Genetic Analysis of Riboswitch-mediated Transcriptional Regulation Responding to Mn²⁺ in Salmonella

Background: Divalent cation binding to riboswitch RNAs regulates expression of their transporter genes in bacteria.

Results: Mn²⁺ interacts with Salmonella riboswitches characterized from Mn²⁺ transporter mntH and Mg²⁺ transporter mgtA to modulate transcription of the downstream coding region.

Conclusion: Specific riboswitches control gene expression in response to Mn²⁺ in bacteria.

Significance: This is the discovery of a Mn²⁺ riboswitch.

Abstract

Riboswitches are a class of cis-acting regulatory RNAs normally characterized from the 5′-UTR of bacterial transcripts that bind a specific ligand to regulate expression of associated genes by forming alternative conformations. Here, we present a riboswitch that contributes to transcriptional regulation through sensing Mn²⁺ in Salmonella typhimurium. We characterized a 5′-UTR (UTR1) from the mntH locus encoding a Mn²⁺ transporter, which forms a Rho-independent terminator to implement transcription termination with a high Mn²⁺ selectivity both in vivo and in vitro. Nucleotide substitutions that cause disruption of the terminator interfere with the regulatory function of UTR1. RNA probing analyses outlined a specific UTR1 conformation that favors the terminator structure in Mn²⁺-replete condition. Switch sequence GCUAUG can alternatively base pair duplicated hexanucleotide CAUAGC to form either a pseudoknot or terminator stem. Mn²⁺, but not Mg²⁺, and Ca²⁺, can enhance cleavage at specific nucleotides in UTR1. We conclude that UTR1 is a riboswitch that senses cytoplasmic Mn²⁺ and therefore participates in Mn²⁺-responsive mntH regulation in Salmonella. This riboswitch domain is also conserved in several Gram-negative enteric bacteria, indicating that this Mn²⁺-responsive mechanism could have broader implications in bacterial gene expression. Additionally, a high level of cytoplasmic Mn²⁺ can down-regulate transcription of the Salmonella Mg²⁺ transporter mgtA locus in a Mg²⁺ riboswitch-dependent manner. On the other hand, these two types of cation riboswitches do not share similarity at the primary or secondary structural levels. Taken together, characterization of Mn²⁺-responsive riboswitches should expand the scope of RNA regulatory elements in response to inorganic ions.

Introduction

Manganese is a redox-active metal, and the manganese ion Mn²⁺ plays a pivotal role in both eukaryotic and prokaryotic organisms as a required or preferred cofactor in many metalloenzymes including DNA and RNA polymerases, kinases, and varied redox enzymes (1, 2). The bacterial pathogen Borrelia burgdorferi even utilizes manganese to bypass host defense by eliminating the need for iron (3). Various metal divalent ion transporters are able to mediate the uptake of Mn²⁺, thus maintaining the Mn²⁺ cytoplasmic concentration. In eukaryotic cells, two natural resistance-associated macrophage proteins, Nramp1 and Nramp2, are characterized as divalent cation transporters (reviewed in Refs. 4 and 5). Nramp1, particularly, is a proton-divalent cation antiporter mediating the uptake of Mn²⁺, Co²⁺, Fe²⁺, Zn²⁺, and others (6). This transporter, expressed exclusively in macrophages, is regarded as a host resistance factor against different intracellular pathogens probably by depleting divalent cations from these bacteria (for reviews see Refs. 4, 7, and 8). Consistently, lack of Nramp1 causes an inability of the murine macrophage to destroy intracellular Salmonella enterica serovar typhimurium, Leishmania donovani, and Mycobacterium bovis (9).

As reported from several studies, the intracellular Mn²⁺ level of bacteria is detected at an order of 0.01 mm; however, expression of Mn²⁺ transporters can raise this level by more than 10-fold (0.2–0.3 mm) and readily to the millimolar range under specific conditions (1, 10–12). Many bacteria develop an Nramp1-dependent mechanism to transport Mn²⁺, as the mntH gene, which encodes an Nramp1 homolog, has been characterized in both Gram-positive and Gram-negative bacteria (13). In Escherichia coli, MntH mediates uptake of Mn²⁺ and several transition metal divalent ions including Cd²⁺, Co²⁺, Fe²⁺, and Zn²⁺ (14). Additionally, the sitABCD loci in Salmonella encode a member of the ABC-type ATPase superfamily that mediates Mn²⁺ transport (12). Both MntH and SitABCD are highly selective for Mn²⁺ over other divalent cations. It seems that SitABCD is mostly active under alkaline pH conditions (12).

Mn²⁺ uptake is important for virulence in pathogenic bacteria. A Salmonella strain harboring mutations at both mntH and sitABCD loci exhibited an avirulent phenotype in a mouse infection model (15). On the other hand, Mn²⁺ overload causes cytotoxicity regardless of its biological importance (16). Bacteria establish Mn²⁺ homeostasis mainly by modulating expression of the Mn²⁺ transporters. A transcriptional repressor, MntR, plays a major role in regulating mntH expression in Bacillus subtilis. Mn²⁺ can bind to MntR to facilitate its binding to the mntH promoter via a palindromic sequence, 5′-TTTGCCTTAAGGAAAC-3′, resulting in repression of mntH transcription (17). Transcriptional regulators with low identity (∼30%) with B. subtilis MntR have also been characterized in many Gram-negative bacteria (18, 19). In E. coli and Salmonella, binding to Mn²⁺ facilitates these MntR proteins to interact with a different palindromic sequence termed MntR-box, 5′-AAACATAGCAAAGGCTATGTTT-3′, thus implementing repression of mntH transcription (18, 19). The mntH transcription is also partially repressed by Fe²⁺ via a global iron regulator, Fur, which specifically binds Fe²⁺ and targets a Fur-binding site in the mntH promoter (11, 20). Importantly, inactivation of Fur disrupts Fe²⁺-dependent repression of mntH transcription but retains Mn²⁺-dependent repression (19). Besides the negative regulation, mntH transcription is activated through the H₂O₂-sensing regulator OxyR, which binds to the OxyR-binding site in the promoter (11, 19). It is known that Fe²⁺, but not Mn²⁺, has a high reactivity with peroxide, which generates the reactive hydroxyl radical through a Fe²⁺-mediated Fenton reaction. Because Mn²⁺ is regarded as an antioxidant to counter the effect of Fe²⁺, facilitation of Mn²⁺ import in response to oxidative stress may allow Mn²⁺ to replace Fe²⁺ in some metalloenzymes to prevent protein damage caused by reactive oxygen species (21).

The 5′-untranslated region (5′-UTR) of particular bacterial genes can exert a regulatory effect on either transcription elongation to the downstream region or translation initiation of the open reading frame (ORF). Many of these 5′-UTRs are riboswitches that bind a specific signal molecule, thus forming an alternative conformation via switching between mutually exclusive base pairs to modulate transcription or translation of the downstream region (for recent reviews see Refs. 22–24). The signal molecules, which are mainly metabolites present in the cytoplasm, interact with the ligand-binding domain (or aptamer) of the riboswitches. Most commonly, the riboswitch domain in a nascent transcript can cause a transcription termination by forming an intrinsic transcription terminator (22, 23, 25). It has been shown that inorganic ions such as Mg²⁺ and F⁻ can serve as ligands to interact with specific riboswitches (26–28). It is generally believed that inorganic cations play an important role in neutralizing negatively charged phosphate groups that come into close proximity in the transition states of RNA folding (for a recent review see Ref. 29). Essentially, Mg²⁺ contributes to the folding of all large RNAs (29). Meanwhile, particular RNA molecules display high specificity to interact with Mg²⁺. The 5′-UTR of two Mg²⁺ transporter genes, mgtA from Salmonella and mgtE from Bacillus, responds to Mg²⁺ through a riboswitch domain regardless of having no homology at the primary or secondary structure, which subsequently facilitates a transcription termination of the downstream coding region (26, 27). It has been shown that six Mg²⁺ ions residing in the mgtE riboswitch stabilize the conformation with a Rho-independent terminator, thus facilitating mgtE transcription termination (27). Also, a regulatory mechanism that controls transcription termination is involved in the mgtA Mg²⁺ riboswitch function via a Rho-dependent terminator (30) as an open reading frame encoding a 17-residue leader peptide that is translated within the 5′-leader region (LR)² (31, 32).

In this article, we have provided evidence of Salmonella response to Mn²⁺ through divalent cation riboswitches. By conducting in vivo gene expression assays, RNA structural probing, mutational analysis, and in vitro transcription experiments, we have established that a 5′-UTR of the mntH mRNA functions as a regulatory element by sensing Mn²⁺ to determine whether transcription reads through into the mntH coding region or stops within the 5′-UTR. We also have demonstrated that the Mg²⁺ riboswitch can exert its regulatory effect by responding to Mn²⁺ in a manner similar to Mg²⁺.

