Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Jun 1.
Published in final edited form as: Comp Biochem Physiol C Toxicol Pharmacol. 2014 Jan 30;163:24–36. doi: 10.1016/j.cbpc.2014.01.005

Connectivity of vertebrate genomes: Paired-related homeobox (Prrx) genes in spotted gar, basal teleosts, and tetrapods

Ingo Braasch a, Yann Guiguen b, Ryan Loker a, John H Letaw a,1, Allyse Ferrara c, Julien Bobe b, John H Postlethwait a
PMCID: PMC4032612  NIHMSID: NIHMS569579  PMID: 24486528

Abstract

Teleost fish are important models for human biology, health, and disease. Because genome duplication in a teleost ancestor (TGD) impacts the evolution of teleost genome structure and gene repertoires, we must discriminate gene functions that are shared and ancestral from those that are lineage-specific in teleosts or tetrapods to accurately apply inferences from teleost disease models to human health. Generalizations must account both for the TGD and for divergent evolution between teleosts and tetrapods after the likely two rounds of genome duplication shared by all vertebrates. Progress in sequencing techniques provides new opportunities to generate genomic and transcriptomic information from a broad range of phylogenetically informative taxa that facilitate detailed understanding of gene family and gene function evolution.

We illustrate here the use of new sequence resources from spotted gar (Lepisosteus oculatus), a rayfin fish that diverged from teleosts before the TGD, as well as RNA-Seq data from gar and multiple teleost lineages to reconstruct the evolution of the Paired-related homeobox (Prrx) transcription factor gene family, which is involved in the development of mesoderm and neural crest-derived mesenchyme. We show that for Prrx genes, the spotted gar genome and gene expression patterns mimic mammals better than teleosts do. Analyses force the seemingly paradoxical conclusion that regulatory mechanisms for the limb expression domains of Prrx genes existed before the evolution of paired appendages. Detailed evolutionary analyses like those reported here are required to identify fish species most similar to the human genome to optimally connect fish models to human gene functions in health and disease.

Keywords: Prrx1, Prrx2, aquatic medical model, vertebrate, genome duplication, ohnolog, RNA-Seq, paired appendages, fin/limb bud, craniofacial

1. Introduction

Several teleost fish species, most prominently zebrafish, medaka, platyfish, stickleback, and killifish, are used as model species for human development, physiology, health, and disease (reviewed in Schartl, 2013). Despite their advantages as laboratory research models – such as easy husbandry, high fertility, external fertilization, embryo transparency, tractable genetics, and amenability for high-throughput drug screens – interpretations of results obtained from teleosts species are challenged by ∼900 million years of independent evolution that separates teleosts from the condition humaine: Since the last fish-like bony vertebrate (euteleostome) ancestor that lived ∼450 million years ago (Hedges et al., 2006), the lobefin vertebrate (sarcopterygian) lineage that led to tetrapods, mammals and later humans has evolved independently of the rayfin vertebrate (actinopterygian) lineage, including teleost fishes, which have significantly remodeled their morphology and, importantly, their genomes since the euteleostome ancestor.

Two rounds of vertebrate genome duplication (VGD1 and VGD2; Fig. 1) likely occurred at the stem of the vertebrate branch (Dehal and Boore, 2005; Putnam et al., 2008) and, despite the overall high level of conservation of genes between teleosts and tetrapods (Howe et al., 2013), important differences characterize the arrangement of specific gene families in both lineages. The lineages of teleosts and tetrapods have divergently retained gene duplicates from whole genome duplications, a class of paralogs generally termed ‘ohnologs’ (Wolfe, 2001). For example, a central regulator of pluripotency in mammals, Pou5f1 (also known as Oct3 or Oct3/4), was lost in the rayfin fish lineage (Frankenberg and Renfree, 2013). The tetrapod genome, on the other hand, has undergone substantial loss of ancestral genes during the water-to-land transition as well, for example actinodin and fgf24 (Amemiya et al., 2013).

Fig. 1. Cladogram showing phylogenetic relationships among vertebrates analyzed in the present study.

Fig. 1

Tree topology was adopted from Near et al. (2012). VGD1/2: vertebrate genome duplication 1/2; TGD: teleost genome duplication. The results of our Prrx gene surveys are shown to the right. Presence/absence of genes is indicated by colored/white boxes. Within teleosts, a and b refer to the presence/absence of the a- and b-paralogs of prrx1, with the special case of x/y referring to the two prrx1 paralogs of from butterflyfish, for which the orthology to other teleost prrx1 genes remains unclear. The relationship of the single lamprey prrx gene to other vertebrate prrx genes also remains unresolved (see text for further information).

In addition to these instances of ‘ohnologs gone missing’ (Postlethwait, 2007) leading to the divergence of gene contents in teleost and tetrapod genomes, an additional round of whole genome duplication occurred in an ancestor of the teleost lineage, the teleost genome duplication or TGD; 12-24% of genes have been retained as two paralogous genes in teleosts compared to one gene in tetrapods (reviewed in Braasch and Postlethwait, 2012). TGD paralogs (also termed co-orthologs), have often, like VGD1 and VGD2 ohnologs, changed functions by mechanisms such as subfunctionalization, i.e. the partitioning of ancestral gene functions among duplicates, and/or neofunctionalization, i.e. the acquisition of new gene functions in one or both co-orthologs (Force et al., 1999; Postlethwait et al., 2004). These differences in gene repertoires and gene functions between teleosts and tetrapods can make it difficult to transfer knowledge obtained in a teleost model species to the human condition.

Until recently, genomic sequence information was restricted to a few teleost model species, i.e. zebrafish (Howe et al., 2013), medaka (Kasahara et al., 2007), stickleback (Jones et al., 2012), and pufferfishes (Aparicio et al., 2002; Jaillon et al., 2004), but progress in sequencing techniques has enabled the relatively cheap and fast generation of genomic and transcriptomic sequence data from numerous fish species.

The present study illustrates how the availability of sequence information from a wide range of phylogenetically informative fish species can improve our understanding of gene function evolution among vertebrates, thereby better informing the suitability of teleost models for the analysis of specific gene functions and associated diseases. To this end, we take advantage of genomic sequence information from the spotted gar (Lepisosteus oculatus), a member of the closest living sister lineage to the teleosts, the holosteans (gars and bowfin), which diverged from teleosts before the TGD (Amores et al., 2011) (Fig. 1). The spotted gar offers a unique opportunity to study gene functions in a non-teleost, unduplicated rayfin species that is suitable for gene function analysis in a laboratory environment (Amores et al., 2011; Braasch and Postlethwait, 2012). Other, even more basally diverging lineage of rayfin fish such as Polypteriformes (bichirs and reedfish, the most basal living rayfin group; Raincrow et al., 2011), as well as Acipenseriformes (sturgeons and paddlefish), would be helpful for the analysis of rayfin gene functions, but genomic resources for these lineage are currently lacking and, in the case of Acipenseriformes, are further complicated by multiple, lineage-specific polyploidization events (Braasch and Postlethwait, 2012; Crow et al., 2012). Basally diverging teleost lineages, such as elopomorphs and osteoglossomorphs (Fig. 1), on the other hand, offer the opportunity to gain better understanding of the evolutionary mechanisms leading to the divergence of gene repertoires and gene functions shortly after the rise of the teleost lineage and the TGD.

We illustrate the use of these new sequence resources by the example of Paired-related homeobox (Prrx) genes. Prrx genes encode transcription factors characterized by a paired type DNA-binding homeodomain and a C-terminal OAR domain functioning as an interface for cofactor interactions (Norris and Kern, 2001). Prrx genes play essential roles in several developmental processes, particularly of mesoderm and neural crest-derived mesenchyme (Cserjesi et al., 1992; Kern et al., 1992; Opstelten et al., 1991). In tetrapods, Prrx genes are expressed in mesenchymal tissues like the limb buds, cranial and axial mesoderm, and branchial arches as well as during brain and heart development (Beverdam and Meijlink, 2001; Kuratani et al., 1994; Leussink et al., 1995; Lu et al., 1999; Nohno et al., 1993; Opstelten et al., 1991; Takahashi et al., 1998). Loss of Prrx functions in mice result in malformations in the skull, jaws, limbs, ears, and vasculature (Bergwerff et al., 2000; Martin et al., 1995; ten Berge et al., 1998) and mutations in human PRRX1 are associated with the agnathia-otocephaly complex (OMIM: #202650). Prrx1 is involved in pancreas development and regeneration (Reichert et al., 2013), has been identified as an inducer of epithelial-to-mesenchymal transitions, and its loss is required for cancer metastasis (Ocana et al., 2012). Furthermore, Prrx1 is important for the maintenance of adult neural stem cells in mammals (Shimozaki et al., 2013). The expression domains of Prrx2, a second Prrx gene, overlap with many expression domains of Prrx1 in tetrapods (Leussink et al., 1995; Lu et al., 1999), yet Prrx2 seems to be absent from teleosts (Hernandez-Vega and Minguillon, 2011). The importance of PRRX genes for human development and health and specific differences in the repertoire of Prrx genes between teleost and tetrapods reported in the literature make this gene family a good example to illustrate the use of new fish sequence resources to improve the connectivity of vertebrate gene functions.

