Skip to main content
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2014 Mar 5;289(16):11497–11511. doi: 10.1074/jbc.M113.531921

Phosphatidic Acid (PA)-preferring Phospholipase A1 Regulates Mitochondrial Dynamics*

Takashi Baba ‡, Yuriko Kashiwagi ‡, Nagisa Arimitsu ‡, Takeshi Kogure ‡, Ayumi Edo ‡, Tomohiro Maruyama ‡, Kazuki Nakao §, Hiroki Nakanishi , Makoto Kinoshita ‖, Michael A Frohman **, Akitsugu Yamamoto ‡‡, Katsuko Tani ‡,1
PMCID: PMC4036285  PMID: 24599962

Background: Phosphatidic acid (PA) is involved in membrane dynamics.

Results: PA-preferring phospholipase A1 (PA-PLA1) affects mitochondrial morphology in an activity-dependent manner. Gene disruption of PA-PLA1 in mice causes sperm malformation due to mitochondrial organization defects.

Conclusion: PA-PLA1 regulates mitochondrial dynamics.

Significance: We demonstrate an in vivo function of PA-PLA1 and suggest a possible mechanism of PA regulation of the mitochondrial membrane.

Keywords: Membrane, Mitochondria, Phosphatidic Acid, Phospholipase A, Sperm

Abstract

Recent studies have suggested that phosphatidic acid (PA), a cone-shaped phospholipid that can generate negative curvature of lipid membranes, participates in mitochondrial fusion. However, precise mechanisms underling the production and consumption of PA on the mitochondrial surface are not fully understood. Phosphatidic acid-preferring phospholipase A1 (PA-PLA1)/DDHD1 is the first identified intracellular phospholipase A1 and preferentially hydrolyzes PA in vitro. Its cellular and physiological functions have not been elucidated. In this study, we show that PA-PLA1 regulates mitochondrial dynamics. PA-PLA1, when ectopically expressed in HeLa cells, induced mitochondrial fragmentation, whereas its depletion caused mitochondrial elongation. The effects of PA-PLA1 on mitochondrial morphology appear to counteract those of MitoPLD, a mitochondrion-localized phospholipase D that produces PA from cardiolipin. Consistent with high levels of expression of PA-PLA1 in testis, PA-PLA1 knock-out mice have a defect in sperm formation. In PA-PLA1-deficient sperm, the mitochondrial structure is disorganized, and an abnormal gap structure exists between the middle and principal pieces. A flagellum is bent at that position, leading to a loss of motility. Our results suggest a possible mechanism of PA regulation of the mitochondrial membrane and demonstrate an in vivo function of PA-PLA1 in the organization of mitochondria during spermiogenesis.

Introduction

Phosphatidic acid (PA)2 is a central intermediate for the synthesis of glycerophospholipids and triacylglycerol. Recent studies have indicated that PA is involved in a variety of physiological processes such as membrane trafficking and cell signaling. PA can be generated via several routes including the hydrolysis of phospholipids by phospholipase D (PLD), the phosphorylation of diacylglycerol by diacylglycerol kinase, and the acylation of lysophosphatidic acid (LPA) by lysophosphatidic acid acyltransferase (1, 2). PA can be metabolized to LPA by phospholipases A (PLA1 and PLA2) (3) and to diacylglycerol by PA phosphatases such as Lipin 1 (4). Moreover, PA acyl chains may undergo a cycle of deacylation and acylation by means of PLA1/A2 and lysophosphatidic acid acyltransferases, respectively, in the Lands cycle (3, 5).

Mitochondria are dynamic organelles, and their morphology is regulated by the balance between fusion and fission. These processes are mediated by GTPases: fusion of the outer and inner membranes is mediated by Mitofusin (Mfn) and Opa1, respectively, and fission is mediated by Drp1 (6). In mitochondria, PA can be generated from cardiolipin by the action of mitochondrial PLD (MitoPLD), a PLD family member found on the mitochondrial surface (7). Recent studies demonstrated that MitoPLD and Lipin 1 phosphatase reciprocally regulate the dynamics of mitochondria. It has been proposed that production of PA by MitoPLD facilitates Mfn-mediated fusion, whereas the consumption of PA and the production of diacylglycerol by Lipin 1 promote mitochondrial fission (8–10).

