 promotes signaling of WNT1 and WNT3A via a β-catenin dependent pathway.

  • FZD10 interacts with WNT1 and WNT3A in an in situ proximity ligation assay.

  • Palmitoylation of WNT3A is not an absolute requirement for the interaction of WNT3A with FZD10.

  • FZD10 is required for proliferation in the dorsal spinal cord.

Acknowledgements

We thank Dr. Annette Chan of the Cell and Molecular Imaging Center for her assistance with confocal microscopy (SFSU). We would also like to thank the Beckman Foundation for funding the research endeavors of Roeben Munji and Camilla Teng. Ouma Onguka was supported by an NIH RISE fellowship while Roeben Munji, Joseph Ramahi, Rowena Suriben, and Baouyen Tran were supported by NIH MARC fellowships. Linda Szabo was supported by NSF RUI MCB-1244602. This research was made possible by NSF RUI MCB-1244602, NSF RUI IOS-0950892, NIH 2 SO6 GM52588 and NIH 1R15HD070206-01A1 grants to Dr. Laura Burrus, a NIH R01DC009236 grant to Dr. Susan C. Chapman, and a NIH-RIMI (P20MD000262) grant to San Francisco State University.

References

  1. ALVAREZ-MEDINA R, CAYUSO J, OKUBO T, TAKADA S, MARTI E. Wnt canonical pathway restricts graded Shh/Gli patterning activity through the regulation of Gli3 expression. Development. 2008;135:237–47. doi: 10.1242/dev.012054. [DOI] [PubMed] [Google Scholar]
  2. ANDERSSON ER, BRYJOVA L, BIRIS K, YAMAGUCHI TP, ARENAS E, BRYJA V. Genetic interaction between Lrp6 and Wnt5a during mouse development. Dev Dyn. 2010;239:237–45. doi: 10.1002/dvdy.22101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. AXELROD JD. Progress and challenges in understanding planar cell polarity signaling. Semin Cell Dev Biol. 2009;20:964–71. doi: 10.1016/j.semcdb.2009.08.001. [DOI] [PubMed] [Google Scholar]
  4. BARANSKI M, BERDOUGO E, SANDLER JS, DARNELL DK, BURRUS LW. The dynamic expression pattern of frzb-1 suggests multiple roles in chick development. Dev Biol. 2000;217:25–41. doi: 10.1006/dbio.1999.9516. [DOI] [PubMed] [Google Scholar]
  5. BARROW JR. Wnt/PCP signaling: a veritable polar star in establishing patterns of polarity in embryonic tissues. Semin Cell Dev Biol. 2006;17:185–93. doi: 10.1016/j.semcdb.2006.04.002. [DOI] [PubMed] [Google Scholar]
  6. BORELLO U, BERARDUCCI B, MURPHY P, BAJARD L, BUFFA V, PICCOLO S, BUCKINGHAM M, COSSU G. The Wnt/beta-catenin pathway regulates Gli-mediated Myf5 expression during somitogenesis. Development. 2006;133:3723–32. doi: 10.1242/dev.02517. [DOI] [PubMed] [Google Scholar]
  7. BORELLO U, BUFFA V, SONNINO C, MELCHIONNA R, VIVARELLI E, COSSU G. Differential expression of the Wnt putative receptors Frizzled during mouse somitogenesis. Mech Dev. 1999;89:173–7. doi: 10.1016/s0925-4773(99)00205-1. [DOI] [PubMed] [Google Scholar]