2. Material and Methods

2.1 Animals and tissue collection

In the PhyloFish project, ten tissues/organs (ovary, testis, brain, gills, intestine, liver, bones, kidney, muscle, heart) were collected from adult spotted gar, zebrafish (Danio rerio), Japanese ricefish (medaka; Oryzias latipes), Northern pike (Esox lucius), allis shad (Alosa alosa), striped catfish (Pangasianodon hypophthalmus), butterflyfish (Pantodon buchholzi), and European eel (Anguilla anguilla). See Fig. 1 for species relationships. In some species (spotted gar, zebrafish, medaka, Northern pike, striped catfish), embryos were also collected around the eyed stage. In European eel, a leptocephalus stage was used in place of the embryonic sample.

2.2 RNA-seq

Tissues were homogenized in Tri-reagent (Sigma, St. Louis, MO, USA) at a ratio of 100 mg of tissue per ml of reagent and total RNA was extracted according to manufacturer's instructions. RNA quality was checked on a Bioanalyzer 2100 (Aligent, Santa Clara, CA). Sequencing libraries were prepared using a TruSeq RNA sample preparation kit according to the manufacturer's instructions (Illumina, San Diego, CA, USA). Poly-A-containing mRNA was isolated from total RNA using poly-T oligo-attached magnetic beads, and chemically fragmented. First strand cDNA was generated using SuperScript II reverse transcriptase and random primers. Following the second strand cDNA synthesis and adaptor ligation, cDNA fragments were amplified by PCR. Amplification products were loaded onto an Illumina HiSeq2000 instrument and subjected to multiplexed paired-end (2 × 100 bp) sequencing. The processing of fluorescent images into sequences, base-calling and quality value calculations were performed using the Illumina data processing pipeline. Coding sequences of prrx genes were obtained from de novo assembly of cDNAs performed in a library-specific manner using Velvet and Oases (Schulz et al., 2012). Sequences of prrx transcripts were submitted to GenBank (accession numbers KF841587 - KF841600).

2.3 Identification and genomic annotation of prrx genes

Assembled transcripts from RNA-Seq experiments were used to annotate prrx genes in the genomes of spotted gar (genome assembly LepOcu1; GenBank Assembly ID: GCA_000242695.1), European eel (Henkel et al., 2012a), and Japanese eel (Anguilla japonica) (Henkel et al., 2012b). Agnathan prrx was identified by tblastn–guided manual annotation of genomic sequences in the genome of Artic lamprey (Lethenteron camtschaticum) (GenBank Assembly ID: GCA_000466285.1; Mehta et al., 2013). Chondrichthyan prrx transcripts were identified by tblastn in the transcriptomes of little skate (Leucoraja erinacea), small spotted catshark (Scyliorhinus canicula), and elephant shark (Callorhinchus milii) (http://skatebase.org/downloads). Other Prrx sequences were obtained from Ensembl release 73 (http://www.ensembl.org). Suppl. Tab. 1 summarized sequence information and accession numbers.

2.4 Phylogenetic analysis

Sequence alignments were performed with MUSCLE (Edgar, 2004) implemented in GENEIOUS 6.1.6 (Biomatters, Ltd.). The appropriate models for nucleotide evolution (GTR+I+G) and protein evolution (JTT+G+F) for phylogentic tree inference were determined using jModelTest 2 (Darriba et al., 2012) and ProtTest 2.4 (Abascal et al., 2005), respectively. Maximum likelihood trees were generated with PhyML 3.0 (Guindon et al., 2010) with 100 bootstrap replications and a 50% consensus rule.

2.5 Synteny analysis

The spotted gar genome assembly (LepOcu1) and a preliminary gene annotation were downloaded from PreEnsembl (http://pre.ensembl.org/Lepisosteus_oculatus), integrated into the Synteny Database (Catchen et al., 2009), and used to generate dot plots, orthologous pairwise, and paralogous pairwise clusters. Pairwise clusters were generated with sliding window sizes of 100 and 200 genes and paralogous pairwise clusters within the genomes of spotted gar and human were identified with amphioxus (Branchiostoma floridae) as outgroup (Fig. 1).

Genes directly surrounding Prrx genes in human, zebrafish, and stickleback were identified in Ensembl release 73; genes directly surrounding the spotted gar, Japanese eel, and Arctic lamprey prrx genes were predicted with AUGUSTUS (Stanke et al., 2004) and then annotated with blastp against the nr database of GenBank (http://blast.ncbi.nlm.nih.gov/Blast.cgi).

2.6 Spotted gar breeding, husbandry and ethics statement

Wild adult spotted gar were collected from the Atchafalaya River Basin, Louisiana. Spotted gar broodstock were injected with Ovaprim© (0.5 ml/kg) to induce spawning and cultured in a 2-m diameter tank containing artificial spawning substrate. Mean total length/weight for female and male broodstock was 691mm/1235g and 571mm/616g, respectively. Fertilized eggs from a group spawn were shipped to the University of Oregon and arrived two days after fertilization. Embryos were manually dechorionated with forceps and raised in fish water (1ppt salinity) at 24°C in a 14h light, 10h dark cycle. To inhibit melanin formation, 0.015 g/l N-Phenylthiourea (Sigma-Aldrich) was added to the fish water without any signs of developmental delay or malformations. Developmental stages were determined following (Long and Ballard, 2001). Animals were handled in accordance with good animal practice as approved by the University of Oregon Institutional Animal Care and Use Committee (Animal Welfare Assurance Number A-3009-01, IACUC protocol 12-02RA).

2. 7 Spotted gar RNA in situ hybridization

RNA in situ hybridization probes were cloned from spotted gar genomic DNA with the following primer sets:

  • Loc-prrx 1 -ex4F CTACCTACCCACCCACATGC,

  • Loc-prrx1-3′UTRR CTTCAGATGTGCTTGGCAGAT (1,572bp),

  • Loc-prrx2-ex4F GGCCAAGGAGTACAGTCTGC,

  • Loc-prrx2-3′UTRR GTAAAAAGATCGGCCAGCTG (1,568bp). Spotted gar whole mount in situ hybridizations were performed following a standard zebrafish protocol (Jowett and Yan, 1996) with proteinase K (10 μg/mL) digestion times of 35 min for Long/Ballard stage (st.) 28-29 and 50 min for st.33-34 55 min.

2.8 Tissue expression profiling

For spotted gar, zebrafish, medaka, and European eel, expression profiles among the tissue set were generated through re-mapping of Illumina reads using BWA (Li and Durbin, 2009) and SAMtools (Li et al., 2009) implemented in Galaxy (Goecks et al., 2010). For each library, reads were realigned onto the coding sequence of the deduced cDNAs using BWA (maximum of two mismatches allowed, -aln 2), and counted using SAMtools (with a maximum alignment quality value –q 30, to discard ambiguous mapping reads). Read counts were subsequently normalized and expressed as reads per kb per million reads (RPKM).

3. Results

3.1 Prrx1 and Prrx2 are ancient vertebrate paralogs

A single prrx gene is present in non-vertebrate genomes such as fruitfly and the cephalochordate amphioxus (Fig. 1), but two Prrx genes have been identified in vertebrates (Zhong and Holland, 2011). Prrx1 has been described in tetrapods and zebrafish, but Prrx2 has only been found so far in tetrapods and is absent from the zebrafish genome (Hernandez-Vega and Minguillon, 2011). The genome of the African coelacanth (Latimeria chalumnae) (Amemiya et al., 2013) harbors both Prrx paralogs, suggesting that Prrx2 could be a gene specific to the lobefin lineage.

We examined the spotted gar genome and its transcriptomes and found that both resources contained both prrx genes, prrx1 and prrx2. The prrx1 ortholog is located on spotted gar linkage group 10 (LG10) with extensive conserved macrosynteny to the human PRRX1 genes on human chromosome Hsa1 (Figs. 2A, C). Likewise, the spotted gar prrx2 ortholog on LG21 shows long-range conserved macrosynteny to the human PRRX2 region on Hsa9 (Figs. 2B, D). These data show that the duplication of the Prrx1/2 precursor predates the divergence of rayfin and lobefin vertebrates.

Fig. 2. Conserved synteny between human and spotted gar Prrx genes.

Fig. 2

A) A dotplot comparing the human PRRX1 gene region on chromosome 1 (Hsa1) to the spotted gar (Loc) genome shows extensive conserved synteny to spotted gar LG10. B) Conserved synteny of human and spotted gar Prrx2 genes. C, D) Orthologous pairwise clusters between human and spotted gar.

A prrx1 gene was previously reported for small spotted catshark (Compagnucci et al., 2013). To further date the duplication of the Prrx1/2 precursor, we looked for Prrx genes in the transcriptomes and genomes of three cartilaginous fish, whose lineage diverged from the bony vertebrates before the divergence of rayfin and lobefin fish, and in the genomes of two lamprey species as representatives of jawless vertebrates, the deepest diverging living vertebrates (Fig. 1). Both Prrx paralogs were found for small spotted catshark, little skate, and elephant shark showing that the Prrx duplication predates the origin of extant jawed (gnathostome) vertebrates. The situation in lampreys, however, is less conclusive: While no prrx gene could be located in the genome assembly of the sea lamprey (Petromyzon marinus), the genome of the Arctic lamprey possesses a clear prrx gene. Thus, based on the prrx gene repertoire in agnathans, it remains unclear whether the duplication of Prrx predates the origin of all living vertebrate lineages or whether this was a gnathostome-specific duplication (but see section 3.4 below).