Intracellular PLA1 (iPLA1) proteins constitute a relatively recently discovered lipid-metabolizing enzyme family (11). Mammals have three iPLA1 family members (phosphatidic acid-preferring phospholipase A1 (PA-PLA1)/DDHD1 (12), KIAA0725p/DDHD2 (13), and p125/Sec23IP (14)). PA-PLA1, which is the iPLA1 first identified by Glomset and co-worker (15), preferentially hydrolyzes PA. PA-PLA1 is highly expressed in brain and testis, especially in mature but not in newborn testis, raising the possibility that PA-PLA1 is involved in spermatogenesis or sperm function (12, 15). But so far, the physiological role of PA-PLA1 has not been elucidated. Recent human genetic approaches revealed that mutations in the PA-PLA1 gene cause hereditary spastic paraplegia (16), an inherited neurodegenerative disorder characterized by slowly progressive lower limb spasticity and weakness (17). Tesson et al. (16) indicated a possible link between lipid metabolism in mitochondria and the appearance of hereditary spastic paraplegia symptoms.

In this study, we showed that PA-PLA1 regulates mitochondrial dynamics. Ablation of the PA-PLA1 gene caused defects in the organization of mitochondria during spermiogenesis, leading to sperm malformation and male subfertility.

EXPERIMENTAL PROCEDURES

Plasmid Construction

The mammalian expression plasmid for FLAG-tagged human PA-PLA1 was described previously (18). Ser-537 in human PA-PLA1 corresponds to the active site residue, Ser-540, in bovine PA-PLA1 (12). The human PA-PLA1 S537A mutant in which Ser-537 was replaced by Ala was constructed by site-directed mutagenesis. To express FLAG-tagged human PA-PLA1 and PA-PLA1 S537A in PA-PLA1 siRNA-transfected cells, the siRNA targeting sequences were changed by PCR-based site-direct mutagenesis as follows: AAGAGTTGCCTGATGAACGAT to AGGAACTTCCGGACGAGCGCT (letters underlined indicate nucleotides changed) for the PA-PLA1 siRNA5 site. The expression plasmids for the wild-type or mutant (H156N) MitoPLD, Raf1-PA binding domain (PABD)-EGFP, and Raf1-PABD mutant-EGFP were described previously (9). cDNAs encoding myc-tagged wild-type and mutant (H156N) MitoPLD were amplified by PCR and inserted into the pcDNA3 vector.

RNA Interference

The siRNA targeting sequences used for HeLa cells were as follows: Lamin A/C siRNA, CTGGACTTCCAGAAGAACA; PA-PLA1 siRNA2, AAGCCACATTAGAAGACAAGC; PA-PLA1 siRNA5, AAGAGTTGCCTGATGAACGAT; KIAA0725p siRNA2, GAAAGAAGATATTAAACTA; KIAA0725p siRNA3, GGAGAAAGTAGATAAGGAA. HeLa cells were transfected at a final concentration of 200 nm using Oligofectamine (Invitrogen) according to the manufacturer's protocol. Unless otherwise indicated, cells were fixed and processed at 72 h after transfection. The siRNA targeting sequences used for mouse embryonic fibroblasts (MEFs) were as follows: KIAA0725p siRNA1, GAAAGAAGATACTGAACCA; KIAA0725p siRNA5, GCGGATTGACTACGTGCTA. PA-PLA1 siRNA used for MEFs were obtained from Invitrogen (PA-PLA11, MSS201695; PA-PLA12, MSS201696). MEFs were transfected at a final concentration of 100 nm using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer's protocol. AllStars Negative Control siRNA (Qiagen) was used as a control. Cells were fixed and processed at 72 h after transfection.

HeLa Cell Culture and Transfection

HeLa cells were maintained in α-modified Eagle's minimal essential medium supplemented with 10% fetal bovine serum, 2 mm l-glutamine, and penicillin/streptomycin. Plasmids were transfected using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's protocol.