  8. BOURHIS E, TAM C, FRANKE Y, BAZAN JF, ERNST J, HWANG J, COSTA M, COCHRAN AG, HANNOUSH RN. Reconstitution of a frizzled8.Wnt3a.LRP6 signaling complex reveals multiple Wnt and Dkk1 binding sites on LRP6. J Biol Chem. 2010;285:9172–9. doi: 10.1074/jbc.M109.092130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. BRABLETZ T, HERRMANN K, JUNG A, FALLER G, KIRCHNER T. Expression of nuclear beta-catenin and c-myc is correlated with tumor size but not with proliferative activity of colorectal adenomas. Am J Pathol. 2000;156:865–70. doi: 10.1016/s0002-9440(10)64955-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. BRABLETZ T, JUNG A, REU S, PORZNER M, HLUBEK F, KUNZ SCHUGHART LA, KNUECHEL R, KIRCHNER T. Variable beta-catenin expression in colorectal cancers indicates tumor progression driven by the tumor environment. Proc Natl Acad Sci U S A. 2001;98:10356–61. doi: 10.1073/pnas.171610498. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. BROWN SD, TWELLS RC, HEY PJ, COX RD, LEVY ER, SODERMAN AR, METZKER ML, CASKEY CT, TODD JA, HESS JF. Isolation and characterization of LRP6, a novel member of the low density lipoprotein receptor gene family. Biochem Biophys Res Commun. 1998;248:879–88. doi: 10.1006/bbrc.1998.9061. [DOI] [PubMed] [Google Scholar]
  12. BRYJA V, ANDERSSON ER, SCHAMBONY A, ESNER M, BRYJOVA L, BIRIS KK, HALL AC, KRAFT B, CAJANEK L, YAMAGUCHI TP, BUCKINGHAM M, ARENAS E. The extracellular domain of Lrp5/6 inhibits noncanonical Wnt signaling in vivo. Mol Biol Cell. 2009;20:924–36. doi: 10.1091/mbc.E08-07-0711. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. CARMON KS, LOOSE DS. Development of a bioassay for detection of Wnt-binding affinities for individual frizzled receptors. Anal Biochem. 2010;401:288–94. doi: 10.1016/j.ab.2010.03.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. CARTER M, CHEN X, SLOWINSKA B, MINNERATH S, GLICKSTEIN S, SHI L, CAMPAGNE F, WEINSTEIN H, ROSS ME. Crooked tail (Cd) model of human folate-responsive neural tube defects is mutated in Wnt coreceptor lipoprotein receptor-related protein 6. Proc Natl Acad Sci U S A. 2005;102:12843–8. doi: 10.1073/pnas.0501963102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. CAUTHEN CA, BERDOUGO E, SANDLER J, BURRUS LW. Comparative analysis of the expression patterns of Wnts and Frizzleds during early myogenesis in chick embryos. Mech Dev. 2001;104:133–8. doi: 10.1016/s0925-4773(01)00369-0. [DOI] [PubMed] [Google Scholar]
  16. CHAPMAN SC, SCHUBERT FR, SCHOENWOLF GC, LUMSDEN A. Analysis of spatial and temporal gene expression patterns in blastula and gastrula stage chick embryos. Dev Biol. 2002;245:187–99. doi: 10.1006/dbio.2002.0641. [DOI] [PubMed] [Google Scholar]
  17. CHESNUTT C, BURRUS LW, BROWN AM, NISWANDER L. Coordinate regulation of neural tube patterning and proliferation by TGFbeta and WNT activity. Dev Biol. 2004;274:334–47. doi: 10.1016/j.ydbio.2004.07.019. [DOI] [PubMed] [Google Scholar]
  18. CLEVERS H. Wnt/beta-catenin signaling in development and disease. Cell. 2006;127:469–80. doi: 10.1016/j.cell.2006.10.018. [DOI] [PubMed] [Google Scholar]
  19. COOMBS GS, COVEY TM, VIRSHUP DM. Wnt signaling in development, disease and translational medicine. Curr Drug Targets. 2008;9:513–31. doi: 10.2174/138945008784911796. [DOI] [PubMed] [Google Scholar]
  20. DEARDORFF MA, TAN C, SAINT-JEANNET JP, KLEIN PS. A role for frizzled 3 in neural crest development. Development. 2001;128:3655–63. doi: 10.1242/dev.128.19.3655. [DOI] [PubMed] [Google Scholar]