3.2 Evolution of prrx1 genes in teleost model species

Next, we analyzed the situation for prrx genes in Clupeocephala, the teleost order containing the major fish model species zebrafish, medaka, platyfish, and stickleback (Fig. 1). Two paralogs of prrx1, called prrx1a and prrx1b, are present in the genome of zebrafish (Hernandez-Vega and Minguillon, 2011), an ostariophysian teleost (Fig. 1). The genome of another ostariophysian, the Mexican tetra (Astyanax mexicanus), harbors prrx1a and prrx1b as well. In contrast, the genomes of the acanthomorph teleosts – medaka, platyfish (Xiphophorus maculatus), Nile tilapia (Oreochromis niloticus), threespine stickleback (Gasterosteus aculeatus), two pufferfishes (both Tetraodon nigroviridis and Takifugu rubripes), and Atlantic cod (Gadus morhua) – contain only a single prrx1 gene. Therefore, prrx1a and prrx1b may be either paralogs from an ostariophysian-specific gene duplication or older duplicates generated, for example during the TGD, with subsequent loss of one of the two genes in the lineage leading to acanthomorphs.

Conserved synteny data support the origin-in-TGD hypothesis: the prrx1 region on spotted gar LG10 shows double conserved synteny to zebrafish chromosomes Dre2 and Dre20, which contain the prrx1a and prrx1b genes, respectively (Fig. 3A). The conserved synteny block on Dre20 is relatively short because some LG10 co-orthlogs jump to Dre8 and Dre6. Nevertheless, the comparatively short stretch of conserved synteny between spotted gar LG10 and Dre20 is comprised of 20 (co-) orthologous genes in addition to prrx1. Furthermore, the prrx1 region in spotted gar LG10 shows double conserved synteny to medaka chromosome Ola4, containing the single prrx1 gene, and to Ola17, which does not harbor a prrx gene (Fig. 3B). Finally, the prrx1b region on Dre20 shows conserved synteny with Ola4 but also Ola24 (Suppl. Fig. 1A), while the prrx1a region on Dre2 shows extensive conserved synteny to Ola17 (Suppl. Fig. 1B). Dre2, Ola17 and Ola4 are all derived from the reconstructed ancestral pre-TGD protochromosome m (Kasahara et al., 2007; Nakatani et al., 2007). Thus, we conclude (i) that the zebrafish prrx1 co-orthologs were generated in the TGD; (ii) that in the zebrafish lineage, the chromosomal region surrounding the prrx1b gene was translocated to a different chromosome that became Dre20 after the TGD; and (iii) that the prrx1a co-ortholog was lost in the lineage leading to acanthomorphs, leaving this teleost group with only the prrx1b co-ortholog.

Fig. 3. Rayfin conserved synteny and phylogeny of Prrx genes.

Fig. 3

A, B) A dotplot analysis comparing the chromosomal neighborhood surrounding spotted gar prrx1 on LG10 shows double conserved synteny with chromosome segments containing prrx1 co-orthologs in zebrafish on Dre2 and Dre20 (A) and in medaka to prrx1b on Ola4 and to Ola17, which lacks a prrx1 gene. C) Nucleotide maximum likelihood phylogeny of vertebrate Prrx genes (GTR+I+G model, 50% bootstrap consensus) rooted on amphioxus prrx. Node values indicate % bootstrap support. Note that gene names were assigned taking conserved synteny and/or splicing information into account. Aal: allis1 shad; Aja: Japanese eel; Ame: Mexican tetra; Bfl: amphioxus; Cmi: elephant shark; Elu: Northern pike; Gac: stickleback; Gga: chicken; Gmo: cod; Hsa: human; Lca: Arctic lamprey; Lch: coelacanth; Loc: spotted gar; Mmu: mouse; Ola: medaka; Oni: tilapia; Pbu: butterflyfish; Phy: striped catfish; Xtr: frog.

When was the prrx1a gene lost during the course of teleost evolution? To answer this question, we surveyed the transcriptomes of several phylogenetically informative taxa (Fig. 1). Transcripts of both genes, prrx1a and prrx1b, were found for the striped catfish, another ostariophysian, for the allis shad, a clupeomorph, and for the Northern pike, an esociform that represents a sister lineage to acanthomorph teleosts (Near et al., 2012). These data would be expected if prrx1a was lost in an ancestor of acanthomorph teleosts.

3.3 Three prrx genes in basal teleosts and the problem of orthology

Until recently, historical relationships of the three major teleost lineages, Clupeocephala (including zebrafish, medaka, stickleback, and others), Osteoglossomorpha (bony tongues and mooneyes), and Elopomorpha (eels, tarpons, ladyfishes, bonefishes) were unclear. Fresh molecular phylogenetic analyses now place elopomorphs basally in the phylogeny (Fig. 1) as a sister group to the lineage of osteoglossomorphs and clupeocephalans, which together constitute the monophylum Osteoglossocephala (Betancur et al., 2013; Faircloth et al., 2013; Near et al., 2012). We were interested in the status of prrx genes in elopomorphs and osteoglossomorphs and therefore analyzed the genomes of two eel species, the European eel (Henkel et al., 2012a) and the Japanese eel (Henkel et al., 2012b); we also searched our transcriptomes from the European eel and the butterflyfish, an osteoglossomorph.

Surprisingly, and in contrast to clupeocephalans, we found a prrx2 gene for all three basally diverging teleosts. Therefore, prrx2 was still present in the pre-TGD teleost ancestor and after the TGD, one of the two prrx2 TGD duplicates was lost in all teleosts, but the other TGD duplicate of prrx2 was retained both in elopomorphs and in osteoglossomorphs, but was lost in an ancestor of the clupeocephalan lineage.

Similar to zebrafish, eels and butterflyfish both have two prrx1 genes. Thus, the lineages of the basally diverging elopomorphs and osteoglossomorphs contain three prrx genes, more than any other vertebrate so far investigated.

But which of the prrx1 co-orthlogs in eels and butterflyfish are orthologous to prrx1a or prrx1b in zebrafish? To answer this question, we generated multiple phylogenetic trees of vertebrate Prrx genes based both on nucleotide and protein sequences. A bootstrap consensus (50%) maximum likelihood phylogeny of the nucleotide phylogeny is shown in Fig. 3C, other trees appear in Suppl. Fig. 2.

Common to all inferred phylogenies is that Prrx1 genes are clearly separated from Prrx2. In the Prrx2 clade, coelacanth groups anomalously with rayfin fish rather than lobefins. In contrast to Prrx2, however, in the Prrx1 clade the vast majority of nodes are not well supported because the relatively short Prrx1 genes (738bp) and accordingly Prrx1 proteins (246 aa) lack phylogenetic signal. It is thus impossible to determine orthology of prrx1 duplicates within teleosts based on phylogenetic trees.

Using the draft genome assemblies of eel species, we were able to assign orthology of the eel genes based on conserved microsynteny for genes directly surrounding the prrx genes (Fig. 4). In Japanese eel, scaffold222 appears to be more conserved with the prrx1b neighborhood in clupeocephalans: 6/9 eel genes from scaffold222 contribute to conserved synteny with zebrafish chromosome Dre20 (including slc25a24, which is specific to the zebrafish prrx1b region) and stickleback chromosome GacVIII, compared to just 2/9 genes shared with the prrx1a neighborhoods on Dre2 and GacIII. The genomic region on Japanese eel scaffold1220 on the other hand is less decisive: 3/5 eel genes contribute to conserved synteny with both prrx1 paralogons in zebrafish, yet eel scaffold1220 contains ivns1ap, which is in the vicinity of the prrx1a paralogon on Dre2. Butterflyfish currently lacks a genome assembly, precluding a similar analysis for this osteoglossomorph.

Fig. 4. Genomic environments of vertebrate Prrx genes.

Fig. 4

Orthologous genes contributing to conserved synteny are similarly color-coded.

Alternative splicing patterns can provide phylogenetically informative characters independent of sequence similarities and the preservation of genome neighborhoods. In mammals, Prrx1 gene generates two major splice isoforms (Norris and Kern, 2001), hereafter called splisoform A and splisoform B. While Prrx1 splisoform A contains both the homeodomain and the C-terminal OAR protein domain similar to the single Prrx2 splisoform, the shorter Prrx1 splisoform B uses an alternative fourth exon lacking the OAR domain (Norris and Kern, 2001) (Fig. 5). Likewise, in the spotted gar transcriptome, two splice variants were present for prrx1, splisoform A and splisoform B', with B' meaning that, although this gene uses an alternative fourth exon, this exon is not conserved with the mammalian alternative fourth exon. The resulting protein in spotted gar lacks the OAR domain and thus appears to be functionally equivalent to the mammalian splisoform B, hence the name splisoform B'. In zebrafish (as well as other clupeocephalans teleosts, including acanthomorphs; Fig. 1), only prrx1b generates splisoform B'. The alternative fourth exon is gone from zebrafish prrx1a (Fig. 5). In the genomes of eels, representing elopomorph teleosts, and supported by the eel transcriptome, for one of the two prrx1 co-orthologs we also found evidence for the presence of the alternative fourth exon that characterizes splisoform B' in spotted gar and zebrafish. This eel co-ortholog (scaffold222 in Japanese eel) is thus annotated as prrx1b, which is consistent with our conserved synteny results (Figs. 4 and 5). In the transcriptome of the osteoglossomorph teleost butterflyfish, however, we did not find evidence for an isoform B' for either prrx1 gene; therefore, the orthology of butterflyfish prrx1 genes remains unresolved and so these genes were called prrx1x and prrx1y (Fig. 1) following nomenclature conventions for unclear phylogenetic relationships following genome duplications (Force et al., 2002).