MATERIALS AND METHODS

Bacterial Strains, Growth Conditions, and Oligonucleotides

All S. enterica serovar typhimurium strains were derived from the wild-type strain ATCC14028s and are listed in Table 1. Bacteria were grown at 37 °C in Luria-Bertani (LB) broth or in N minimal medium (33), pH 7.4, supplemented with 0.1% casamino acids and 38 mm glycerol. MnCl₂ and MgCl₂ were added to the required concentrations. When necessary, antibiotics were added at final concentrations of 50 μg/ml for ampicillin, 20 μg/ml for chloramphenicol, and 50 μg/ml for kanamycin. E. coli DH5α and BL21-Gold (DE3) were used as hosts for the preparation of plasmid DNA and protein production, respectively. Oligonucleotides used in this study are described in Table 2.

TABLE 1.

Bacterial strains and plasmids used in this study

Strain or plasmid	Description	Reference or source
S. enterica serovar typhimurium
14028s	Wild type	ATCC
YS13290	ΔmntH-lacZY	This work
YS13291	ΔmntH-lacZY ΔmntR	This work
YS14063	ΔmntH-lacZY stem-R[mut]	This work
YS14065	ΔmntH-lacZY stem-R[mut] ΔmntR	This work
YS14261	ΔmntR Δfur	This work
YS10211	mntH-FLAG corA-FLAG	This work
E. coli
DH5α	F− supE44 ΔlacU169 (φ80 lacZΔM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1	New England Biolabs
BL21-Gold (DE3)	E. coli B F− ompT hsdSB (rB− mB−)	Agilent Technologies
	dcm+ Tetr gal λ (DE3) endA Hte
Plasmids
pKD4	repR6K γApR FRT KmR FRT	Ref. 34
pKD46	reppSC101ts ApR ParaBAD γβ exo	Ref. 34
pCP20	reppSC101ts ApR CmR cI857 λPR	Ref. 34
pKG137	repR6Kγ KmR FRT lacZY this	Ref. 35
pACYC184	repp15A CmR TcR	New England Biolabs
pUHE21–2lacq	reppMB1 ApR lacIq	Ref. 44
pYS1000	repp15A CmR Plac1–6 lacZ this	Ref. 36
pYS1010	repp15A CmR Plac1–6 lacZ this	Ref. 38
	mgtA 5′LR lacZ this
pYS1011	repp15A CmR Plac1–6 lacZ this	This work
	Stem-loop B−
	mgtA 5′LR lacZ this
pYS1300	repp15A CmR Plac1–6 UTR1	This work
	Wild-type lacZ this
pYS1301	repp15A CmR Plac1–6 UTR1	This work
	Stem-R[mut] lacZ this
pYS1331	repp15A CmR Plac1–6 UTR1	This work
	stem-L[mut] lacZ this
pET28a	repColE1 KmR lacI PT7	EMD Biosciences
pYS1466	repColE1 KmR lacI PT7 mntR-His6	This work
pYS1008	reppMB1 ApR lacIq mntH-FLAG	This work
pYS1013	reppMB1 ApR lacIq mntH-FLAG (D34E)	This work
pYS1014	reppMB1 ApR lacIq mntH-FLAG (E102D)	This work
pYS1020	reppMB1 ApR lacIq corA	This work

TABLE 2.

Primers used in this study

No.	Sequence
	5′—3′
7	CCGATGACGCCCACGCATCGGGCCTGCTATCTTTCTGTCTGTGTAGGCTGGAGCTGCTTC
8	TGGTTGCTGGTTGGAACGGTGATGGGGTTGTCAGACTACAAGGACGACGATGACAAGTAACATATGAATATCCTCCTTAG
12	CGGGATCCGAGGCAAAAGATGACTGAC
13	CCCAAGCTTACTTGTCATCGTCGTCCTTGTAGTCTGACAACCCCATCACCGTTC
17	CTCTGCTGTCTTACCGGTGTAGATGTTTTCGACACAATAACGTCC
18	ACACCGGTAAGACAGCAGAGGCAGGCTTACC
20	GCCGCGATTGGTTATATCGAACCTGGTAACTTCGCG
21	TCGATATAACCAATCGCGGCAATGAACGCAG
23	TTTTACTGGGTACAGGCGGATATCATCGCGATGGCC
24	TCCGCCTGTACCCAGTAAAACCAGACTACC
105	CGGGATCCGGAGTCCCGGTCATGCT
106	CCCAAGCTTACTTGTCATCGTCC
144	AGCATGAAACATAGCAAAGGCTATGTTTTTGAGGCAAAAGCATATGAATATCCTCCTTAG
145	CCGATGACGCCCACGCATCGGGCCTGCTATCTTTCTGTCTGTGTAGGCTGGAGCTGCTTC
201	AGGTAATCCCTCCGCGCCG
241	GGCCTGCTTCTCGCCGAAACGTTTGG
298	GCGTCGACCTTTACACTTTAAGCTTTTTATGTTTATGTTGTGTGGATAATTGCCACAAAACTTATGGATTTATGC
565	GTTGGGAAGGGCGATCGG
1253	GTTAACGCGTCACAGAAACGAGGAAGCAAACATATGAATATCCTCCTTAG
1254	GATCTCCGGACTTACGCCTAATACCAGTAAGTGTAGGCTGGAGCTGCTTC
1256	AACTGCAGTGTTAAGCCAAACTGTTC
1262	TGAATCGTTTAGCAACAGGACAGATTCCGCCATATGAATATCCTCCTTAG
1263	CGGGCGGTTGGCTCTTCGAAAGATTTACACGTGTAGGCTGGAGCTGCTTC
1301	AGCTTGCGCGCCGCCCGTCC
1302	CCAGGGTTTTCCCAGTC
1307	AACTGCAGCATTGAAATGCACTTGAT
1308	TGTTTCCTGCTCGAGCTTTTGCCTCAAAAAC
1312	TAATACGACTCACTATAGCATTGAAATGCACTTGAT
1341	TTTTTGAGGCAAAAGCTCGAG
1342	GAGCTTTTGCCTCAAAAAGTATCGCTTTGCTATGTTTCATGC
1343	GAGCTTTTGCCTCAAAAAGTATCGCTTTCGATACTTTCATGCTATGTTTATTG
1355	GAATCCGTAATCATGGTC
1386	GCTATGTTTTTGAGGCAAAAGC
1389	TTTGCCTCAAAAACATAGCGAGAGCTATGTTTCATGCTATGTTTATTG
1543	TTTCATGCTATGTTTATTGATAATG
1544	CAATAAACATAGCATGAAAGTATCGAAAGGCTATGTTTTTGAGG
1545	CAATAAACATAGCATGAAACATAGCAAAGGCTATGACACTGAGGCAAAAGCTCGAG
1575	TCAATAAACATAGCATGAAACATAGCAAAGCGATACTTTTTGAGGCAAAAGCATATG
1576	AACATAGCATGAAACATAGCAAAGGCTATGACACTGAGGCAAAAGCATATGAATATC
1582	CATTCTATGCAACAGCCG
1583	GCTATGTTTCATGCTATG
1630	CCGCTCGAGTCATTCTGCAGATGTTCCA
1631	CATGCCATGGGCCATCATCACCATCATCACAGCATGGGTCGTCGCGCAGG

Construction of Strains with Chromosomal Deletions, lac Fusions, FLAG Fusions, and Site-directed Mutations

Strains harboring deletions and FLAG fusion were generated as described previously (34). If needed, the antibiotic resistance cassette was removed using plasmid pCP20. Deletion of the mntH, mntR, and fur genes was carried out using primer pairs 144 and 145, 1253 and 1254, and 1262 and 1263, respectively, to amplify the kanamycin resistance cassette (Km^R) from plasmid pKD4 and integrate the resulting PCR product into the chromosome. A lac gene was integrated in the deleted chromosomal mntH location using plasmid pKG137, which was inserted into the FLP recombination target sequence generated after the Km^R cassette was removed (35). mntH-lac strain which contained substitution of the mntH 5′-UTR, stem-R[mut], was constructed using primer pair 145 and 1575 to amplify the PCR product from the chromosomal DNA of the ΔmntH::Km strain; the product was electroporated into wild-type cells harboring pKD46, and then Km^R colonies were selected, and substitution was confirmed. Construction of the strain harboring a chromosomal copy of the mntH-FLAG (C terminus) fusion was carried out using primer pair 7 and 8 to amplify the kanamycin resistance cassette (Km^R) from plasmid pKD4 and integrate the resulting PCR product into the chromosome of a Salmonella strain that carried a chromosomal corA-FLAG fusion (our laboratory collection).