  21. DICKINSON ME, KRUMLAUF R, MCMAHON AP. Evidence for a mitogenic effect of Wnt-1 in the developing mammalian central nervous system. Development. 1994;120:1453–71. doi: 10.1242/dev.120.6.1453. [DOI] [PubMed] [Google Scholar]
  22. DIEZ-ROUX G, BANFI S, SULTAN M, GEFFERS L, ANAND S, ROZADO D, MAGEN A, CANIDIO E, PAGANI M, PELUSO I, LIN-MARQ N, KOCH M, BILIO M, CANTIELLO I, VERDE R, DE MASI C, BIANCHI SA, CICCHINI J, PERROUD E, MEHMETI S, DAGAND E, SCHRINNER S, NURNBERGER A, SCHMIDT K, METZ K, ZWINGMANN C, BRIESKE N, SPRINGER C, HERNANDEZ AM, HERZOG S, GRABBE F, SIEVERDING C, FISCHER B, SCHRADER K, BROCKMEYER M, DETTMER S, HELBIG C, ALUNNI V, BATTAINI MA, MURA C, HENRICHSEN CN, GARCIA-LOPEZ R, ECHEVARRIA D, PUELLES E, GARCIA-CALERO E, KRUSE S, UHR M, KAUCK C, FENG G, MILYAEV N, ONG CK, KUMAR L, LAM M, SEMPLE CA, GYENESEI A, MUNDLOS S, RADELOF U, LEHRACH H, SARMIENTOS P, REYMOND A, DAVIDSON DR, DOLLE P, ANTONARAKIS SE, YASPO ML, MARTINEZ S, BALDOCK RA, EICHELE G, BALLABIO A. A high-resolution anatomical atlas of the transcriptome in the mouse embryo. PLoS Biol. 2011;9:e1000582. doi: 10.1371/journal.pbio.1000582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. ENDO Y, BEAUCHAMP E, WOODS D, TAYLOR WG, TORETSKY JA, UREN A, RUBIN JS. Wnt-3a and Dickkopf-1 stimulate neurite outgrowth in Ewing tumor cells via a Frizzled3- and c-Jun N-terminal kinase-dependent mechanism. Mol Cell Biol. 2008;28:2368–79. doi: 10.1128/MCB.01780-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. FOKINA VM, FROLOVA EI. Expression patterns of Wnt genes during development of an anterior part of the chicken eye. Dev Dyn. 2006;235:496–505. doi: 10.1002/dvdy.20621. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. FUNAYAMA N, FAGOTTO F, MCCREA P, GUMBINER BM. Embryonic axis induction by the armadillo repeat domain of beta-catenin: evidence for intracellular signaling. J Cell Biol. 1995;128:959–68. doi: 10.1083/jcb.128.5.959. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. GALLI LM, BARNES T, CHENG T, ACOSTA L, ANGLADE A, WILLERT K, NUSSE R, BURRUS LW. Differential inhibition of Wnt-3a by Sfrp-1, Sfrp-2, and Sfrp-3. Dev Dyn. 2006;235:681–690. doi: 10.1002/dvdy.20681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. GALLI LM, BARNES TL, SECREST SS, KADOWAKI T, BURRUS LW. Porcupine-mediated lipid-modification regulates the activity and distribution of Wnt proteins in the chick neural tube. Development. 2007;134:3339–48. doi: 10.1242/dev.02881. [DOI] [PubMed] [Google Scholar]
  28. GALLI LM, BURRUS LW. Differential palmit(e)oylation of Wnt1 on C93 and S224 residues has overlapping and distinct consequences. PLoS One. 2011;6:e26636. doi: 10.1371/journal.pone.0026636. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. GAO X, HANNOUSH RN. Single-cell imaging of Wnt palmitoylation by the acyltransferase porcupine. Nat Chem Biol. 2014;10:61–8. doi: 10.1038/nchembio.1392. [DOI] [PubMed] [Google Scholar]
  30. GARCIA-MORALES C, LIU CH, ABU-ELMAGD M, HAJIHOSSEINI MK, WHEELER GN. Frizzled-10 promotes sensory neuron development in Xenopus embryos. Dev Biol. 2009;335:143–55. doi: 10.1016/j.ydbio.2009.08.021. [DOI] [PubMed] [Google Scholar]