Fig. 5. Splice variants of Prrx genes.

Fig. 5

Three domains characterize Prrx proteins: the prx domain, the homeodomain and the OAR domain. The OAR domain is missing from the amniote Prrx1 splisoform B as well as from the rayfin Prrx1 splisoform B' (spotted gar) and the teleost prrx1b gene due to the use of alternative fourth exons. Evidence of splisoform B' for Prrx1b was found here for clupeocephalan teleosts (i.e. zebrafish, acanthomorphs, etc.) and elopomorph teleosts, i.e., eels), but not for osteoglossormph teleosts (i.e., butterflyfish) (see also Fig. 1).

3.4 Origin of Prrx1 and Prrx2 in the early vertebrate genome duplications

We next analyzed the origin of gnathostome Prrx1 and Prrx2 genes. As we have seen, Arctic lamprey contains only a single prrx gene (see section 3.1) and phylogenetic trees tend to place lamprey prrx as outgroup to the gnathostome genes (Fig. 3C, Suppl. Fig. 2). The direct genomic environment of lamprey prrx, however, appears to be more similar to gnathostome Prrx1 than to Prrx2. Among the ten genes on lamprey scaffold416 surrounding prrx, three genes (kifap3, mettl11b, and pde4dip) are also found in the neighborhood of gnathostome Prrx1 genes, but none of the genes on scaffold416 provides conserved synteny with gnathostome Prrx2 (Fig. 4), a result that would be expected under the hypothesis that the duplication to produce Prrx1 and Prrx2 occurred before the divergence of gnathostomes and agnathans with the loss of Prrx2 in the lamprey lineage. In addition, sequence comparisons uncovered no evidence for an alternative fourth exon. From these data, it is thus difficult to conclude whether the duplication of Prrx genes occurred before or after the divergence of agnathans and gnathostomes.

As with the TGD, intragenomic patterns of conserved synteny can be informative to infer gene family history with regard to the vertebrate whole genome duplications (e.g. Braasch et al., 2009; Canestro et al., 2009; Lagman et al., 2013; Nakatani et al., 2007). We therefore used the Synteny Database (Catchen et al., 2009) to generate pairwise paralogous clusters and paralogy dotplots for spotted gar and human with amphioxus as outgroup (Fig. 6). Within spotted gar and human genomes, the two Prrx gene regions show extensive pairwise paralogy with each other (Fig. 6A, B), suggesting that the Prrx-containing paralogons were generated in a large-scale duplication event. Dotplots further provide evidence that the two Prrx paralogons found in spotted gar were indeed generated during the earlier rounds of vertebrate whole genome duplication: In spotted gar, the two prrx paralogons on LG10 and LG21 also show conserved synteny with LG2, LG6, and LG19 (Fig. 6C); in human, the two PRRX paralogons on Hsa1 and Hsa9 share additional conserved synteny with regions on Hsa6 and Hsa19 (Fig. 6D). Similar results were obtained for the chicken genome (data not shown). The paralogous regions evident in the human and chicken dotplots were previously shown to be derived from the inferred vertebrate ancestral protochromosome A (Nakatani et al., 2007). Thus we conclude that the gnathostome Prrx genes were generated as result of the early vertebrate genome duplications VGD1 and VGD2.

Fig. 6. Conserved synteny of Prrx paralogons after VGD1 and VGD2.

Fig. 6

Prrx genes in spotted gar (A) and human (B) are part of larger paralogons. Intragenomic paralogy dotplots in spotted gar (C) and human (D) show that additional paralogons are present in vertebrate genomes (i.e., Loc2, 6 and 19, and Hsa6 and 19) despite the absence of additional Prrx genes, as would be expected after two rounds of whole genome duplication followed by gene loss.

3.5 Expression of prrx ohnologs in spotted gar and teleosts

To gain insight into the expression of prrx genes in the spotted gar, we performed RNA whole mount in situ hybridization experiments on spotted gar embryos (Fig. 7A). Based on the prominent expression of Prrx1 and Prrx2 in the fore- and hindlimb buds of mouse and chicken (Beverdam and Meijlink, 2001; Kuratani et al., 1994; Lu et al., 1999; Nohno et al., 1993) and of prrx1 co-orthologs in pectoral fin buds of zebrafish (Hernandez-Vega and Minguillon, 2011), we selected two critical developmental stages for our analysis. At Long/Ballard stage 28-29 (5-6 days post fertilization), the pectoral fins are visible as low discs; at stage 32-33 (11-12 days post fertilization), pelvic fin buds become apparent for the first time (Long and Ballard, 2001). Indeed, we find that prrx1 and prrx2 are both expressed in the gar pectoral fins buds at stage 28-29. Furthermore, both genes are expressed in branchial arches and head structures at stage 28-29. At stage 32-33, prrx1 and prrx2 are both expressed in the pelvic fin buds while expression in pectoral fins is no longer detectable (Fig. 7A).

Fig. 7. Expression of prrx genes in rayfins.

Fig. 7

A) Expression of prrx genes during spotted gar development. RNA whole mount in situ hybridizations are shown for prrx1 to the left, prrx2 to the right. The upper row shows embryos at Long/Ballard stage (st.) 28-29 at left with a dorsal view of the gar embryo (heads to the left) and at the right a lateral view of the head and anterior trunk region. Both genes are expressed in the pectoral fin buds (fb), branchial arches (white asterisks) and head structures. The lower row shows embryos at stage 32-33. At the left, lateral views of the embryos are shown with a box insert highlighting the region around the pelvic fin bud (fb) that is shown in the magnification on the right. Both prrx genes are expressed in the pelvic find buds at this stage, while expression is no longer detectable in the pectorals. B) RNA-Seq based expression analysis of prrx genes in tissues of spotted gar, European eel, zebrafish, and medaka. Expression level is measured as reads per kb per million reads (rpkm).

Using our RNA-Seq data, we furthermore determined expression levels of pprx genes in adult tissues of spotted gar, European eel, zebrafish, and medaka (Fig. 7B). A general observation is that in all species, the level of prrx gene expression is higher in whole embryos than in any adult tissue. Furthermore, in the two species that have a prrx2 gene, spotted gar and European eel, the expression of prrx2 is lower than the expression of prrx1 (spotted gar) or both prrx1 co-orthologs combined (European eel).

In spotted gar, prrx1 is most prominently expressed in testis and bone, while prrx2 is barely expressed in these tissues. Gar prrx1 is also expressed in gills, heart, muscle and kidney, with prrx2 and prrx1 expression being equally high in the heart (Fig. 7B).

In eel, prrx1a is generally more highly expressed than prrx1b. While prrx1a is expressed in bone, testis, gills, brain, and muscle, prrx1b is only expressed in gills (Suppl. Fig. 3). Eel prrx2 expression is found mostly in the gills, in contrast to spotted gar prrx2 (Fig. 7B).

In zebrafish as in eel, prrx1a is more highly expressed than prrx1b. Zebrafish prrx1a is expressed in gills, muscle, brain, bone, testis, and kidney, and prrx1b is expressed in testis, gills, and muscle (Fig. 7B, Suppl. Fig.3). When comparing prrx1 co-ortholog expression between zebrafish and eel (Suppl. Fig. 3), we see that despite differences in absolute expression levels (which are generally higher in zebrafish), the ratio of expression of prrx1a vs. prrx1b is similar in both species.

In medaka, prrx1b is expressed in bone, muscle, and gills and thereby, curiously, more closely resembles the expression of prrx1a in zebrafish and eel than the expression of prrx1b in these species (Fig. 7B).

4. Discussion

4.1 Evolution of vertebrate Prrx genes by three rounds of genome duplication

The analyses presented here provide evidence to support a model for the evolution of the Prrx gene family in vertebrates through three rounds of whole genome duplication (VGD1, VGD2, TGD) (Fig. 8). The two vertebrate genome duplications led to the amplification of many gene families in vertebrates, generating for example the four vertebrate Hox clusters (reviewed in (Canestro, 2012)). In the case of the prrx genes, gnathostomes retained only two of the theoretically four VGD ohnologs. This result could be explained by the hypothesis that one of the two VGD1-paralogs was lost before VGD2 so that only a single Prrx gene was available for duplication in the VGD2 event. The genomic location of the two PRRX genes in human and chicken relative to the reconstruction of vertebrate karyotype evolution by Nakatani et al. (2007), however, is inconsistent with this hypothesis. The PRRX paralogons in human and chicken genomes are located in chromosomal blocks A2 (PRRX1) and A0 (PRRX2), which are connected by VGD1, not VGD2 (Nakatani et al., 2007). Thus, it appears that after duplication of the ancestral chromosome A during VGD1 and VGD2 four Prrx ohnologs were initially present but the VGD2 ohnologs of the two extant Prrx genes were lost independently after VGD2 (Fig. 8). The presence of a single prrx gene in lamprey, whose lineage most likely diverged from gnathostomes after VGD2 (Smith et al., 2013), neither supports nor refutes this model. The phylogenetic position of the lamprey prrx gene remains unresolved, a common problem when inferring gene family histories among the two major, early diverging vertebrate lineages, agnathans and gnathostomes (Kuraku, 2013).

Fig. 8. Model for the evolution of vertebrate Prrx genes.

Fig. 8

The Prrx gene family evolved through three rounds of whole genome duplication [vertebrate genome duplications 1 and 2 (VGD1/VGD2), and the teleost genome duplication (TGD)] followed by several instances of gene loss in multiple lineages (OGM: ohnolog gone missing).