Plasmid Construction

All plasmids used in this study are listed in Table 1. pYS1300 was constructed using PCR fragments containing mntH full-length UTR1 generated with primer pair 1307 and 1308 and wild-type 14028s chromosomal DNA as template. These fragments were digested with PstI and XhoI and then ligated between the PstI and XhoI sites of pYS1000 (36). Derivatives of pYS1300 with nucleotide substitutions were constructed using the GeneTailor site-directed mutagenesis system (Invitrogen) with Platinum Taq Polymerase High Fidelity (Invitrogen) and pYS1300 DNA and the following primer pairs: for pYS1301, 1341 and 1342; and for pYS1331, 1543 and 1544. pYS1466 was constructed using PCR fragments containing the mntR coding region generated with primer pair 1630 and 1631 and 14028s chromosomal DNA as template; these were digested with NdeI and XhoI and then ligated between the NdeI and XhoI sites of pET28a (EMD Biosciences). pYS1008 (a FLAG epitope in the C terminus of MntH) was constructed as follows. A PCR fragment containing the mntH coding region with its Shine-Dalgarno sequence that was generated with a primair pair 12 and 13 and 14028s chromosomal DNA as template was digested with BamHI and HindIII and cloned into pUHE21–2lacI^q that had been digested with the same enzymes. Derivatives of pYS1008 with nucleotide substitutions were constructed through site-directed mutagenesis (described above) using the following primer pairs: 20 and 21 for pYS1013 (D34E) and 23 and 24 for pYS1014 (E102D). pYS1020 was constructed using a PCR fragment containing the corA coding region with its Shine-Dalgarno sequence that was generated with primer pair 105 and 106 and 14028s chromosomal DNA as template was digested with BamHI and HindIII and cloned into pUHE21–2lacI^q, that had been digested with the same enzymes. The pYS1010 derivative pYS1011, with nucleotide substitutions at stem-loop B, was constructed through site-directed mutagenesis using primer pair 17 and 18.

In Vitro Transcription Assays Using E. coli RNA Polymerase Holoenzyme

Linear DNA templates containing the P_lac1–6 promoter region, the mntH full-length UTR1, and the first 62 nucleotides (nt) of the lacZ ORF were generated by PCR from pYS1300 and its derivatives using primers 241 and 1302. The template harboring the full-length mgtA 5′-UTR was amplified using plasmid pYS1010 DNA and primers 201 and 248. A control template containing the P_lac1–6 promoter and the first 151 nt of the lacZ gene was amplified from pYS1000 (36) using primers 241 and 565. In vitro transcription was carried out as described (37). Briefly, 1 unit of E. coli RNA polymerase σ⁷⁰ holoenzyme (Epicentre) was incubated with 0.5 μg of template DNA in 35 μl of transcription buffer, which contained 100 mm Tris-HCl, pH 8.0, 100 mm NaCl, 0.2 mm EDTA, 0.2 mm DTT, 50 mg/ml BSA, and 0.35 mm Mg²⁺, at 37 °C for 30 min to form open complexes. RNA synthesis was initiated by adding 15 μl of NTP mixture, which contained 0.32 mm ATP, CTP, and GTP, 0.1 mm UTP, and 2 μCi of [α-³²P]UTP (PerkinElmer Life Sciences). After a 10-min incubation at 37 °C, transcripts were precipitated with 5 μl of 3 m sodium acetate, pH 5.5, and 150 μl of ethanol, separated in a 6% denaturing polyacrylamide gel electrophoresis, and detected by autoradiography. When necessary, Mn²⁺, Mg²⁺, and Ca²⁺ were added to the required concentrations. The length of transcripts was determined by using a DNA sequencing ladder generated from a PCR product amplified with primers 241 and ³²P-labeled 1302 from pYS1300 (for mntH UTR1) or primers 248 and ³²P-labeled 201 (for mgtA 5′-LR), and degraded using the Maxam-Gilbert sequencing reaction.

Primer Extension

Bacteria were grown to mid-exponential phase (A_{600 nm} of 0.4–0.6) in 50 ml of N minimal medium, pH 7.4, containing 10 mm MgCl₂ and 0 or 0.05 mm MnCl₂, and total RNA was isolated from the harvested bacterial cells using the SV total RNA isolation system (Promega) according to the manufacturer's specifications as described previously (38). The primer extension assay was performed in a 25-μl reaction with 10 μg of total RNA, ³²P-labeled primer 1301 (complementary to the 31–50 nt of the mntH ORF), 100 units of M-MuLV reverse transcriptase (Promega), and 1× reaction buffer and incubated at 42 °C for 2 h. The cDNA were synthesized and resuspended in 10 μl of H₂O after precipitation with ethanol. Samples (3 μl) were analyzed by 6% denaturing polyacrylamide gel electrophoresis by comparison with a DNA ladder amplified from chromosome with primers 1256 and ³²P-labeled 1301 and generated by Maxam-Gilbert reaction.

Isolation of MntR-His₆

E. coli BL21-Gold (DE3) harboring plasmid pET28a-mntR (pYS1466) was grown at 37 °C with shaking to A_{600 nm} of 0.5 in 500 ml of LB medium; then IPTG (final concentration, 1 mm) was added, and the bacteria were incubated for 2 h. Cells were harvested, washed with PBS once, resuspended in 10 ml of PBS, and opened by sonication. The whole cell lysate was used for MntR-His₆ purification by mixing with His-Select nickel affinity gel (Sigma) following the instructions of the manufacturer. A pure MntR-His₆ sample was tested using silver staining (Pierce) following the instructions of the manufacturer.

DNase I Protection Assays

DNase I protection assays were carried out using DNA fragments amplified by PCR using 14028s chromosomal DNA as template. Prior to the PCR, primer 1583 was labeled with T4 polynucleotide kinase and [γ-³²P]ATP. The mntH promoter region was synthesized with primers 1582 and ³²P-labeled 1583. Approximately 25 pmol of labeled DNA and 0, 100, or 200 pmol of the MntR-His₆ protein were used in a 100-μl reaction. 0.05 mm Mn²⁺ was added to the required reactions. DNase I digestion was carried out as described previously (36) using 0.05 units of DNase I (Invitrogen) per reaction. Samples (3 μl) were analyzed by 6% denaturing polyacrylamide electrophoresis by comparison with a DNA sequence ladder generated with the appropriate primer by a Maxam-Gilbert A+G reaction. The positions of radioactive DNA fragments in the gels were detected by autoradiography.

Structural Probing of the mntH UTR1 RNA Structure

An RNA containing full-length mntH UTR1 was synthesized with a T7 RiboMax large scale RNA production system (Promega) according to the manufacturer's instructions using PCR-generated products as templates. The PCR products harboring the T7 promoter were generated using pYS1300 and its derivatives as template and primers 1312 and 1355. A DNA sequencing ladder was generated from the PCR product that was amplified using primer 1312 and ³²P-labeled 1355 and degraded using the Maxam-Gilbert reaction. Chemical modification of the RNA with dimethyl sulfate (DMS) was carried out as follows. 1 μl of RNA solution (corresponding to 7.5 μg) was mixed with 146 μl of H₂O, incubated at 95 °C for 5 min, cooled on ice for 30 s, and placed at room temperature for 5 min. 40 μl of 1 m HEPES, pH 8.0, 5 μl of 2 m KCl, 4 μl of 17.5 mm MgCl₂, and 4 μl of H₂O or 17.5 mm MnCl₂ were added and incubated at 37 °C for 30 min. When the specificity of UTR1 to cationic ions was clarified, Mg²⁺ in the solution was substituted by Mn²⁺, Mg²⁺, or Ca²⁺ at the required concentrations. 2 μl of DMS (Acros) was added, and the reaction mixture was incubated at 37 °C for 5 min. Then, 20 μl of 3 m sodium acetate, pH 5.2, and 600 μl of cold ethanol were added, and the tube was kept at −80 °C for 15 min. The RNA was precipitated by centrifugation at 14,000 rpm for 15 min, and the pellet was washed with 75% ethanol and air-dried. The products were reverse-transcribed using M-MLV reverse transcriptase (Promega) and ³²P-labeled primer 1355 according to the manufacturer's instructions, separated using 6% denaturing polyacrylamide gel electrophoresis, and detected by autoradiography. DMS modification of the denatured RNA was carried out in a similar fashion. 1.5 μl of RNA solution (corresponding to 11 μg) was mixed with 153.5 μl of H₂O, incubated at 95 °C for 5 min, cooled on ice for 30 s, and placed at room temperature for 5 min. 40 μl of 1 m HEPES, pH 8.0, and 5 μl of 2 m KCl were added and incubated at 90 °C for 1 min. 2 μl of DMS (Acros) was added, and the reaction mixture was incubated at 90 °C for 30 s. The RNA was precipitated and reverse-transcribed.