  31. HAMBURGER V, HAMILTON HL. A series of normal stages in the development of the chick embryo. J. Morphol. 1951;88:49–92. [PubMed] [Google Scholar]
  32. HENDZEL MJ, WEI Y, MANCINI MA, VAN HOOSER A, RANALLI T, BRINKLEY BR, BAZETT-JONES DP, ALLIS CD. Mitosis-specific phosphorylation of histone H3 initiates primarily within pericentromeric heterochromatin during G2 and spreads in an ordered fashion coincident with mitotic chromosome condensation. Chromosoma. 1997;106:348–60. doi: 10.1007/s004120050256. [DOI] [PubMed] [Google Scholar]
  33. HEY PJ, TWELLS RC, PHILLIPS MS, YUSUKE N, BROWN SD, KAWAGUCHI Y, COX R, GUOCHUN X, DUGAN V, HAMMOND H, METZKER ML, TODD JA, HESS JF. Cloning of a novel member of the low-density lipoprotein receptor family. Gene. 1998;216:103–11. doi: 10.1016/s0378-1119(98)00311-4. [DOI] [PubMed] [Google Scholar]
  34. HOLLYDAY M, MCMAHON JA, MCMAHON AP. Wnt expression patterns in chick embryo nervous system. Mech Dev. 1995;52:9–25. doi: 10.1016/0925-4773(95)00385-e. [DOI] [PubMed] [Google Scholar]
  35. HOUSTON DW, WYLIE C. Cloning and expression of Xenopus Lrp5 and Lrp6 genes. Mech Dev. 2002;117:337–42. doi: 10.1016/s0925-4773(02)00205-8. [DOI] [PubMed] [Google Scholar]
  36. HUBER O, KORN R, MCLAUGHLIN J, OHSUGI M, HERRMANN BG, KEMLER R. Nuclear localization of beta-catenin by interaction with transcription factor LEF-1. Mech Dev. 1996;59:3–10. doi: 10.1016/0925-4773(96)00597-7. [DOI] [PubMed] [Google Scholar]
  37. IKEYA M, LEE SM, JOHNSON JE, MCMAHON AP, TAKADA S. Wnt signalling required for expansion of neural crest and CNS progenitors. Nature. 1997;389:966–70. doi: 10.1038/40146. [DOI] [PubMed] [Google Scholar]
  38. JANDA CY, WAGHRAY D, LEVIN AM, THOMAS C, GARCIA KC. Structural basis of Wnt recognition by Frizzled. Science. 2012;337:59–64. doi: 10.1126/science.1222879. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. JENNY A, MLODZIK M. Planar cell polarity signaling: a common mechanism for cellular polarization. Mt Sinai J Med. 2006;73:738–50. [PubMed] [Google Scholar]
  40. JIN EJ, ERICKSON CA, TAKADA S, BURRUS LW. Wnt and BMP signaling govern lineage segregation of melanocytes in the avian embryo. Dev Biol. 2001;233:22–37. doi: 10.1006/dbio.2001.0222. [DOI] [PubMed] [Google Scholar]
  41. JOINER DM, KE J, ZHONG Z, XU HE, WILLIAMS BO. LRP5 and LRP6 in development and disease. Trends Endocrinol Metab. 2013;24:31–9. doi: 10.1016/j.tem.2012.10.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. JONES C, CHEN P. Planar cell polarity signaling in vertebrates. Bioessays. 2007;29:120–32. doi: 10.1002/bies.20526. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. KAWAKAMI Y, WADA N, NISHIMATSU S, KOMAGUCHI C, NOJI S, NOHNO T. Identification of chick frizzled-10 expressed in the developing limb and the central nervous system. Mech Dev. 2000a;91:375–8. doi: 10.1016/s0925-4773(99)00301-9. [DOI] [PubMed] [Google Scholar]
  44. KAWAKAMI Y, WADA N, NISHIMATSU S, NOHNO T. Involvement of frizzled-10 in Wnt-7a signaling during chick limb development. Dev Growth Differ. 2000b;42:561–9. doi: 10.1046/j.1440-169x.2000.00545.x. [DOI] [PubMed] [Google Scholar]