The common ancestor of bony vertebrates (euteleostomes) still contained both Prrx genes because we find both genes in many lobefins as well as in spotted gar among rayfins. Our analysis of teleost transcriptomes further shows that prrx2 is not an ohnolog gone missing in all teleosts, but that it was lost in the lineage leading to clupeocephalan teleosts, and was retained in the two other major teleost lineages, elopomorphs and osteoglossomorphs. Following the TGD, prrx1 was still present in two copies in the ancestors of the elopomorph, osteoglossomorph, and clupeocephalan lineages. Within clupeocephalans, the prrx1a gene was later lost in the lineage leading to acanthomorphs. Because of the rapid succession of the TGD and the diversification of the three major teleost lineages (elopomorphs, osteoglossomorphs, and clupeocephalans), phylogenetic reconstructions can fail in clearly inferring orthology of TGD duplicates among the three teleost lineages (Kuraku, 2013), particularly in situations with low phylogenetic signal like the one described here for prrx genes. Therefore, other measures, such as conserved synteny and splicing patterns, become essential to determine orthology as successfully applied here for clupeocephalan and eel prrx1 genes.

Our analysis of Prrx gene family history shows that none of the teleost model species resembles the situation of PRRX genes in human. The makeup of the prrx gene family in neither zebrafish nor medaka is representative of teleosts in general, and ironically, despite the TGD, the prrx gene repertoire is most reduced among bony vertebrates in acanthomorphs, including model species like medaka and platyfish. The basal teleost lineages, in contrast, have the most expanded prrx gene repertoire of all vertebrates analyzed so far. Among investigated rayfins, the spotted gar is the only one that is the same as human with regard to its prrx gene repertoire.

This census of rayfin prrx genes illustrates that the choice of model species for the study of gene functions can be rather random at the level of the specific gene family and that the specifics of the gene regulatory network components in the teleost model under investigation should be taken into account when generalizing to teleosts and translating the knowledge to the human situation.

4.2 Implications of gene family history for gene function evolution and modeling human conditions

Prrx genes are most prominently known for their function during the development of limbs and craniofacial structures (ten Berge et al., 1998). Our in situ hybridization analysis during spotted gar development shows for the first time that the overlapping expression of Prrx1 and Prrx2 genes in paired appendages and branchial arches is not restricted to tetrapods, but is most likely derived from a gene regulatory program that predates the divergence of bony vertebrates. Besides reports on the expression of prrx1 in the branchial arches in shark (Compagnucci et al., 2013), expression data are currently lacking for species basal to bony vertebrates, but will be required to gain more insight into the evolutionary origin of vertebrate Prrx gene expression patterns.

Following the parsimony principle, the similarity in expression of bony vertebrate Prrx1 and Prrx2 suggests that their common single precursor gene potentially already had cis-regulatory elements enabling expression in branchial arches and paired appendages that both daughter genes then retained after the duplication. Genomic evidence shows that the VGD1 event initially generated Prrx1 and Prrx2 (Fig. 8), an event that predates the divergence of gnathostome and agnathan vertebrates (Smith et al., 2013). These arguments lead to the paradoxical situation that the paired appendage expression domain evolved before the evolution of paired appendages in gnathostomes (Tulenko et al., 2013)! This conclusion is reminiscent of the situation for Tbx5 and Tbx4, which are expressed in gnathostomes in anterior and posterior paired appendages, respectively, suggesting that their expression program is derived from the common Tbx4/5 precursor gene, and yet the duplication that generated these paralogs presumably predates the origin of paired appendages itself (Horton et al., 2008; Minguillon et al., 2009; Tanaka et al., 2002). Considering both gene families (Prrx and Tbx4/5), we conclude that the evolution of paired appendages may involve the exaptation of preexisting regulatory elements driving the expression of limb-specific genes in paired mesodermal domains.

The present study furthermore shows that the spotted gar will be very useful to functionally model the role of prrx1 and prrx2 in the ancestor of tetrapods before the fin-to-limb transition. Lobefin fish, i.e. coelacanths and lungfishes, are not suitable for functional and/or genetic studies, while teleost model species are variants as proxies due to the loss of prrx2 and the independent duplication of prrx1 during the TGD.

The expression of the two prrx1 co-orthologs during zebrafish development largely overlaps in pectoral fin buds, head mesenchyme, and branchial arches (Hernandez-Vega and Minguillon, 2011) and matches similar expression of the single prrx1 gene in spotted gar embryos (Fig. 7A). The expression of prrx1 in embryonic and adult spotted gar, in comparison to zebrafish and eel prrx1 co-orthologs, does not clearly indicate of sub- and/or neofunctionalization after the TGD. Generally, in both zebrafish and eel, prrx1a is the more highly expressed TGD co-ortholog, and thus presumably already was more highly expressed than prrx1b in the last common ancestor of elopomorphs and clupeocephalans. Surprisingly, however, within clupeocephalans, prrx1a, the highly expressed gene, rather than prrx1b, the lower expressed gene, was lost in acanthomorphs. The expression of the remaining prrx1b in the medaka resembles more that of zebrafish prrx1a than prrx1b (Fig.7B), suggesting divergent evolution of prrx1 duplicate expression in acanthomorphs (e.g., medaka) vs. ostariophysians (e.g., zebrafish) (see Fig. 1). Expression data from more acanthomorph species are necessary to test this hypothesis. We suggest, however, that prrx1a was more prone to gene loss than prrx1b despite its presumable higher and broader expression because it had lost its ability to generate splisoform B' soon after the TGD.

Our RNA-Seq analysis of adult rayfin tissues revealed that prrx genes are predominantly expressed in bone, gills, heart, muscle, brain, and testis. Prrx genes are expressed in bone, heart, and muscle in human and mouse as well (Leussink et al., 1995; Norris et al., 2000), suggesting similar functions in rayfins and mammals. Prrx1 has been recently shown to be important for the maintenance of adult neural stem cells in mammals (Shimozaki et al., 2013). Zebrafish is becoming an important model organism for adult neurogenesis in vertebrates (see e.g. (Grandel et al., 2006)) and our expression data suggest that prrx1a is a primary candidate to test for similar functions in teleosts. In medaka, in contrast, we did not find expression of its only remaining gene, prrx1b, in the adult brain (Fig. 7B), suggesting that zebrafish, rather than medaka, would be a better model for adult neurogenic functions of PRRX1 in human.

Interestingly, testis had the highest expression of prrx1 among adult tissues in spotted gar, and testis expression of prrx1a as well as of prrx1a and prrx1b was also found in eel and zebrafish, respectively. To the best of our knowledge, Prrx1 has not been studied in the context of testis development and testis function and it will be interesting to analyze if this is a rayfin-specific function or shared with other vertebrates.

5. Conclusions

The present study illustrates, based on the example of Prrx genes, the diversity of developmental genetic toolbox components among vertebrates in general and within teleost fishes in particular. These differences are the results of lineage-specific gene family expansions by genome duplications and multiple subsequent gene loss events. We also uncovered significant differences in the prrx gene repertoires among teleost model and non-model species and learned that no single species represents teleosts in general, emphasizing the need to study several different teleost models. Our study highlights the suitability of spotted gar to infer gene family histories in vertebrates. The spotted gar lends itself as the best possible model for the situation of the Prrx gene family before the fin-to-limb transition and to study the function of prrx2 in a fish. Further studies of other non-teleost rayfins (e.g., bowfin, sturgeons, bichirs) will complement our analysis in spotted gar to understand the functional role of prrx genes in lineages basal to the TGD. Future biomedical studies concerned with Prrx genes in teleost model species need to take into account differences with respect to the human gene family. The currently rapid progress in fish genomics illuminates the ‘genomic black boxes’ of teleosts and enables us to make better predictions about which particular fish model to use for modeling specific human gene functions, thereby improving the interpretation and translation of insights from fish models to human disease states.

Supplementary Material

01
02
03
04

Acknowledgments

We would like to thank the BROAD Institute for generating the spotted gar genome assembly, MGX-Montpellier GenomiX for performing RNA-seq, INRA-Sigenae for generating de novo cDNA assemblies, Yi-Lin Yan for advice on spotted gar in situ hybridizations, Julian Catchen for help with integrating the spotted gar into the Synteny Database, and the Postlethwait lab, Julia Ganz, and Dylan Farnsworth for stimulating discussions. This work was supported by NIH grant R01 RR020833 (R01 OD011116) to JHP and by French National Research Agency grant PHYLOFISH (ANR-10-GENM-017) to JB.

Footnotes

Footnote: This paper is based on a presentation given at the 6th Aquatic Annual Models of Human Disease Conference, hosted by the University of Wisconsin - Milwaukee (June 30 -July 3, 2013)

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Contributor Information

Ingo Braasch, Email: ibraasch@uoneuro.uoregon.edu.

Yann Guiguen, Email: yann.guiguen@rennes.inra.fr.

Ryan Loker, Email: loker@uoregon.edu.

John H. Letaw, Email: letaw@ohsu.edu.

Allyse Ferrara, Email: allyse.ferrara@nicholls.edu.

Julien Bobe, Email: Julien.Bobe@rennes.inra.fr.

John H. Postlethwait, Email: jpostle@uoneuro.uoregon.edu.