Determination of Mn²⁺-facilitated Cleavage of the UTR1 RNA

A cleavage reaction of RNA molecules induced by Mn²⁺ was carried out as follows. One μl of RNA solution (corresponding to 7.5 μg) was mixed with 146 μl of H₂O, 40 μl of 1 m HEPES, pH 8.0, 5 μl of 2 m KCl, and 4 μl of 17.5 mm MgCl₂. Specified concentrations of Mn²⁺ and EDTA were added as described above. The mixture was incubated at room temperature for 40 h. The product was separated and analyzed as described above for the RNA structural probing step.

β-Galactosidase Assay

The β-galactosidase assay was carried out in triplicate, and the activity was determined as described previously (39). The data correspond to three independent assays conducted in duplicate, and all values are mean ± S.D.

RESULTS AND DISCUSSION

A MntR-independent Mechanism Contributing to Mn²⁺-responsive mntH Transcription in Salmonella

0.05 mm Mn²⁺ was able to turn off mntH transcription in Salmonella because β-galactosidase activity was reduced to an undetectable level in a mntH-lac strain grown in N minimal medium supplemented with Mn²⁺ (Fig. 1). In a mutant harboring deletion of the regulator mntR gene, mntH transcription could still be repressed 2.8-fold by Mn²⁺ although it was not turned off as in the wild type (Fig. 1). This observation implies that Salmonella may regulate Mn²⁺-responsive mntH transcription through a MntR-independent mechanism. When a chromosomal region located upstream of the mntH ORF and overlapping a previously characterized MntR-binding site (referred to as MntR-box; see Ref. 18) was substituted with an alternative sequence (i.e. stem-R[mut]), this MntR-independent regulation was eliminated because mntH transcription could no longer be repressed by Mn²⁺ and therefore remained similarly activated regardless of Mn²⁺ in a mntR stem-R[mut] mutant (Fig. 1). On the other hand, mntH transcription could still be repressed significantly by Mn²⁺ in a stem-R[mut] mutant, implying that MntR could exert its effect by interacting with a region other than the MntR-box, in the mntH promoter (Fig. 1). Hence, we concluded that this novel regulatory mechanism was independent from MntR but still dependent on a regulatory element located upstream of mntH ORF. Because it functions regardless of MntR, this chromosomal region most likely plays a regulatory role as more than just a MntR binding region. Importantly, this hypothesis provides a possible explanation for several previous observations drawn from a plasmid-borne mntH expression that were consistent with our observations (1, 19).

FIGURE 1.

Expression of Salmonella mntH gene is regulated by both MntR-dependent and -independent mechanisms. β-Galactosidase activity was determined in a wild-type strain and mntR deletion mutant harboring a mntH-lacZY fusion (YS13290 and YS13291, respectively) and their derivatives with a chromosomal substitution upstream of the mntH coding region (stem-R[mut], YS14063 and YS14065, respectively). Bacteria were grown for 6 h in N minimal medium (0.01 mm Mg²⁺), pH 7.4, supplemented with 0 or 0.05 mm Mn²⁺.

Mn²⁺ Down-regulates mntH Transcription from Two Different Initiation Sites

To gain insights into this regulation, we characterized the promoter region of mntH gene by mapping its transcription initiation site. We carried out primer extension and detected two products from the wild-type strain grown in a low Mn²⁺ condition (Fig. 2A, lane 1). Therefore, mntH transcription is initiated from two locations, which correspond to adenosines located 76 and 18 nt upstream of the mntH ORF, respectively (Fig. 2, A and C, referred to as +1 and +1′ hereinafter). Mn²⁺ (0.05 mm) added to the wild-type culture reduced the level of both transcripts initiated from +1 and +1′ by 5.1- and 7.4-fold, respectively (Fig. 2A, lane 2), suggesting that Mn²⁺ down-regulates the transcription initiated from both starts. We examined the MntR-binding site in the mntH promoter by carrying out DNase I footprinting and found that MntR protein could protect two regions (Fig. 2B) (referred to as R1 and R2, respectively). R1 is located in the −21 and −2 nt upstream of +1, which is protected by MntR mainly in the presence of Mn²⁺ (Fig. 2B, lanes 4–6), whereas R2 is located in the −18′ and −1′ nt upstream of +1′, which is protected under the conditions we tested regardless of Mn²⁺ (Fig. 2B, lanes 1–3 and 4–6). Thus, MntR most likely exerts its inhibitory effect by binding to individual −10 regions upstream of +1 and +1′, respectively (illustrated in Fig. 2C). Consistent with previous results, R2 partially overlaps the MntR-box demonstrated previously (18). A pentanucleotide motif, CAAAG, is shared by the R1 and R2 sequences and is highly conserved in the mntH promoter of E. coli and Shigella (Fig. 2C), and thus it most likely represents a consensus sequence for MntR binding in these Gram-negative bacteria.

FIGURE 2.

Mn²⁺-responsive mntH transcription is initiated from two start sites, both controlled by MntR. A, mapping transcription start site of Salmonella mntH gene. Primer extension products were generated using primer 1301, and total RNA was isolated from wild-type strain 14028s grown in N-minimal medium, pH 7.4, with 0 (−) and 0.05 mm (+) Mn²⁺, respectively. M corresponds to a DNA ladder derived from a Maxam-Gilbert A+G reaction. Arrows indicate the transcription start nucleotides (uppercase letters) labeled as +1 and +1′. B, DNase I footprinting analysis of the mntH promoter with increasing amounts of MntR-His₆ protein (0, 50, 100, and 200 pmol) and with 0 (−) and 0.05 mm (+) Mn²⁺. Solid vertical lines correspond to the R1 and R2 regions protected by the MntR protein. M corresponds to the DNA ladder derived from a Maxam-Gilbert A+G reaction. Numbering in the R1 and R2 sequences are from +1 and +1′, respectively. C, sequence alignment of the upstream region of mntH ORF from chromosome of S. typhimurium (STM), E. coli (ECO), and Shigella flexneri (SFL). The horizontal lines are the previously characterized binding sites for OxyR, Fur, and MntR. The boxed sequences are the MntR protected sequences, R1 (the one overlapping the OxyR binding region) and R2 (the one overlapping the MntR-box). The bold uppercase letters with arrows are the transcription starts, +1 and +1′. The light highlighted sequences are the consensus sequences of the MntR-binding site. The dark highlighted sequence is the putative −10 corresponding to +1. The bold italic letters represent a palindromic sequence in the MntR-box. Underlined sequences represent the mntH start codon. Numbering in the sequence is from the start codon.

Regulatory Role of the 5′-Untranslated Region from Transcription Start +1 in Response to Mn²⁺

We examined whether the mntH 5′-UTR could play a role in MntR-independent regulation. Transcription initiated from +1 and +1′ will produce a long 76-nt 5′-UTR (termed UTR1 hereinafter) and a short 18-nt 5′-UTR, respectively. We investigated the regulatory role of the UTR1 by constructing a plasmid (pYS1300) that carried full-length UTR1-lacZ transcriptional fusion under the control of P_lac1–6 (i.e. a promoter independent of IPTG) (40). P_lac1–6 is insensitive to Mn²⁺ because the level of β-galactosidase from wild type harboring parental pYS1000, which carries a P_lac1–6-controlled lacZ gene (26), is similar regardless of Mn²⁺ (Fig. 3A). β-Galactosidase activity from wild type harboring pYS1300 is 2.6-fold lower in the medium supplemented with Mn²⁺ than without (Fig. 3A). It is still reduced by about 2.6-fold in an mntR fur mutant harboring pYS1300 by supplementing Mn²⁺ (Fig. 3A) regardless of both the MntR (R1)- and Fur-binding sites present in the UTR1 region (Fig. 2C). We reason that the chromosomal sequence upstream of UTR1, which is absent in pYS1300, may still be required for MntR and Fur to exert their effects. Taken together, these results suggest that UTR1 is sufficient to respond to Mn²⁺ and down-regulate the mntH transcription independently from the known regulators.

FIGURE 3.