Analysis of the Mitochondrial Length

Cells were stained with an antibody against Tom20, and images were obtained by confocal microscopy and analyzed using ImageJ software. The average length of Tom20-positive tubules in the peripheral regions (20 × 20 μm2) was estimated.

Antibodies and Probes

GST-tagged full-length human PA-PLA1 was expressed in Sf9 cells and purified using glutathione beads. The purified protein was injected into BALB/c mice, and hybridoma cells producing antibodies against PA-PLA1 were obtained according to the standard protocol. Culture supernatants were used for the immunostaining of testis sections. Polyclonal antibodies against α-tubulin and FLAG were purchased from Abcam and Sigma-Aldrich, respectively. A polyclonal antibody against SEPT4 was described previously (19). Monoclonal antibodies against cytochrome c and Tom20 were obtained from BD Transduction Laboratories. Monoclonal antibodies against Drp1, Mfn1, and Mfn2 were obtained from BD Transduction Laboratories, Abnova, and Abcam, respectively. FITC-conjugated goat anti-mouse and Texas Red-conjugated goat anti-rabbit antibodies were purchased from Jackson ImmunoResearch Laboratories. Alexa Fluor 350-conjugated goat anti-rabbit and anti-mouse antibodies, Alexa Fluor 488-conjugated goat anti-mouse antibody, MitoTracker Red CMXRos, and MitoTracker Deep Red FM were purchased from Invitrogen. Hoechst 33342 and protonophore carbonyl cyanide m-chlorophenylhydrazone (CCCP) were obtained from Thermo Scientific and Wako Chemicals, respectively.

Lipid Analysis by Mass Spectrometry

Cells were collected by gently scraping with a rubber policeman. Subcellular fractionation was performed essentially as described previously (20), and the mitochondrial fractions were used for the lipid analysis. Protein concentration was determined by the bicinchoninic acid method. Total lipids were extracted by the method of Bligh and Dyer (29). PA and LPA were separated from total lipids using a DEAE-cellulose column. LC-electrospray ionization-MS/MS analysis was performed using a TSQ-Vantage (Thermo Fisher Scientific, Waltham, MA) with an UltiMate 3000 LC system (Thermo Fisher Scientific) equipped with an HTC PAL autosampler (CTC Analytics, Zwingen, Switzerland). This MS system was controlled by Xcalibur software. PA and LPA were measured by selected reaction monitoring in the negative ion mode. The amounts of PA and LPA were determined from the ratio of the peak area of each PA and LPA species to that of internal standards (14:0/14:0 PA and 17:0 LPA).

Generation of PA-PLA1 Knock-out Mice

A targeting vector (Clone PGS00049_B_D06) was obtained from the Knock-out Mouse Project (KOMP) Repository at the University of California Davis. The vector was electroporated into embryonic stem cells (TT2 cells). Two targeted cell lines were injected into ICR eight-cell stage embryos, and chimeric mice were obtained by the conventional method. All animal procedures and experiments were approved by the Animal Care Committee of Tokyo University of Pharmacy and Life Sciences and conducted according to the guidelines of the committee.

Histology

Mouse testes were fixed with 3.7% formaldehyde in PBS, dehydrated, and then embedded in paraffin. Paraffin sections (6 μm) were stained with hematoxylin and eosin (H&E) according to the standard protocol. For immunohistochemistry, testes were fixed with 4% paraformaldehyde in PBS and frozen in O.C.T compound (Tissue-Tek, Sakura, Japan). Cryosections (10 μm) were prepared and stained as described previously (21).

Preparation of Sperm

Cauda epididymis, caput epididymis, and testis were dissected in human tubal fluid medium and incubated with 5% CO2 at 37 °C for 1 h. Released sperm were washed with PBS and spread on poly-l-lysine-coated coverslips. Then the sperm were fixed with 4% paraformaldehyde for 20 min and used for light microscopy and immunofluorescence analysis. For the motility assay, released sperm were observed under an Olympus IX70 microscope, and images were recorded using an Olympus DP70 charge-coupled device camera.