References

  1. Abascal F, Zardoya R, Posada D. ProtTest: selection of best-fit models of protein evolution. Bioinformatics. 2005;21:2104–2105. doi: 10.1093/bioinformatics/bti263. [DOI] [PubMed] [Google Scholar]
  2. Amemiya CT, Alfoldi J, Lee AP, Fan S, Philippe H, Maccallum I, Braasch I, Manousaki T, Schneider I, Rohner N, Organ C, Chalopin D, Smith JJ, Robinson M, Dorrington RA, Gerdol M, Aken B, Biscotti MA, Barucca M, Baurain D, Berlin AM, Blatch GL, Buonocore F, Burmester T, Campbell MS, Canapa A, Cannon JP, Christoffels A, De Moro G, Edkins AL, Fan L, Fausto AM, Feiner N, Forconi M, Gamieldien J, Gnerre S, Gnirke A, Goldstone JV, Haerty W, Hahn ME, Hesse U, Hoffmann S, Johnson J, Karchner SI, Kuraku S, Lara M, Levin JZ, Litman GW, Mauceli E, Miyake T, Mueller MG, Nelson DR, Nitsche A, Olmo E, Ota T, Pallavicini A, Panji S, Picone B, Ponting CP, Prohaska SJ, Przybylski D, Saha NR, Ravi V, Ribeiro FJ, Sauka-Spengler T, Scapigliati G, Searle SM, Sharpe T, Simakov O, Stadler PF, Stegeman JJ, Sumiyama K, Tabbaa D, Tafer H, Turner-Maier J, van Heusden P, White S, Williams L, Yandell M, Brinkmann H, Volff JN, Tabin CJ, Shubin N, Schartl M, Jaffe DB, Postlethwait JH, Venkatesh B, Di Palma F, Lander ES, Meyer A, Lindblad-Toh K. The African coelacanth genome provides insights into tetrapod evolution. Nature. 2013;496:311–316. doi: 10.1038/nature12027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Amores A, Catchen J, Ferrara A, Fontenot Q, Postlethwait JH. Genome evolution and meiotic maps by massively parallel DNA sequencing: spotted gar, an outgroup for the teleost genome duplication. Genetics. 2011;188:799–808. doi: 10.1534/genetics.111.127324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Aparicio S, Chapman J, Stupka E, Putnam N, Chia JM, Dehal P, Christoffels A, Rash S, Hoon S, Smit A, Gelpke MD, Roach J, Oh T, Ho IY, Wong M, Detter C, Verhoef F, Predki P, Tay A, Lucas S, Richardson P, Smith SF, Clark MS, Edwards YJ, Doggett N, Zharkikh A, Tavtigian SV, Pruss D, Barnstead M, Evans C, Baden H, Powell J, Glusman G, Rowen L, Hood L, Tan YH, Elgar G, Hawkins T, Venkatesh B, Rokhsar D, Brenner S. Whole-genome shotgun assembly and analysis of the genome of Fugu rubripes. Science. 2002;297:1301–1310. doi: 10.1126/science.1072104. [DOI] [PubMed] [Google Scholar]
  5. Bergwerff M, Gittenberger-de Groot AC, Wisse LJ, DeRuiter MC, Wessels A, Martin JF, Olson EN, Kern MJ. Loss of function of the Prx1 and Prx2 homeobox genes alters architecture of the great elastic arteries and ductus arteriosus. Virchows Arch. 2000;436:12–19. doi: 10.1007/pl00008193. [DOI] [PubMed] [Google Scholar]
  6. Betancur RR, Broughton RE, Wiley EO, Carpenter K, Lopez JA, Li C, Holcroft NI, Arcila D, Sanciangco M, Cureton Ii JC, Zhang F, Buser T, Campbell MA, Ballesteros JA, Roa-Varon A, Willis S, Borden WC, Rowley T, Reneau PC, Hough DJ, Lu G, Grande T, Arratia G, Orti G. The tree of life and a new classification of bony fishes. PLoS Curr. 2013;5 doi: 10.1371/currents.tol.53ba26640df0ccaee75bb165c8c26288. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Beverdam A, Meijlink F. Expression patterns of group-I aristaless-related genes during craniofacial and limb development. Mech Dev. 2001;107:163–167. doi: 10.1016/s0925-4773(01)00450-6. [DOI] [PubMed] [Google Scholar]
  8. Braasch I, Postlethwait JH. Polyploidy in Fish and the Teleost Genome Duplication. In: Soltis PS, Soltis DE, editors. Polyploidy and Genome Evolution. Springer; Berlin Heidelberg: 2012. pp. 341–383. [Google Scholar]
  9. Braasch I, Volff JN, Schartl M. The endothelin system: evolution of vertebrate-specific ligandreceptor interactions by three rounds of genome duplication. Mol Biol Evol. 2009;26:783–799. doi: 10.1093/molbev/msp015. [DOI] [PubMed] [Google Scholar]
  10. Canestro C. Two round of Whole-Genome Duplication: Evidence and impact on the evoluion of vertebrate innovations. In: Soltis PS, Soltis DE, editors. Polyploidy and Genome Evolution. Springer; Berlin Heidelberg: 2012. pp. 309–339. [Google Scholar]
  11. Canestro C, Catchen JM, Rodriguez-Mari A, Yokoi H, Postlethwait JH. Consequences of lineage-specific gene loss on functional evolution of surviving paralogs: ALDH1A and retinoic acid signaling in vertebrate genomes. PLoS Genet. 2009;5:e1000496. doi: 10.1371/journal.pgen.1000496. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Catchen JM, Conery JS, Postlethwait JH. Automated identification of conserved synteny after whole-genome duplication. Genome Res. 2009;19:1497–1505. doi: 10.1101/gr.090480.108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Compagnucci C, Debiais-Thibaud M, Coolen M, Fish J, Griffin JN, Bertocchini F, Minoux M, Rijli FM, Borday-Birraux V, Casane D, Mazan S, Depew MJ. Pattern and polarity in the development and evolution of the gnathostome jaw: both conservation and heterotopy in the branchial arches of the shark, Scyliorhinus canicula. Dev Biol. 2013;377:428–448. doi: 10.1016/j.ydbio.2013.02.022. [DOI] [PubMed] [Google Scholar]
  14. Crow KD, Smith CD, Cheng JF, Wagner GP, Amemiya CT. An independent genome duplication inferred from Hox paralogs in the American paddlefish--a representative basal ray-finned fish and important comparative reference. Genome Biol Evol. 2012;4:937–953. doi: 10.1093/gbe/evs067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Cserjesi P, Lilly B, Bryson L, Wang Y, Sassoon DA, Olson EN. MHox: a mesodermally restricted homeodomain protein that binds an essential site in the muscle creatine kinase enhancer. Development. 1992;115:1087–1101. doi: 10.1242/dev.115.4.1087. [DOI] [PubMed] [Google Scholar]
  16. Darriba D, Taboada GL, Doallo R, Posada D. jModelTest 2: more models, new heuristics and parallel computing. Nat Methods. 2012;9:772. doi: 10.1038/nmeth.2109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Dehal P, Boore JL. Two rounds of whole genome duplication in the ancestral vertebrate. PLoS Biol. 2005;3:e314. doi: 10.1371/journal.pbio.0030314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004;32:1792–1797. doi: 10.1093/nar/gkh340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Faircloth BC, Sorenson L, Santini F, Alfaro ME. A Phylogenomic Perspective on the Radiation of Ray-Finned Fishes Based upon Targeted Sequencing of Ultraconserved Elements (UCEs) PLoS One. 2013;8:e65923. doi: 10.1371/journal.pone.0065923. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Force A, Amores A, Postlethwait JH. Hox cluster organization in the jawless vertebrate Petromyzon marinus. J Exp Zool. 2002;294:30–46. doi: 10.1002/jez.10091. [DOI] [PubMed] [Google Scholar]
  21. Force A, Lynch M, Pickett FB, Amores A, Yan YL, Postlethwait J. Preservation of duplicate genes by complementary, degenerative mutations. Genetics. 1999;151:1531–1545. doi: 10.1093/genetics/151.4.1531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Frankenberg S, Renfree MB. On the origin of POU5F1. BMC Biol. 2013;11:56. doi: 10.1186/1741-7007-11-56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Goecks J, Nekrutenko A, Taylor J. Galaxy: a comprehensive approach for supporting accessible, reproducible, and transparent computational research in the life sciences. Genome Biol. 2010;11:R86. doi: 10.1186/gb-2010-11-8-r86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Grandel H, Kaslin J, Ganz J, Wenzel I, Brand M. Neural stem cells and neurogenesis in the adult zebrafish brain: origin, proliferation dynamics, migration and cell fate. Dev Biol. 2006;295:263–277. doi: 10.1016/j.ydbio.2006.03.040. [DOI] [PubMed] [Google Scholar]
  25. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst Biol. 2010;59:307–321. doi: 10.1093/sysbio/syq010. [DOI] [PubMed] [Google Scholar]