The Salmonella mntH 5′-UTR is a Mn²⁺-responsive cis-acting regulatory element. A, a β-galactosidase assay was carried out with wild-type strain 14028s and mntR fur double mutant YS14261, each harboring pYS1000 (vector, −), pYS1300 (wild type), pYS1301 (stem-R[mut]), and pYS1331 (stem-L[mut]). The -fold change was determined by β-galactosidase activity from no Mn²⁺ supplemented medium divided by activity from 0.05 mm Mn²⁺. B, the predicted Rho-independent terminator structure in mntH UTR1 (T, center panel). The highlighted sequences were substituted in stem-L[mut] (left panel) and stem-R[mut] (right panel), respectively. C, a β-galactosidase assay was carried out with wild type harboring pYS1300. Bacteria were grown for 6 h in N medium (0.01 mm Mg²⁺). The -fold change was determined by β-galactosidase activity from no Mn²⁺ supplemented medium divided by activity from 0.05 mm Mn²⁺, Mg²⁺, and Ca²⁺, respectively. D, a β-galactosidase assay was carried out with the wild-type strain harboring pYS1020 and pYS1300 (UTR1-lacZ, left panel) or pYS1010 (mgtA 5′LR-lacZ, right panel). The -fold change was determined by β-galactosidase activity from 0.01 mm Mg²⁺ divided by activity from 10 mm Mg²⁺ (Mg²⁺ L/H) and by β-galactosidase activity from 0.01 mm Mg²⁺ without IPTG divided by activity from 0.01 mm Mg²⁺ with 0.5 mm IPTG (IPTG −/+). Bacteria in A, C, and D were grown for 6 h in N medium (0.01 mm Mg²⁺).

It is generally believed that Mg²⁺ and Ca²⁺ have a similar size and charge density that can overlap Mn²⁺ function in stabilizing the structural charge of enzymes. However, β-galactosidase activity from wild type harboring pYS1300 was reduced by supplementing 0.05 mm Mn²⁺, but not Mg²⁺ or Ca²⁺ (Fig. 3C), indicating that these ions could not replace Mn²⁺ to repress transcription through UTR1. To determine whether the UTR1 would respond to a higher concentration of Mg²⁺, we tested a high (H) (10 mm) and low (L) (0.01 mm) Mg²⁺, respectively, which were used to determine the regulatory activity of the Salmonella Mg²⁺ riboswitch, i.e. the mgtA 5′-LR (26). Indeed, β-galactosidase activity from wild type harboring pYS1010 (a plasmid that carried a P_lac1–6-controlled lacZ fusion with mgtA 5′-LR; also see Ref. 26) grown in N medium with 10 mm Mg²⁺ was 29-fold lower than that with 0.01 mm Mg²⁺ (see Fig. 3D, right panel, Mg²⁺ L/H column). However, the ratio of the β-galactosidase activity from wild type harboring pYS1300 grown in high and low Mg²⁺ was ∼1-fold (Fig. 3D, left panel, Mg²⁺ L/H column), indicating that Mg²⁺, even at a high level, had no effect on UTR1. Furthermore, when Mg²⁺ uptake was enhanced by overexpressing a Salmonella Mg²⁺ transporter, corA, mgtA 5′-LR-controlled transcription was repressed because β-galactosidase activity from wild type harboring pYS1010 and pYS1020 (P_lac-controlled corA gene) grown in low Mg²⁺ with IPTG (0.5 mm) was ∼25-fold lower than that without IPTG (Fig. 3D, right panel, IPTG −/+ column). However, β-galactosidase activity from wild type harboring pYS1300 and pYS1020 remained similar in low Mg²⁺ regardless of IPTG (Fig. 3D, left panel, IPTG −/+ column). Taking these results together, we concluded that the UTR1 is highly specific to Mn²⁺.

An Intrinsic Rho-independent Terminator within the UTR1

We observed that UTR1 nucleotides 46–65 formed a stem-loop (termed T hereinafter; Fig. 3B, middle panel) when two complementary segments, ⁴⁶CAUAGC⁵¹ (i.e. stem-L) and ⁵⁶GCUAUG⁶¹ (stem-R), were base-paired to each other and followed by ⁶²UUUU⁶⁵ (poly(U)). Hence, it is likely a Rho-independent terminator that is responsible for the regulatory function of UTR1. According to this structure, the stem-R[mut] substitution actually changed complementary bases at the right arm of this stem-loop (Fig. 3B, right panel), thus explaining why it caused disruption of the MntR-independent regulation (Fig. 1). We constructed two pYS1300 derivatives, pYS1301 and pYS1331, in which UTR1 contained sequences of stem-R[mut] and stem-L[mut] (Fig. 3B, left panel), respectively, and reconfirmed that disruption of this terminator impaired the regulatory activity of UTR1, because β-galactosidase activity remained at levels similar to the wild-type strain or mntR fur double mutant carrying these plasmids grown in the medium regardless of Mn²⁺; this gave rise to a ratio change of ∼1-fold with and without supplementing Mn²⁺ (Fig. 3A, last four columns) and was also similar to the wild-type strain carrying pYS1300 grown without Mn²⁺ (data not shown). The UTR1 sequence is highly conserved in E. coli and Shigella, and therefore, this Mn²⁺-responsive regulation is also most likely employed in these enteric bacteria (Fig. 2C). On the other hand, the short (18 nt) 5′-UTR transcribed from the +1′ start is unlikely to mediate a premature termination because it contains only three nucleotides from the region of the intrinsic terminator (Fig. 2C).

UTR1 Independently Facilitates Transcription Termination

We carried out an in vitro transcription assay in which a linear DNA template amplified from pYS1300 was used to produce a 165-nt runoff RNA containing full-length 76-nt UTR1, an upstream 9-nt linker sequence, and a downstream 80-nt lacZ coding region (Fig. 4A). In this in vitro system, the only protein component supplemented was E. coli RNA polymerase σ⁷⁰ holoenzyme, thus ruling out the influence from any cellular regulatory factors. The only product detected in the Mn²⁺-free condition was the runoff transcript (Fig. 4B, lane 1, designated R), indicating that no terminator structure was formed to stop transcription before it read through the template. Mn²⁺ (0.2 mm) significantly enhanced overall transcription and facilitated production of the 72–77-nt terminated transcripts (Fig. 4B, lane 2, designated T). These terminated transcripts contained 63–68-nt UTR1 fragments, indicating that Mn²⁺ induced the terminator structure to cause transcription termination occurring from the second nucleotide of the polyuridine sequence (Fig. 4A, red arrowheads). Mn²⁺, but no other cations tested, also enhanced production of additional truncated transcripts appearing mainly as 110- and 111-nt bands (Fig. 4B, lane 2, designated U), probably by pausing transcription at nucleotides 7 or 8 of the lacZ sequence (indicated in Fig. 4A by pink arrowheads). Thus, these truncated products should most likely be regarded as runoff transcripts as well because they stopped downstream of the UTR1. As a result, the level of runoff transcripts was reduced to 31% of the total transcripts through the Rho-independent termination in the presence of 0.2 mm Mn²⁺ (the percentage was calculated by using the formula [R + U]/[R + T + U] × 100 (Fig. 4B)). On the other hand, the level of runoff transcript in the reaction supplemented with Mg²⁺ or Ca²⁺ to the same concentration (0.2 mm) remained at 56 and 49% of the total transcripts, respectively (Fig. 4B, lanes 3 and 4), indicating that Mg²⁺ and Ca²⁺ caused less 72–77-nt terminated products than Mn²⁺. This observation is consistent with the in vivo expression assay (Fig. 3C), thus suggesting that UTR1 has a high specificity in response to Mn²⁺. This transcription termination was dependent on Mn²⁺ concentration, because the level of runoff RNA dropped to 48% of the total transcripts when 0.1 mm Mn²⁺ was supplemented (Fig. 4C, lane 2) and was further reduced to 27% when the Mn²⁺ concentration was raised to 0.2 mm (see Fig. 4C, lane 3, similar to the result in Fig. 4B, lane 2). However, it was most interrupted when the stem-R[mut] UTR1 was transcribed because the runoff transcript in Mn²⁺-containing reactions represented almost all (99%) of the total products (Fig. 4C, lanes 8 and 9). Furthermore, the UTR1 transcription using terminator-insensitive T7 RNA polymerase could only produce the runoff transcript regardless of Mn²⁺ (data not shown), confirming that the terminator is essential for transcription termination at the UTR1 63–68-nt region.

FIGURE 4.

The UTR1 is sufficient to mediate premature transcription termination in vitro. A, Illustration of the in vitro transcription template with UTR1 wild-type sequence. The boxed sequences in red and blue are a partial P_lac1–6 promoter and mntH UTR1. The +1 corresponds to the transcription start for P_lac1–6. The bold uppercase letter A is the +1′ start. The red arrows indicate the terminator stem sequence. The lacZ fragment is underlined. The red arrowheads indicate the positions where the transcription stops by the terminator. The pink arrowheads indicate the positions where transcription is terminated/interrupted within the lacZ coding region. Blue numbers indicate is the position of nucleotides from +1. B, in vitro transcription of wild-type template without any supplemental divalent cation (−) or 0.2 mm Mn²⁺, Mg²⁺, and Ca²⁺, respectively. Arrows indicate products labeled by their length from reactions. C, in vitro transcription of templates coding wild type, substituted stem-L[mut], and stem-R[mut] UTR1 in the presence of 0, 0.1, and 0.2 mm Mn²⁺. A control template (lacZ) contains the first 151 lacZ nucleotides. To determine a Mn²⁺-responsive effect through the Rho-independent termination, the percentage of runoff RNAs (R and U) versus all transcripts (R, T, and U) was calculated by the formula [R + U]/[R + T + U] × 100 after bands were quantified using Quantity One software (Bio-Rad). The M in B and C is a ladder prepared from a Maxam-Gilbert A+G reaction.