Immunofluorescence and Microscopic Analyses

Immunofluorescence images were analyzed as described previously (22, 23). An Olympus FluoView 1000 laser scanning microscope was used for confocal microscopy. For electron microscopic analysis, cauda epididymis was sequentially fixed with 2.5% glutaraldehyde in 0.1 m phosphate buffer (pH 7.4) and with 1% OsO4 in the buffer. Electron microscopic analysis was performed as described previously (21).

Preparation of MEFs and Cell Culture

MEFs were isolated from E13.5 embryos by trypsinization and cultured in Dulbecco's modified Eagle's medium supplemented with 50 IU/ml penicillin, 50 μg/ml streptomycin, and 10% fetal calf serum. Two days after isolation, the cells were immortalized with SV40 large T antigen using a retrovirus expression system (24). The immortalized cells were cultured in medium containing 2 μg/ml puromycin.

RESULTS

PA-PLA1 Is Involved in Mitochondrial Dynamics

PA-PLA1 is predominantly expressed in mature testis and brain but also at low levels in other tissues including HeLa cells (Ref. 12 and Fig. 1A). To explore the function of PA-PLA1 in mitochondrial dynamics, PA-PLA1 with a FLAG tag was overexpressed in HeLa cells, and then mitochondrial morphology was examined by immunofluorescence microscopy. In control cells, mitochondria exhibited long tubular structures (Fig. 1B, top row). Upon overexpression of PA-PLA1, the tubular structures became fragmented (middle row). Of note is that this morphological change is activity-dependent. Overexpression of the S537A mutant of human PA-PLA1, which is equivalent to the S540A mutant of bovine PA-PLA1 that lacks phospholipase A1 activity (12), had no effect on mitochondrial morphology (bottom row).

FIGURE 1.

FIGURE 1.

PA-PLA1 regulates mitochondrial dynamics. A, lysates (50 μg each) of different mouse tissues (upper panel) and HeLa cells treated with Lamin A/C siRNA, PA-PLA1 siRNA2, or PA-PLA1 siRNA5 (lower panel) were analyzed by Western blotting with the indicated antibodies. B, HeLa cells were transfected with the empty FLAG plasmid (top), the plasmid encoding FLAG-PA-PLA1 (middle), or the FLAG-PA-PLA1 S537A mutant (bottom). At 24 h after transfection, cells were double stained with antibodies against FLAG and Tom20. Cells expressing FLAG-PA-PLA1 or FLAG-PA-PLA1 S537A mutant are indicated with asterisks. Scale bar, 10 μm. Quantitative data are shown at the bottom. Cells with fragmented mitochondria were counted under a fluorescence microscope. At least 100 cells were analyzed for each sample. Data represent the means ± S.D. for three independent experiments. Error bars represent S.D.

Next, HeLa cells were treated with siRNA targeting PA-PLA1, and then the morphology of mitochondria was examined. Western blotting verified the depletion of PA-PLA1 (Fig. 1A, lower panel). In cells transfected with PA-PLA1 siRNA2, elongation of the mitochondrial tubules was observed (Fig. 2A, middle row). In some cells, interconnected mitochondrial aggregates were detected in the perinuclear region (Fig. 2A, middle row, right column). A similar elongation and aggregation phenotype was observed for cells transfected with PA-PLA1 siRNA5 (bottom row). Upon knockdown of PA-PLA1, the percentage of cells with elongated or aggregated mitochondria was increased from about 10 to about 70% (Fig. 2A, bottom graph). The length of mitochondria in peripheral regions was increased 2.4-fold in cells transfected with PA-PLA1 siRNA (Fig. 2B). Mitochondrial elongation observed upon PA-PLA1 knockdown was significantly reversed by expression of siRNA-resistant PA-PLA1 but not siRNA-resistant S537A mutant (Fig. 2C).

FIGURE 2.

FIGURE 2.