  26. Hedges SB, Dudley J, Kumar S. TimeTree: a public knowledge-base of divergence times among organisms. Bioinformatics. 2006;22:2971–2972. doi: 10.1093/bioinformatics/btl505. [DOI] [PubMed] [Google Scholar]
  27. Henkel CV, Burgerhout E, de Wijze DL, Dirks RP, Minegishi Y, Jansen HJ, Spaink HP, Dufour S, Weltzien FA, Tsukamoto K, van den Thillart GE. Primitive duplicate Hox clusters in the European eel's genome. PLoS One. 2012a;7:e32231. doi: 10.1371/journal.pone.0032231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Henkel CV, Dirks RP, de Wijze DL, Minegishi Y, Aoyama J, Jansen HJ, Turner B, Knudsen B, Bundgaard M, Hvam KL, Boetzer M, Pirovano W, Weltzien FA, Dufour S, Tsukamoto K, Spaink HP, van den Thillart GE. First draft genome sequence of the Japanese eel, Anguilla japonica. Gene. 2012b;511:195–201. doi: 10.1016/j.gene.2012.09.064. [DOI] [PubMed] [Google Scholar]
  29. Hernandez-Vega A, Minguillon C. The Prx1 limb enhancers: targeted gene expression in developing zebrafish pectoral fins. Dev Dyn. 2011;240:1977–1988. doi: 10.1002/dvdy.22678. [DOI] [PubMed] [Google Scholar]
  30. Horton AC, Mahadevan NR, Minguillon C, Osoegawa K, Rokhsar DS, Ruvinsky I, de Jong PJ, Logan MP, Gibson-Brown JJ. Conservation of linkage and evolution of developmental function within the Tbx2/3/4/5 subfamily of T-box genes: implications for the origin of vertebrate limbs. Dev Genes Evol. 2008;218:613–628. doi: 10.1007/s00427-008-0249-5. [DOI] [PubMed] [Google Scholar]
  31. Howe K, Clark MD, Torroja CF, Torrance J, Berthelot C, Muffato M, Collins JE, Humphray S, McLaren K, Matthews L, McLaren S, Sealy I, Caccamo M, Churcher C, Scott C, Barrett JC, Koch R, Rauch GJ, White S, Chow W, Kilian B, Quintais LT, Guerra-Assuncao JA, Zhou Y, Gu Y, Yen J, Vogel JH, Eyre T, Redmond S, Banerjee R, Chi J, Fu B, Langley E, Maguire SF, Laird GK, Lloyd D, Kenyon E, Donaldson S, Sehra H, Almeida-King J, Loveland J, Trevanion S, Jones M, Quail M, Willey D, Hunt A, Burton J, Sims S, McLay K, Plumb B, Davis J, Clee C, Oliver K, Clark R, Riddle C, Eliott D, Threadgold G, Harden G, Ware D, Mortimer B, Kerry G, Heath P, Phillimore B, Tracey A, Corby N, Dunn M, Johnson C, Wood J, Clark S, Pelan S, Griffiths G, Smith M, Glithero R, Howden P, Barker N, Stevens C, Harley J, Holt K, Panagiotidis G, Lovell J, Beasley H, Henderson C, Gordon D, Auger K, Wright D, Collins J, Raisen C, Dyer L, Leung K, Robertson L, Ambridge K, Leongamornlert D, McGuire S, Gilderthorp R, Griffiths C, Manthravadi D, Nichol S, Barker G, Whitehead S, Kay M, Brown J, Murnane C, Gray E, Humphries M, Sycamore N, Barker D, Saunders D, Wallis J, Babbage A, Hammond S, Mashreghi-Mohammadi M, Barr L, Martin S, Wray P, Ellington A, Matthews N, Ellwood M, Woodmansey R, Clark G, Cooper J, Tromans A, Grafham D, Skuce C, Pandian R, Andrews R, Harrison E, Kimberley A, Garnett J, Fosker N, Hall R, Garner P, Kelly D, Bird C, Palmer S, Gehring I, Berger A, Dooley CM, Ersan-Urun Z, Eser C, Geiger H, Geisler M, Karotki L, Kirn A, Konantz J, Konantz M, Oberlander M, Rudolph-Geiger S, Teucke M, Osoegawa K, Zhu B, Rapp A, Widaa S, Langford C, Yang F, Carter NP, Harrow J, Ning Z, Herrero J, Searle SM, Enright A, Geisler R, Plasterk RH, Lee C, Westerfield M, de Jong PJ, Zon LI, Postlethwait JH, Nusslein-Volhard C, Hubbard TJ, Roest Crollius H, Rogers J, Stemple DL. The zebrafish reference genome sequence and its relationship to the human genome. Nature. 2013;496:498–503. doi: 10.1038/nature12111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Jaillon O, Aury JM, Brunet F, Petit JL, Stange-Thomann N, Mauceli E, Bouneau L, Fischer C, Ozouf-Costaz C, Bernot A, Nicaud S, Jaffe D, Fisher S, Lutfalla G, Dossat C, Segurens B, Dasilva C, Salanoubat M, Levy M, Boudet N, Castellano S, Anthouard V, Jubin C, Castelli V, Katinka M, Vacherie B, Biemont C, Skalli Z, Cattolico L, Poulain J, De Berardinis V, Cruaud C, Duprat S, Brottier P, Coutanceau JP, Gouzy J, Parra G, Lardier G, Chapple C, McKernan KJ, McEwan P, Bosak S, Kellis M, Volff JN, Guigo R, Zody MC, Mesirov J, Lindblad-Toh K, Birren B, Nusbaum C, Kahn D, Robinson-Rechavi M, Laudet V, Schachter V, Quetier F, Saurin W, Scarpelli C, Wincker P, Lander ES, Weissenbach J, Roest Crollius H. Genome duplication in the teleost fish Tetraodon nigroviridis reveals the early vertebrate proto-karyotype. Nature. 2004;431:946–957. doi: 10.1038/nature03025. [DOI] [PubMed] [Google Scholar]
  33. Jones FC, Grabherr MG, Chan YF, Russell P, Mauceli E, Johnson J, Swofford R, Pirun M, Zody MC, White S, Birney E, Searle S, Schmutz J, Grimwood J, Dickson MC, Myers RM, Miller CT, Summers BR, Knecht AK, Brady SD, Zhang H, Pollen AA, Howes T, Amemiya C, Baldwin J, Bloom T, Jaffe DB, Nicol R, Wilkinson J, Lander ES, Di Palma F, Lindblad-Toh K, Kingsley DM. The genomic basis of adaptive evolution in threespine sticklebacks. Nature. 2012;484:55–61. doi: 10.1038/nature10944. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Jowett T, Yan YL. Double fluorescent in situ hybridization to zebrafish embryos. Trends Genet. 1996;12:387–389. doi: 10.1016/s0168-9525(96)90091-8. [DOI] [PubMed] [Google Scholar]
  35. Kasahara M, Naruse K, Sasaki S, Nakatani Y, Qu W, Ahsan B, Yamada T, Nagayasu Y, Doi K, Kasai Y, Jindo T, Kobayashi D, Shimada A, Toyoda A, Kuroki Y, Fujiyama A, Sasaki T, Shimizu A, Asakawa S, Shimizu N, Hashimoto S, Yang J, Lee Y, Matsushima K, Sugano S, Sakaizumi M, Narita T, Ohishi K, Haga S, Ohta F, Nomoto H, Nogata K, Morishita T, Endo T, Shin IT, Takeda H, Morishita S, Kohara Y. The medaka draft genome and insights into vertebrate genome evolution. Nature. 2007;447:714–719. doi: 10.1038/nature05846. [DOI] [PubMed] [Google Scholar]
  36. Kern MJ, Witte DP, Valerius MT, Aronow BJ, Potter SS. A novel murine homeobox gene isolated by a tissue specific PCR cloning strategy. Nucleic Acids Res. 1992;20:5189–5195. doi: 10.1093/nar/20.19.5189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Kuraku S. Impact of asymmetric gene repertoire between cyclostomes and gnathostomes. Semin Cell Dev Biol. 2013;24:119–127. doi: 10.1016/j.semcdb.2012.12.009. [DOI] [PubMed] [Google Scholar]
  38. Kuratani S, Martin JF, Wawersik S, Lilly B, Eichele G, Olson EN. The expression pattern of the chick homeobox gene gMHox suggests a role in patterning of the limbs and face and in compartmentalization of somites. Dev Biol. 1994;161:357–369. doi: 10.1006/dbio.1994.1037. [DOI] [PubMed] [Google Scholar]
  39. Lagman D, Ocampo Daza D, Widmark J, Abalo XM, Sundstrom G, Larhammar D. The vertebrate ancestral repertoire of visual opsins, transducin alpha subunits and oxytocin/vasopressin receptors was established by duplication of their shared genomic region in the two rounds of early vertebrate genome duplications. BMC Evol Biol. 2013;13:238. doi: 10.1186/1471-2148-13-238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Leussink B, Brouwer A, el Khattabi M, Poelmann RE, Gittenberger-de Groot AC, Meijlink F. Expression patterns of the paired-related homeobox genes MHox/Prx1 and S8/Prx2 suggest roles in development of the heart and the forebrain. Mech Dev. 1995;52:51–64. doi: 10.1016/0925-4773(95)00389-i. [DOI] [PubMed] [Google Scholar]
  41. Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 2009;25:1754–1760. doi: 10.1093/bioinformatics/btp324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 2009;25:2078–2079. doi: 10.1093/bioinformatics/btp352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Long WL, Ballard WW. Normal embryonic stages of the longnose gar, Lepisosteus osseus. BMC Dev Biol. 2001;1:6. doi: 10.1186/1471-213X-1-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Lu MF, Cheng HT, Lacy AR, Kern MJ, Argao EA, Potter SS, Olson EN, Martin JF. Paired-related homeobox genes cooperate in handplate and hindlimb zeugopod morphogenesis. Dev Biol. 1999;205:145–157. doi: 10.1006/dbio.1998.9116. [DOI] [PubMed] [Google Scholar]