Interestingly, the 110- and 111-nt truncated products were still dependent on the UTR1 because they appeared in the Mn²⁺-containing reactions with both the wild type and the substituted templates (Fig. 4, B, lane 2, and C, lanes 2 and 3, 5 and 6, and 8 and 9) and because there were no truncated bands representing termination at nucleotides 7 and 8 of lacZ observed in Mn²⁺-containing reactions using a template from pYS1000 that carried P_lac1–6-lacZ (the runoff transcript is 179 nt; see Fig. 4C, lanes 10–12). We postulated that the UTR1 might interact with this downstream region in the presence of Mn²⁺ to pause transcription in a terminator-independent manner. Surprisingly, we did not observe the predicted +1′-transcript, i.e. a 98-nt band, in these in vitro reactions (Fig. 4, B and C), although the +1′-site is located within the cloned UTR1 (indicated by uppercase A, Fig. 4A). This was probably because additional regulators, which are absent in our in vitro system, are required to initiate transcription from this start.

The UTR1 Favors a Terminator Conformation in the Presence of Mn²⁺

Mn²⁺ most likely induces a conformational modification of UTR1, by which this 5′-UTR formed the terminator structure to facilitate premature transcription termination. We predicted two UTR1 conformations mainly through canonical base-pairing (Fig. 5A). Structure 1, designated S1, possesses stem-loops A, B, and C. Based on our results, this conformation, which lacks the terminator stem-loop (T), most likely represent a structure favored in low Mn²⁺, thus allowing transcription to pass through UTR1. On the contrary, structure 2 (S2), which contains stem-loops D, E, and T, is likely a conformation favored in high Mn²⁺.

FIGURE 5.

RNA structural probing of UTR1. A, schematic representation of the predicted secondary structure of the 76-nt mntH UTR1 from S. enterica serovar typhimurium. Left, S1 conformation, which is postulated to form in low Mn²⁺. Right, S2 conformation, which is predicted to form in high Mn²⁺. Sequences in blue and red represent nucleotides that showed stronger modification by DMS in Mn²⁺-free and Mn²⁺-supplemented reactions through detection, respectively. Asterisks in red and pink represent nucleotides cleaved more after wild-type and stem-R[mut] UTR1 were incubated with Mn²⁺, respectively. Dashed line boxes in red and light blue represent repeated CAUAGC sequences that base pair alternatively with ⁵⁶GCUAUG⁶¹. Pink lines indicate a pseudoknit formed between ³⁴CAUAGC³⁹ and ⁵⁶GCUAUG⁶¹. Numbering represents the location from the +1 transcription site. The sequences highlighted in blue and yellow were the substitutions in stem-L[mut] and stem-R[mut], respectively. B, DMS treatment of the full-length UTR1 RNA. Wild-type and stem-R[mut] UTR1 were incubated with 0 (−) or 0.35 mm (+) Mn²⁺. M corresponds to a ladder prepared from a Maxam-Gilbert A+G reaction. U is the untreated sample. The blue and red arrowheads indicate nucleotides in wild-type UTR1 that are modified by more Mn²⁺-free and Mn²⁺-supplemented reactions, respectively. The numbers represent the nucleotides located in the UTR1. The corresponding modification ratio (+Mn²⁺/−Mn²⁺) is calculated and shown in the right panel. C, the predicted secondary structure of substituted stem-R[mut] UTR1, which was similar to wild-type S1 except for the pseudoknit. D, comparative DMS analysis of the UTR1 RNA treated with Mn²⁺, Mg²⁺, and Ca²⁺, respectively. Each reaction was supplemented with only one of the given cations and carried out similar to those shown in B. Mn²⁺ was added to 0.01 mm (L) and 0.35 mm (H), respectively; Mg²⁺ was added to 0.35 mm (L) and 3.5 mm (H), respectively; and Ca²⁺ was added to 0.01 mm (L) and 0.35 mm (H), respectively.

We carried out structural mapping using full-length UTR1 RNAs folded in a buffer supplemented without (−Mn) (Fig. 5B, −) or with 0.35 mm Mn²⁺ (+Mn) (Fig. 5B, +). The folded RNA was treated with DMS, which modifies RNA by methylating unpaired adenosines, cytidines, and guanosines. We tested wild-type RNA and observed that nucleotides A⁵², A⁵³, A⁵⁴, and G⁵⁵ were modified 2.8-, 3.5-, 5.3-, and 7.2-fold more, respectively, in Mn²⁺-treated RNA than in Mn²⁺-free RNA (Fig. 5B, lanes 4 and 3, upper panel, and quantified data in lower panel). These results are consistent with the predicted conformation in which they are located in the terminator loop T formed in S2 and thus are likely unpaired and modified more by DMS in +Mn (i.e. high Mn²⁺). On the other hand, A⁵², A⁵³, A⁵⁴, and G⁵⁵ are paired in stem C formed in S1, and indeed, they are modified less by DMS in −Mn (i.e. low Mn²⁺). Contrastingly, A⁴⁹ and G⁵⁰ were predicted to be located in terminator stem T and paired in S2 but unpaired in a single-strand region of S1; thus they are likely modified less by DMS in +Mn than in −Mn. Consistently, our results showed that A⁴⁹ and G⁵⁰ were modified 4.7- and 7.2-fold less, respectively, in Mn²⁺-treated RNA than in Mn²⁺-free RNA (Fig. 5B, lanes 4 and 3).

Unlike the wild-type RNA, DMS modified A⁵², A⁵³, A⁵⁴, and G⁵⁵ from stem-R[mut] UTR1 poorly but similarly in both −Mn and +Mn (Fig. 5B, lanes 6 and 7). This suggests that Mn²⁺ could not induce stem switching in this substituted UTR1, and we predicted that these nucleotides would remain paired within stem-loop C′ regardless of the Mn²⁺ concentration (Fig. 5C). We reasoned that this conformation was thermodynamically favored in this substituted UTR1 because the free energy reduction in stem-loop C′ (ΔG, −7.7 Kcal/mol, estimated using the Mfold tool) was greater than that in another conformation (∼ΔG, −3.8 Kcal/mol), which could only form stem-loops D and E as in wild-type S2 (ΔG, −9.6 Kcal/mol) but not T (ΔG = −5.8 Kcal/mol).

UTR1 Forms Terminator Structure through a Mn²⁺ Riboswitch

We found two CAUAGC sequences in UTR1, representing nucleotides 34–39 and 46–51 and alternatively base-pairing stem-R sequence ⁵⁶GCUAUG⁶¹ (Fig. 5A, sequences in dashed-line boxes in red and blue, respectively). We proposed that switching their base-pairing would contribute to the regulatory function of UTR1. In S1, the ³⁴CAUAGC³⁹ sequence is located in loop C, meanwhile forming a pseudoknot through pairs with stem-R sequence and thus playing a role as anti-terminator by preventing the formation of a terminator structure (Fig. 5A). Instead, the ⁴⁶CAUAGC⁵¹ sequence, i.e. stem-L, base-pairs with stem-R in S2 to form the terminator (Fig. 5A). Consistently, RNA probing results showed that the stem-R sequence remained paired and could not be modified by DMS in either Mn²⁺-free or Mn²⁺-treated RNAs (Fig. 5B, lanes 3 and 4). The conformational change is also shown by nucleotide A²⁹, which is predicted to be paired in stem A in S1, is switched to become unpaired in loop E in S2, and is modified 3.1-fold more in Mn²⁺-treated RNA than Mn²⁺-free RNA. On the contrary, C²¹ and A²², which appear to be unpaired in loop A in S1, but paired in stem E in S2, are modified 7.2- and 7.4-fold less, respectively, in Mn²⁺-treated RNA than Mn²⁺-free RNA (Fig. 5B, lanes 4 and 3). On the other hand, C²¹ and A²² in stem-R[mut] UTR1 were modified significantly by DMS in both low and high Mn²⁺, and the level of modification was similar to that in Mn²⁺-free wild-type RNA; meanwhile, A²⁹ remained unmodified under the Mn²⁺ concentrations tested (Fig. 5B, lanes 6 and 7). This demonstrates that loss of the riboswitch due to inability to form stem-loop T is a reason to keep stem-R[mut] UTR1 in the thermodynamically favorite conformation regardless of Mn²⁺ (Fig. 5C). An in vitro transcription assay using the stem-L[mut] template showed that the runoff RNA could be reduced to 92 and 88% in 0.1 and 0.2 mm Mn²⁺, respectively (Fig. 4C, lanes 5 and 6). We postulate that lack of the stem-L sequence ⁴⁶CAUAGC⁵¹ may allow the alternative CAUAGC sequence, i.e. ³⁴CAUAGC³⁹, to base pair the stem-R sequence ⁵⁶GCUAUG⁶¹ (the same base-pairing occurred in the pseudoknot structure of S1 (Fig. 5A)), resulting in the formation of an alternative stem-loop followed by the poly(U) sequence ⁶²UUUU⁶⁵. Thus, this structure could be an alternative terminator and facilitate termination of stem-L[mut] transcription, despite its functioning less efficiently than stem-loop T (88% of the runoff RNA in the mutant versus 27% in the wild type from reactions containing 0.2 mm Mn²⁺; Fig. 4C, lanes 6 and 3). On the other hand, this alternative terminator could not be formed in vivo, probably for some unknown reason, because lacZ expression remained similar to the strains carrying pYS1331 grown in the medium regardless of Mn²⁺ (Fig. 3A). Unlike the stem-L[mut] UTR1, elimination of ⁵⁶GCUAUG⁶¹ resulted in the inability of the stem-R[mut] UTR1 to form either terminator structure and thus could not mediate transcription termination in vivo and in vitro (Figs. 3A and 4C).