  45. KENGAKU M, CAPDEVILA J, RODRIGUEZ-ESTEBAN C, DE LA PENA J, JOHNSON RL, IZPISUA BELMONTE JC, TABIN CJ. Distinct WNT pathways regulating AER formation and dorsoventral polarity in the chick limb bud. Science. 1998;280:1274–7. doi: 10.1126/science.280.5367.1274. [DOI] [PubMed] [Google Scholar]
  46. KLEIN TJ, MLODZIK M. Planar cell polarization: an emerging model points in the right direction. Annu Rev Cell Dev Biol. 2005;21:155–76. doi: 10.1146/annurev.cellbio.21.012704.132806. [DOI] [PubMed] [Google Scholar]
  47. KOHN AD, MOON RT. Wnt and calcium signaling: beta-catenin-independent pathways. Cell Calcium. 2005;38:439–46. doi: 10.1016/j.ceca.2005.06.022. [DOI] [PubMed] [Google Scholar]
  48. KUBOTA T, MICHIGAMI T, SAKAGUCHI N, KOKUBU C, SUZUKI A, NAMBA N, SAKAI N, NAKAJIMA S, IMAI K, OZONO K. Lrp6 hypomorphic mutation affects bone mass through bone resorption in mice and impairs interaction with Mesd. J Bone Miner Res. 2008;23:1661–71. doi: 10.1359/jbmr.080512. [DOI] [PubMed] [Google Scholar]
  49. KUHL M, SHELDAHL LC, PARK M, MILLER JR, MOON RT. The Wnt/Ca2+ pathway: a new vertebrate Wnt signaling pathway takes shape. Trends Genet. 2000;16:279–83. doi: 10.1016/s0168-9525(00)02028-x. [DOI] [PubMed] [Google Scholar]
  50. LOGAN CY, NUSSE R. The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol. 2004;20:781–810. doi: 10.1146/annurev.cellbio.20.010403.113126. [DOI] [PubMed] [Google Scholar]
  51. MACDONALD BT, TAMAI K, HE X. Wnt/beta-catenin signaling: components, mechanisms, and diseases. Dev Cell. 2009;17:9–26. doi: 10.1016/j.devcel.2009.06.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. MARETTO S, CORDENONSI M, DUPONT S, BRAGHETTA P, BROCCOLI V, HASSAN AB, VOLPIN D, BRESSAN GM, PICCOLO S. Mapping Wnt/beta-catenin signaling during mouse development and in colorectal tumors. Proc Natl Acad Sci U S A. 2003;100:3299–304. doi: 10.1073/pnas.0434590100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. MCCABE KL, SHIAU CE, BRONNER-FRASER M. Identification of candidate secreted factors involved in trigeminal placode induction. Dev Dyn. 2007;236:2925–35. doi: 10.1002/dvdy.21325. [DOI] [PubMed] [Google Scholar]
  54. MEGASON SG, MCMAHON AP. A mitogen gradient of dorsal midline Wnts organizes growth in the CNS. Development. 2002;129:2087–98. doi: 10.1242/dev.129.9.2087. [DOI] [PubMed] [Google Scholar]
  55. MIKELS AJ, NUSSE R. Purified Wnt5a protein activates or inhibits beta-catenin-TCF signaling depending on receptor context. PLoS Biol. 2006;4:e115. doi: 10.1371/journal.pbio.0040115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. MOON RT, KOHN AD, DE FERRARI GV, KAYKAS A. WNT and beta-catenin signalling: diseases and therapies. Nat Rev Genet. 2004;5:691–701. doi: 10.1038/nrg1427. [DOI] [PubMed] [Google Scholar]
  57. NUNNALLY AP, PARR BA. Analysis of Fz10 expression in mouse embryos. Dev Genes Evol. 2004;214:144–8. doi: 10.1007/s00427-004-0386-4. [DOI] [PubMed] [Google Scholar]
  58. NUSSE R. Wnt signaling in disease and in development. Cell Res. 2005;15:28–32. doi: 10.1038/sj.cr.7290260. [DOI] [PubMed] [Google Scholar]
  59. PARR BA, SHEA MJ, VASSILEVA G, MCMAHON AP. Mouse Wnt genes exhibit discrete domains of expression in the early embryonic CNS and limb buds. Development. 1993;119:247–61. doi: 10.1242/dev.119.1.247. [DOI] [PubMed] [Google Scholar]