  45. Martin JF, Bradley A, Olson EN. The paired-like homeo box gene MHox is required for early events of skeletogenesis in multiple lineages. Genes Dev. 1995;9:1237–1249. doi: 10.1101/gad.9.10.1237. [DOI] [PubMed] [Google Scholar]
  46. Mehta TK, Ravi V, Yamasaki S, Lee AP, Lian MM, Tay BH, Tohari S, Yanai S, Tay A, Brenner S, Venkatesh B. Evidence for at least six Hox clusters in the Japanese lamprey (Lethenteron japonicum) Proc Natl Acad Sci U S A. 2013;110:16044–16049. doi: 10.1073/pnas.1315760110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Minguillon C, Gibson-Brown JJ, Logan MP. Tbx4/5 gene duplication and the origin of vertebrate paired appendages. Proc Natl Acad Sci U S A. 2009;106:21726–21730. doi: 10.1073/pnas.0910153106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Nakatani Y, Takeda H, Kohara Y, Morishita S. Reconstruction of the vertebrate ancestral genome reveals dynamic genome reorganization in early vertebrates. Genome Res. 2007;17:1254–1265. doi: 10.1101/gr.6316407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Near TJ, Eytan RI, Dornburg A, Kuhn KL, Moore JA, Davis MP, Wainwright PC, Friedman M, Smith WL. Resolution of ray-finned fish phylogeny and timing of diversification. Proc Natl Acad Sci U S A. 2012;109:13698–13703. doi: 10.1073/pnas.1206625109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Nohno T, Koyama E, Myokai F, Taniguchi S, Ohuchi H, Saito T, Noji S. A chicken homeobox gene related to Drosophila paired is predominantly expressed in the developing limb. Dev Biol. 1993;158:254–264. doi: 10.1006/dbio.1993.1184. [DOI] [PubMed] [Google Scholar]
  51. Norris RA, Kern MJ. The identification of Prx1 transcription regulatory domains provides a mechanism for unequal compensation by the Prx1 and Prx2 loci. J Biol Chem. 2001;276:26829–26837. doi: 10.1074/jbc.M100239200. [DOI] [PubMed] [Google Scholar]
  52. Norris RA, Scott KK, Moore CS, Stetten G, Brown CR, Jabs EW, Wulfsberg EA, Yu J, Kern MJ. Human PRRX1 and PRRX2 genes: cloning, expression, genomic localization, and exclusion as disease genes for Nager syndrome. Mamm Genome. 2000;11:1000–1005. doi: 10.1007/s003350010193. [DOI] [PubMed] [Google Scholar]
  53. Ocana OH, Corcoles R, Fabra A, Moreno-Bueno G, Acloque H, Vega S, Barrallo-Gimeno A, Cano A, Nieto MA. Metastatic colonization requires the repression of the epithelial-mesenchymal transition inducer Prrx1. Cancer Cell. 2012;22:709–724. doi: 10.1016/j.ccr.2012.10.012. [DOI] [PubMed] [Google Scholar]
  54. Opstelten DJ, Vogels R, Robert B, Kalkhoven E, Zwartkruis F, de Laaf L, Destree OH, Deschamps J, Lawson KA, Meijlink F. The mouse homeobox gene, S8, is expressed during embryogenesis predominantly in mesenchyme. Mech Dev. 1991;34:29–41. doi: 10.1016/0925-4773(91)90089-o. [DOI] [PubMed] [Google Scholar]
  55. Postlethwait J, Amores A, Cresko W, Singer A, Yan YL. Subfunction partitioning, the teleost radiation and the annotation of the human genome. Trends Genet. 2004;20:481–490. doi: 10.1016/j.tig.2004.08.001. [DOI] [PubMed] [Google Scholar]
  56. Postlethwait JH. The zebrafish genome in context: ohnologs gone missing. J Exp Zool B Mol Dev Evol. 2007;308:563–577. doi: 10.1002/jez.b.21137. [DOI] [PubMed] [Google Scholar]
  57. Putnam NH, Butts T, Ferrier DE, Furlong RF, Hellsten U, Kawashima T, Robinson-Rechavi M, Shoguchi E, Terry A, Yu JK, Benito-Gutierrez EL, Dubchak I, Garcia-Fernandez J, Gibson-Brown JJ, Grigoriev IV, Horton AC, de Jong PJ, Jurka J, Kapitonov VV, Kohara Y, Kuroki Y, Lindquist E, Lucas S, Osoegawa K, Pennacchio LA, Salamov AA, Satou Y, Sauka-Spengler T, Schmutz J, Shin IT, Toyoda A, Bronner-Fraser M, Fujiyama A, Holland LZ, Holland PW, Satoh N, Rokhsar DS. The amphioxus genome and the evolution of the chordate karyotype. Nature. 2008;453:1064–1071. doi: 10.1038/nature06967. [DOI] [PubMed] [Google Scholar]
  58. Raincrow JD, Dewar K, Stocsits C, Prohaska SJ, Amemiya CT, Stadler PF, Chiu CH. Hox clusters of the bichir (Actinopterygii, Polypterus senegalus) highlight unique patterns of sequence evolution in gnathostome phylogeny. J Exp Zool B Mol Dev Evol. 2011;316:451–464. doi: 10.1002/jez.b.21420. [DOI] [PubMed] [Google Scholar]
  59. Reichert M, Takano S, von Burstin J, Kim SB, Lee JS, Ihida-Stansbury K, Hahn C, Heeg S, Schneider G, Rhim AD, Stanger BZ, Rustgi AK. The Prrx1 homeodomain transcription factor plays a central role in pancreatic regeneration and carcinogenesis. Genes Dev. 2013;27:288–300. doi: 10.1101/gad.204453.112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Schartl M. Beyond the zebrafish: diverse fish species for modeling human disease. Dis Model Mech. 2013 doi: 10.1242/dmm.012245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Schulz MH, Zerbino DR, Vingron M, Birney E. Oases: robust de novo RNA-seq assembly across the dynamic range of expression levels. Bioinformatics. 2012;28:1086–1092. doi: 10.1093/bioinformatics/bts094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Shimozaki K, Clemenson GD, Jr, Gage FH. Paired related homeobox protein 1 is a regulator of stemness in adult neural stem/progenitor cells. J Neurosci. 2013;33:4066–4075. doi: 10.1523/JNEUROSCI.4586-12.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Smith JJ, Kuraku S, Holt C, Sauka-Spengler T, Jiang N, Campbell MS, Yandell MD, Manousaki T, Meyer A, Bloom OE, Morgan JR, Buxbaum JD, Sachidanandam R, Sims C, Garruss AS, Cook M, Krumlauf R, Wiedemann LM, Sower SA, Decatur WA, Hall JA, Amemiya CT, Saha NR, Buckley KM, Rast JP, Das S, Hirano M, McCurley N, Guo P, Rohner N, Tabin CJ, Piccinelli P, Elgar G, Ruffier M, Aken BL, Searle SM, Muffato M, Pignatelli M, Herrero J, Jones M, Brown CT, Chung-Davidson YW, Nanlohy KG, Libants SV, Yeh CY, McCauley DW, Langeland JA, Pancer Z, Fritzsch B, de Jong PJ, Zhu B, Fulton LL, Theising B, Flicek P, Bronner ME, Warren WC, Clifton SW, Wilson RK, Li W. Sequencing of the sea lamprey (Petromyzon marinus) genome provides insights into vertebrate evolution. Nat Genet. 2013;45:415–421. 421e411–412. doi: 10.1038/ng.2568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Stanke M, Steinkamp R, Waack S, Morgenstern B. AUGUSTUS: a web server for gene finding in eukaryotes. Nucleic Acids Res. 2004;32:W309–312. doi: 10.1093/nar/gkh379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Takahashi S, Uochi T, Kawakami Y, Nohno T, Yokota C, Kinoshita K, Asashima M. Cloning and expression pattern of Xenopus prx-1 (Xprx-1) during embryonic development. Dev Growth Differ. 1998;40:97–104. doi: 10.1046/j.1440-169x.1998.t01-6-00011.x. [DOI] [PubMed] [Google Scholar]
  66. Tanaka M, Munsterberg A, Anderson WG, Prescott AR, Hazon N, Tickle C. Fin development in a cartilaginous fish and the origin of vertebrate limbs. Nature. 2002;416:527–531. doi: 10.1038/416527a. [DOI] [PubMed] [Google Scholar]
  67. ten Berge D, Brouwer A, Korving J, Martin JF, Meijlink F. Prx1 and Prx2 in skeletogenesis: roles in the craniofacial region, inner ear and limbs. Development. 1998;125:3831–3842. doi: 10.1242/dev.125.19.3831. [DOI] [PubMed] [Google Scholar]
  68. Tulenko FJ, McCauley DW, Mackenzie EL, Mazan S, Kuratani S, Sugahara F, Kusakabe R, Burke AC. Body wall development in lamprey and a new perspective on the origin of vertebrate paired fins. Proc Natl Acad Sci U S A. 2013;110:11899–11904. doi: 10.1073/pnas.1304210110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Wolfe KH. Yesterday's polyploids and the mystery of diploidization. Nat Rev Genet. 2001;2:333–341. doi: 10.1038/35072009. [DOI] [PubMed] [Google Scholar]
  70. Zhong YF, Holland PW. HomeoDB2: functional expansion of a comparative homeobox gene database for evolutionary developmental biology. Evol Dev. 2011;13:567–568. doi: 10.1111/j.1525-142X.2011.00513.x. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01
02
03
04

RESOURCES