It is worth pointing out that Mg²⁺ was supplemented as a component in the RNA structural mapping reaction of Fig. 5B for the sake of the UTR1 transcription in vitro, which requires this cation. Thus, we carried out additional structural mapping using only one given divalent cation to fold wild-type UTR1 RNA. 0.01 mm Mn²⁺ (referred to as low Mn²⁺ hereinafter), also at a level analogous to the cytoplasmic concentration under the physiological condition (1), caused the UTR1 conformation to resemble that of S1, because the same set of nucleotides was modified similarly by DMS (Fig. 5D, lane 3, arrowheads) as those in the Mg²⁺-containing condition without supplementing Mn²⁺ (Fig. 5B, lane 3). Concomitantly, the addition of 0.35 mm Mn²⁺ (a concentration presumably falling in the range accumulated in the cytoplasm when Mn²⁺ uptake was enhanced; see Ref. 1) caused C²¹, A²², A⁴⁹, and G⁵⁰ to be modified less by DMS and A²⁹, A⁵², A⁵³, A⁵⁴, and G⁵⁵ to be modified more (Fig. 5, B and D, lanes 4), indicating that this high Mn²⁺ level likely enhances UTR1 to form the same S2 structure in Mg²⁺-depleted and Mg²⁺-containing conditions.

We also compared modifications of UTR1 treated by Mn²⁺ as well as Mg²⁺ and Ca²⁺. We chose 0.35 and 3.5 mm Mg²⁺ to investigate the UTR1 folding; these were used previously as low and high Mg²⁺ conditions in structural mapping of the mgtA 5′-LR, respectively (26). In comparison to the stem-loop T region in S1 and S2 (Fig. 5A), A⁵², A⁵³, A⁵⁴, and G⁵⁵, which were paired in stem C formed in S1 and unpaired in loop T formed in S2, were indeed modified less in low Mg²⁺ than in high Mg²⁺ (Fig. 5D, lanes 5 and 6). On the other hand, A⁴⁹ and G⁵⁰, which resided in ⁴⁶CAUAGC⁵¹ (stem-L), were modified more in high Mg²⁺ than in low Mg²⁺, suggesting that they stayed in a single-strand region in high Mg²⁺. This contrasted with the Mn²⁺-treated reaction (Fig. 5D, lane 4), in which this switching sequence formed stem T (i.e. paired) in S2 (Fig. 5A). Thus, we postulated that Mg²⁺ is unlikely to facilitate the formation of an intact terminator structure. In addition, we mapped the conformation of UTR1 treated with 0.01 mm (i.e. low) and 0.35 mm (high) Ca²⁺, respectively. We observed that more nucleotides could be modified by DMS after the RNA was treated in both Ca²⁺ conditions (Fig. 5D, lanes 8 and 9). Particularly, both the stem-L and stem-R regions could still be modified in high Ca²⁺ (Fig. 5D, lane 9), probably due to the relaxed structure of the UTR1. Thus, it is also unlikely for this cation to induce a terminator structure in the UTR1.

Mn²⁺-facilitated Cleavage at the Specific Nucleotides of the UTR1

Specific divalent metal cations have been shown to induce site-specific cleavage when they bind tRNAs (41–43). Particularly, Mn²⁺ can induce hydrolysis of yeast tRNA^Phe and Elongator tRNA^Met, mainly in their D-loops, and also tRNA^Glu in the anticodon loop (43). We incubated UTR1 RNA in a buffer supplemented with varying amounts of Mn²⁺ to examine whether Mn²⁺ could facilitate specific cleavage of UTR1 RNA when it interacted with the riboswitch domain. Specific nucleotides in which the Mn²⁺-facilitated cleavage took place were characterized by monitoring truncated UTR1 fragments generated from wild-type full-length UTR1 RNA. We observed RNA fragments containing 47-, 54-, and 55-nt UTR1, respectively, in which the level was proportional to the Mn²⁺ concentration supplemented (Fig. 6A, lanes 2–4), indicating that Mn²⁺ induced a strong cleavage of the 3′,5′-phosphodiester bond at nucleotides A⁴⁷, A⁵⁴, and G⁵⁵ in a concentration-dependent manner; these are located in stem-loop T (Fig. 5A). The effect of this ligand was validated by supplementation of EDTA, which significantly reduced cleavage at these sites (Fig. 6A, lane 5). However, all three of these sites were seldom cleaved when stem-R[mut] UTR1 was incubated with Mn²⁺ at the same levels as for wild-type UTR1. It is worth pointing out that the nucleotides at these sites keep the same nucleotides in the wild type and the substituted UTR1 (Fig. 5, A and C). This suggests that cleavage would take place only if nucleotides 47, 54, and 55 were placed in stem-loop T. We also observed minor cleavages occurring at U¹⁷ and G⁴² (Fig. 6A, lane 4). Interestingly, all five of these nucleotides are located in base-paired stem regions in S1 (the conformation without Mn²⁺ ligand), but two of them, A⁵⁴ and G⁵⁵, are switched to loop T region in S2. We reasoned that the loop nucleotides might be flexible for Mn²⁺ binding. In stem-R[mut] UTR1, the strong cleavage sites were U¹⁷ and C²⁷, which could be weakly or rarely cleaved in wild-type UTR1 (Fig. 6A, lanes 9 and 4). Although it remains to be investigated whether specific cleavage of the UTR1 would reflect a direct Mn²⁺ interaction with these specific nucleotides, we postulated that Mn²⁺ could bind to central atoms adjacent to specific cleavage sites located in stem-loop T in wild-type UTR1, but located in to stem-loop A in R[mut] UTR1. The products derived from cleavage at A⁴⁷, A⁵⁴, and G⁵⁵ could not be detected when wild-type UTR1 was incubated with the same amount of Mg²⁺ or Ca²⁺ (Fig. 6B, lane 2 versus lanes 3 and 4), which again demonstrates that the UTR1 is a riboswitch that is highly specific to Mn²⁺.

FIGURE 6.

Mn²⁺-facilitated cleavage of the UTR1 in vitro. A, cleavage of wild-type and stem-R[mut] UTR1 RNA in mixtures supplemented with 0, 0.1, 0.2 mm Mn²⁺, and 0.2 mm Mn²⁺ plus 0.5 mm EDTA. Numbered nucleotides indicate their positions in the UTR1. B, cleavage of wild-type UTR1 RNA in mixtures supplemented with 0.2 mm Mn²⁺, Mg²⁺ and Ca²⁺. M corresponds to a ladder prepared from a Maxam-Gilbert A+G reaction. U is untreated sample.