Knockdown of PA-PLA1 induces elongation of mitochondria. A, HeLa cells were treated with the indicated siRNAs for 72 h and subsequently stained with an antibody against Tom20. Higher magnification views of the boxed areas are shown on the right (middle column). Scale bar, 10 μm. Cells were classified according to their mitochondrial morphology: intermediate (mitochondria with tubular structures, which were dominantly observed in control (Lamin A/C-treated) cells (top row, left column)), elongated (most mitochondria were elongated (middle and bottom rows, left column) and aggregated (most mitochondria were aggregated near the nucleus with long tubule extensions to the cell periphery (middle and bottom rows, right column)), and fragmented (most mitochondria were fragmented, and filamentous mitochondria were scarcely found). The bottom graph shows the percentages of cells with the indicated mitochondrial morphologies. Black, gray, and white bars indicate elongated and aggregated, intermediate, and fragmented morphologies, respectively. At least 100 cells were analyzed. Data represent the means ± S.D. for three independent experiments. B, HeLa cells were treated with the indicated siRNAs and stained as in A. The mitochondrial length in the peripheral regions was analyzed as described under “Experimental Procedures”. Twenty randomly selected cells were analyzed for each sample. Data represent the means ± S.D. for three independent experiments. C, HeLa cells were treated with PA-PLA15 siRNA or mock-treated for 48 h and then transfected with the indicated plasmids. At 24 h after transfection with the plasmid, the cells were fixed and stained with antibodies against cytochrome c and FLAG. Scale bar, 10 μm. The bottom graph shows the percentages of cells with the indicated mitochondrial morphologies. Black, gray, and white bars indicate elongated and aggregated, intermediate, and fragmented morphologies, respectively. At least 100 cells were analyzed for each sample. Data represent the means ± S.D. for three independent experiments. *, p < 0.05, Student's t test. D, HeLa cells were treated with the indicated siRNAs as in A and stained after incubation with 10 μm CCCP for 90 min. Scale bar, 10 μm. Error bars represent S.D.

Mitochondrial elongation, interconnection, and aggregation can occur when mitochondrial fusion is promoted or fission is inhibited (25–27). To further verify the effects of the depletion of PA-PLA1, HeLa cells were treated with CCCP. It has been reported that CCCP causes mitochondrial fragmentation in a Drp1-dependent manner (25). When PA-PLA1 siRNA2- or siRNA5-transfected cells were treated with CCCP, much less fragmentation of mitochondria was detected (Fig. 2D, middle and bottom rows) compared with control (Lamin A/C siRNA-treated) cells (top row). These results indicate that the overexpression and depletion of PA-PLA1 cause the fragmentation and elongation of mitochondria, respectively. Note that these effects depend on PA-PLA1 activity.

PA-PLA1 Counteracts the Action of MitoPLD on Mitochondria

MitoPLD is a mitochondrial surface PLD that produces PA via hydrolysis of cardiolipin (8). Overexpression of MitoPLD results in mitochondrial aggregation caused by the promotion of fusion events, whereas its siRNA-mediated knockdown results in mitochondrial fragmentation (8). Because PA-PLA1 is a cytosolic protein and shows phospholipase A1 activity against PA in vitro (12, 15, 23), it is plausible that PA-PLA1 hydrolyzes mitochondrial surface PA, thereby regulating mitochondrial morphology. To test this idea, we first analyzed the effects of coexpression of MitoPLD and PA-PLA1 on mitochondrial morphology (Fig. 3A). As reported previously (8), mitochondria became aggregated in the perinuclear region of MitoPLD-overexpressing cells (Fig. 3A, top row). When PA-PLA1 was coexpressed with MitoPLD, the mitochondrial aggregation was prevented, and mitochondria spread throughout the cell (middle row). The expression of the S537A mutant had no effect (bottom row). Quantitative data (Fig. 3A, graph) support this viewpoint. Western blotting showed that the expression level of MitoPLD was not affected by coexpression with PA-PLA1 or the S537A mutant (data not shown).

FIGURE 3.

FIGURE 3.