  60. PAXTON CN, BLEYL SB, CHAPMAN SC, SCHOENWOLF GC. Identification of differentially expressed genes in early inner ear development. Gene Expr Patterns. 2010;10:31–43. doi: 10.1016/j.gep.2009.11.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. PINSON KI, BRENNAN J, MONKLEY S, AVERY BJ, SKARNES WC. An LDL-receptor-related protein mediates Wnt signalling in mice. Nature. 2000;407:535–8. doi: 10.1038/35035124. [DOI] [PubMed] [Google Scholar]
  62. ROSSI E, SIWIEC F, YAN CY. Pattern of Wnt ligand expression during chick eye development. Braz J Med Biol Res. 2007;40:1333–8. doi: 10.1590/s0100-879x2006005000155. [DOI] [PubMed] [Google Scholar]
  63. SAINT-JEANNET JP, HE X, VARMUS HE, DAWID IB. Regulation of dorsal fate in the neuraxis by Wnt-1 and Wnt-3a. Proc Natl Acad Sci U S A. 1997;94:13713–8. doi: 10.1073/pnas.94.25.13713. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. SCHNEIDER S, STEINBEISSER H, WARGA RM, HAUSEN P. Beta-catenin translocation into nuclei demarcates the dorsalizing centers in frog and fish embryos. Mech Dev. 1996;57:191–8. doi: 10.1016/0925-4773(96)00546-1. [DOI] [PubMed] [Google Scholar]
  65. SODERBERG O, GULLBERG M, JARVIUS M, RIDDERSTRALE K, LEUCHOWIUS KJ, JARVIUS J, WESTER K, HYDBRING P, BAHRAM F, LARSSON LG, LANDEGREN U. Direct observation of individual endogenous protein complexes in situ by proximity ligation. Nat Methods. 2006;3:995–1000. doi: 10.1038/nmeth947. [DOI] [PubMed] [Google Scholar]
  66. STARK MR, BIGGS JJ, SCHOENWOLF GC, RAO MS. Characterization of avian frizzled genes in cranial placode development. Mech Dev. 2000;93:195–200. doi: 10.1016/s0925-4773(00)00263-x. [DOI] [PubMed] [Google Scholar]
  67. STENMAN JM, RAJAGOPAL J, CARROLL TJ, ISHIBASHI M, MCMAHON J, MCMAHON AP. Canonical Wnt signaling regulates organ-specific assembly and differentiation of CNS vasculature. Science. 2008;322:1247–50. doi: 10.1126/science.1164594. [DOI] [PubMed] [Google Scholar]
  68. SUMMERHURST K, STARK M, SHARPE J, DAVIDSON D, MURPHY P. 3D representation of Wnt and Frizzled gene expression patterns in the mouse embryo at embryonic day 11.5 (Ts19) Gene Expr Patterns. 2008;8:331–48. doi: 10.1016/j.gep.2008.01.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. TAMAI K, SEMENOV M, KATO Y, SPOKONY R, LIU C, KATSUYAMA Y, HESS F, SAINT-JEANNET JP, HE X. LDL-receptor-related proteins in Wnt signal transduction. Nature. 2000;407:530–5. doi: 10.1038/35035117. [DOI] [PubMed] [Google Scholar]
  70. TERRY K, MAGAN H, BARANSKI M, BURRUS LW. Sfrp-1 and sfrp-2 are expressed in overlapping and distinct domains during chick development. Mech Dev. 2000;97:177–82. doi: 10.1016/s0925-4773(00)00407-x. [DOI] [PubMed] [Google Scholar]
  71. TETSU O, MCCORMICK F. Beta-catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature. 1999;398:422–6. doi: 10.1038/18884. [DOI] [PubMed] [Google Scholar]
  72. VAN AMERONGEN R, NUSSE R. Towards an integrated view of Wnt signaling in development. Development. 2009;136:3205–14. doi: 10.1242/dev.033910. [DOI] [PubMed] [Google Scholar]