Salmonella mgtA Mg²⁺ Riboswitch Can Sense Mn²⁺

In vitro, Mn²⁺ can induce similar folding of the Mg²⁺ riboswitch characterized from B. subtilis mgtE (27). However, a previous finding showed that Mn²⁺ is unable to repress a mgtA transcription in Salmonella, which is controlled by its leader region (26). We reasoned that 0.025 mm Mn²⁺ supplemented in the experiment could not raise the cytoplasmic concentration of Mn²⁺ over a threshold level to act on this riboswitch. Thus, we introduced a plasmid (pYS1008) carrying the mntH-FLAG fusion gene under the control of promoter P_lac into the wild-type strain carrying pYS1010. Overexpression of mntH to facilitate Mn²⁺ uptake significantly inhibited the expression of lacZ controlled by mgtA 5′-LR, as β-galactosidase activity in the wild-type strain carrying pYS1010 and pYS1008 was 25-fold lower than that carrying pYS1010 and pUHE21 (vector) when bacteria were grown in N medium with 0.01 mm Mg²⁺ (a low Mg²⁺ condition allowing transcription to pass through the 5′-LR (26)), 0.01 mm Mn²⁺, and IPTG (Fig. 7A, right panel, column 2 versus 1). On the other hand, lacZ expression remained similarly activated in the strains harboring pYS1010, and either pYS1008 or pUHE21, when they were grown in the medium with low Mg²⁺ and IPTG but without 0.01 mm Mn²⁺ (Fig. 7A, left panel, column 2 versus 1), indicating that only overexpression of mntH without adding Mn²⁺ was unable to repress this lacZ transcription. It has been shown that Asp³⁴ and Glu¹⁰² residues are conserved in Salmonella and E. coli and are essential for MntH-dependent Mn²⁺ transport (45). We constructed two pYS1008 derivatives, pYS1013 and pYS1014, which directed the synthesis of two substituted MntH proteins in which Asp³⁴ and Glu¹⁰² were changed to Glu³⁴ and Asp¹⁰², i.e. D34E and E102D, respectively. Expression of lacZ was similar in the wild-type strain harboring pYS1010 and pYS1008 or one of its derivatives under the low Mg²⁺ condition without added Mn²⁺ but with IPTG (Fig. 7B, columns 1–3, left panel). When 0.01 mm Mn²⁺ was added to the strain harboring pYS1010 and wild-type pYS1008, β-galactosidase activity was reduced ∼24-fold (Fig. 7B, column 1, right panel versus column 1, left panel). However, Mn²⁺ supplementation could not change lacZ expression in the strain harboring pYS1010 and pYS1013 or pYS1014, as β-galactosidase activity remained similar in these strains regardless of Mn²⁺ (Fig. 7B, columns 2 and 3, right panel versus columns 2 and 3, left panel). Although expression of D34E or E102D MntH was unable to repress mgtA 5′-LR transcription, immunoblot results showed that the level of mutated MntH protein produced was similar to that of the wild-type protein under the same inducing condition, all of which was much higher than the level of MntH expressed from the chromosomal locus (Fig. 7C). These results indicate that mgtA Mg²⁺ riboswitch can sense Mn²⁺ when Mn²⁺ uptake is enhanced by MntH transporter. It has been shown that mgtA 5′-LR forms a stem-loop B at high cytoplasmic Mg²⁺ concentrations to mediate transcription termination (26). We sought to determine whether mgtA 5′-LR also requires this stem-loop by constructing a pYS1010 derivative, pYS1011, which carried a substituted right arm of stem-loop B. Under low Mg²⁺ and IPTG-containing conditions, Mn²⁺ supplementation reduced β-galactosidase activity in the wild-type strain harboring pYS1010 and pYS1008 by ∼23-fold (Fig. 7B, column 1, right panel versus column 1, left panel), whereas β-galactosidase activity remained similar in the strain harboring pYS1011 and pYS1008 grown under the same conditions regardless of Mn²⁺ (Fig. 7D, column 2, right panel versus left panel). Also, we conducted an in vitro transcription assay to determine whether mgtA 5′-LR could sense Mn²⁺ and Ca²⁺ in addition to Mg²⁺. When transcription of the full-length mgtA 5′-LR was initiated by P_lac1–6, consistent with a previous observation (26), the reactions with a low Mg²⁺ condition (0.35 mm) mainly produced a 264-nt runoff RNA (Fig. 7E, lanes 1, 3, and 5, respectively, marked −), and a high Mg²⁺ condition (3.5 mm) strongly facilitated transcription termination to produce a 220-nt truncated RNA (Fig. 7E, lane 2, +). Adding either 0.35 mm Mn²⁺ or Ca²⁺ to the low Mg²⁺ reaction induced the 220-nt truncated product to a level similar to that of Mg²⁺ (Fig. 7E, lanes 4 and 6 versus lane 2). Taking these findings together, we concluded that Mn²⁺ and Ca²⁺, just like Mg²⁺, are able to act on mgtA 5′-LR in a manner similar to Mg²⁺ and that the mgtA Mg²⁺ sensor should be considered a general divalent cation sensor.

FIGURE 7.

The Salmonella mgtA Mg²⁺ riboswitch also responds to cytoplasmic Mn²⁺ in a manner similar to Mg²⁺. A, β-galactosidase activity was determined in the wild-type strain harboring pYS1010 and pYS1008 (pmntH). Bacteria were grown for 6 h in N medium (0.01 mm Mn²⁺) supplemented with 0.5 mm IPTG and 0 or 0.01 mm Mn²⁺. B, β-galactosidase activity was determined in mntH-FLAG corA-FLAG strain (YS10211) harboring pYS1010 and pYS1008 (pmntH) or one of the pYS1008 derivatives (pYS1013 (D34E) or pYS1014 (E102D)) grown under the same conditions as in A. C, immunoblot analysis of MntH protein. The level of MntH-FLAG protein from the cultures in B was determined by Western blot. M2 anti-FLAG antibodies (Sigma) were used. Cellular lysate of the wild type (14028s) was used as a negative control of MntH-FLAG (shown as C). Production of CorA-FLAG is dependent on expression of MntH. The mntH-FLAG corA-FLAG strain harboring pUHE21 (vector) was used as a negative control of heterogeneous overproduction of MntH-FLAG (shown as −). D, β-galactosidase activity was determined in wild-type strain 14028s harboring pYS1008 and pYS1010 or pYS1011 grown in N medium (0.01 mm Mg²⁺) supplemented with 0.5 mm IPTG and 0 or 0.01 mm Mn²⁺. E, in vitro transcription of a template harboring the P_lac1–6 promoter and the full-length wild-type mgtA 5′-LR sequence conducted in buffer containing 0.35 mm Mg²⁺ without (−) or with (+) the addition (3.5 mm) of one of the tested divalent cations.

Concluding Remarks

The discovery of the Mn²⁺ riboswitch from the Salmonella mntH gene should provide new insights into specific transcriptional regulation employing riboswitches to respond to specific divalent metal cations. It also reveals a feedback genetic control, which modulates the transcription of the bacterial Mn²⁺ transporter gene through control of the elongation step by sensing Mn²⁺. As transcription of the mntH gene is regulated in response to not only Mn²⁺ but also other cations, the biological significance of the Mn²⁺ riboswitch may lie in the selective sensing of Mn²⁺ but not of other divalent cations that can be transported through MntH. Mn²⁺ also interacts with a Mg²⁺ riboswitch in Salmonella, mgtA 5′-LR, and modulates transcription of the coding region of the Mg²⁺ transporter. This suggests a coordinating regulation that contributes to the maintenance of divalent cation homeostasis by which Salmonella can modulate the level of cytoplasmic Mg²⁺ and probably some other divalent cations by responding to Mn²⁺.

In Fig. 5A we have summarized a working model that describes the regulatory action of the UTR1. In low Mn²⁺, ³⁴CAUAGC³⁹ and the following ⁴⁰AUG⁴² sequence play the role of anti-terminator motifs in S1, in which ⁴⁰AUG⁴² base-pairs ⁴⁶CAU⁴⁸ to form stem-loop B, and ³⁴CAUAGC³⁹ base-pairs ⁵⁶GCUAUG⁶¹; together they prevent these two sequences from forming terminator stem-loop T. In high Mn²⁺, on the other hand, the anti-terminator ²⁰UCAU²³ and the following ²⁴UAU²⁶ base-pair anti-terminator motifs to form stem-loop E in S2, which allows ⁴⁶CAU⁴⁸ as well as ⁴⁹AGC⁵¹ to pair with ⁵⁶GCUAUG⁶¹ and form stem-loop T.

Two independent mechanisms most likely participate in the regulation of the mntH expression in response to the cytoplasmic Mn²⁺ through transcription initiated from the +1 transcription start site. Low levels of cellular Mn²⁺ allow transcription to take place when the R1 sequence is not occupied by MntR. Synthesis of MntH transporter will facilitate uptake of Mn²⁺, which causes an accumulation of cytoplasmic Mn²⁺. The Mn²⁺ ion then binds to UTR1 as a nascent transcript, thus acting on its riboswitch motif to terminate mntH transcription before it arrives at the mntH coding region. We postulate that UTR1 serves as a fine-tuning device. When cytoplasmic Mn²⁺ reaches further, to a higher level, it will activate MntR. Then, this regulator will bind to R1 and repress the transcription initiation from +1. At that time point, it remains to be investigated how MntR can differentiate the transcription initiated alternatively from +1 and +1′. Although the Fur-box is located proximally downstream of +1, it is unlikely to regulate the Mn²⁺-dependent transcription of mntH because Fur responds to Fe²⁺ but not Mn²⁺ (18, 19).