  73. VEEMAN MT, AXELROD JD, MOON RT. A second canon. Functions and mechanisms of beta-catenin-independent Wnt signaling. Dev Cell. 2003a;5:367–77. doi: 10.1016/s1534-5807(03)00266-1. [DOI] [PubMed] [Google Scholar]
  74. VEEMAN MT, SLUSARSKI DC, KAYKAS A, LOUIE SH, MOON RT. Zebrafish prickle, a modulator of noncanonical Wnt/Fz signaling, regulates gastrulation movements. Curr Biol. 2003b;13:680–5. doi: 10.1016/s0960-9822(03)00240-9. [DOI] [PubMed] [Google Scholar]
  75. VLADAR EK, ANTIC D, AXELROD JD. Planar cell polarity signaling: the developing cell’s compass. Cold Spring Harb Perspect Biol. 2009;1:a002964. doi: 10.1101/cshperspect.a002964. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. WANG Y, GUO N, NATHANS J. The role of Frizzled3 and Frizzled6 in neural tube closure and in the planar polarity of inner-ear sensory hair cells. J Neurosci. 2006;26:2147–56. doi: 10.1523/JNEUROSCI.4698-05.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. WANG Y, NATHANS J. Tissue/planar cell polarity in vertebrates: new insights and new questions. Development. 2007;134:647–58. doi: 10.1242/dev.02772. [DOI] [PubMed] [Google Scholar]
  78. WEHRLI M, DOUGAN ST, CALDWELL K, O’KEEFE L, SCHWARTZ S, VAIZEL-OHAYON D, SCHEJTER E, TOMLINSON A, DINARDO S. arrow encodes an LDL-receptor-related protein essential for Wingless signalling. Nature. 2000;407:527–30. doi: 10.1038/35035110. [DOI] [PubMed] [Google Scholar]
  79. WEI Y, YU L, BOWEN J, GOROVSKY MA, ALLIS CD. Phosphorylation of histone H3 is required for proper chromosome condensation and segregation. Cell. 1999;97:99–109. doi: 10.1016/s0092-8674(00)80718-7. [DOI] [PubMed] [Google Scholar]
  80. YAN Y, LI Y, HU C, GU X, LIU J, HU YA, YANG Y, WEI Y, ZHAO C. Expression of Frizzled10 in mouse central nervous system. Gene Expr Patterns. 2009;9:173–7. doi: 10.1016/j.gep.2008.11.001. [DOI] [PubMed] [Google Scholar]
  81. YU H, SMALLWOOD PM, WANG Y, VIDALTAMAYO R, REED R, NATHANS J. Frizzled 1 and frizzled 2 genes function in palate, ventricular septum and neural tube closure: general implications for tissue fusion processes. Development. 2010;137:3707–17. doi: 10.1242/dev.052001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  82. ZECHNER D, FUJITA Y, HULSKEN J, MULLER T, WALTHER I, TAKETO MM, CRENSHAW EB, 3RD, BIRCHMEIER W, BIRCHMEIER C. beta-Catenin signals regulate cell growth and the balance between progenitor cell expansion and differentiation in the nervous system. Dev Biol. 2003;258:406–18. doi: 10.1016/s0012-1606(03)00123-4. [DOI] [PubMed] [Google Scholar]
  83. ZECHNER D, MULLER T, WENDE H, WALTHER I, TAKETO MM, CRENSHAW EB, 3RD, TREIER M, BIRCHMEIER W, BIRCHMEIER C. Bmp and Wnt/beta-catenin signals control expression of the transcription factor Olig3 and the specification of spinal cord neurons. Dev Biol. 2007;303:181–90. doi: 10.1016/j.ydbio.2006.10.045. [DOI] [PubMed] [Google Scholar]
  84. ZHOU CJ, WANG YZ, YAMAGAMI T, ZHAO T, SONG L, WANG K. Generation of Lrp6 conditional gene-targeting mouse line for modeling and dissecting multiple birth defects/congenital anomalies. Dev Dyn. 2010;239:318–26. doi: 10.1002/dvdy.22054. [DOI] [PubMed] [Google Scholar]

RESOURCES