The ectopic expression of PA-PLA1 counteracts that of MitoPLD. A, HeLa cells were double transfected with the following plasmid/construct combinations: MitoPLD-myc and FLAG (top row), MitoPLD-myc and FLAG-PA-PLA1 (middle row), and MitoPLD-myc and FLAG-PA-PLA1 S537A mutant (bottom row). At 24 h after transfection, the cells were stained with MitoTracker Red CMXRos and antibodies against FLAG and myc. Representative images are shown. Scale bar, 10 μm. The graph shows the percentages of cells exhibiting perinuclear aggregation of mitochondria. At least 100 cells were evaluated for each sample. Data represent the means ± S.D. for three independent experiments. *, p < 0.05, Student's t test. B, HeLa cells were triple transfected with the following plasmid/construct combinations: Raf1-PABD-EGFP, pcDNA3, and FLAG (top row); Raf1-PABD-EGFP, pcDNA3, and FLAG-PA-PLA1 (second row); Raf1-PABD-EGFP, MitoPLD-myc, and FLAG (third row); Raf1-PABD-EGFP, MitoPLD H156N-myc, and FLAG (fourth row); Raf1-PABD mutant (mut)-EGFP, MitoPLD-myc, and FLAG (fifth row); Raf1-PABD-EGFP, MitoPLD-myc, and FLAG-PA-PLA1 (sixth row); and Raf1-PABD-EGFP, MitoPLD-myc, and FLAG-PA-PLA1 S537A mutant (bottom row). At 24 h after transfection, the cells were stained with antibodies against FLAG and myc. Representative images are shown. For cells expressing Raf1-PABD-EGFP, MitoPLD-myc, and FLAG (third row) or Raf1-PABD-EGFP, MitoPLD-myc, and FLAG-PA-PLA1 S537A mutant (bottom row), staining patterns of cells in which Raf1-PABD-EGFP is localized to mitochondria are presented. Scale bar, 10 μm. Cells with Raf1-PABD-EGFP on mitochondria were counted, and the quantitative data are shown. At least 100 cells were evaluated for each sample. Data represent the means ± S.D. for three independent experiments. **, p < 0.01, Student's t test. C, quantification of PA and LPA contents by mass spectrometry. HeLa cells were double transfected with the empty FLAG plasmid and pcDNA3, the empty FLAG plasmid and the plasmid encoding MitoPLD-myc, or the plasmid encoding FLAG-PA-PLA1 and pcDNA3. At 24 h after transfection, cells were collected. PA and LPA contents of mitochondrial fractions were measured by mass spectrometry as described under “Experimental Procedures.” Data represent relative intensities normalized by protein amount. The averages of two independent experiments are shown. Error bars represent S.D.

We next examined the effect of the expression of PA-PLA1 on mitochondrial surface PA. Raf1-PABD-EGFP is a fluorescent sensor for PA (28) and has been successfully used to detect mitochondrial surface PA generated by MitoPLD (9). When expressed alone, Raf1-PABD-EGFP was localized in the cytosol in many cells (Fig. 3B, top row) but targeted to mitochondria in 28% of Raf1-PABD-EGFP-expressing cells (Fig. 3B, graph). The association of Raf1-PABD-EGFP with mitochondria may be in part due to the hydrophobic nature of Raf1-PABD. Upon coexpression with MitoPLD, Raf1-PABD-EGFP was redistributed from the cytosol to mitochondria (Fig. 3B, third row), and the percentage of cells with Raf1-PABD-EGFP on mitochondria increased to 53%. The binding of Raf1-PABD-EGFP to mitochondria did not significantly increase when a phospholipase D activity-defective mutant (MitoPLD H156N) was expressed (fourth row) or when a Raf1-PABD mutant that lacks PA binding activity (9) was coexpressed with MitoPLD (fifth row). These results demonstrate the specificity of this fluorescent probe. When PA-PLA1 was coexpressed with Mito-PLD, the targeting of Raf1-PABD-EGFP to mitochondria decreased to the background level (second row from bottom). In contrast, the PA-PLA1 S537A mutant did not affect the targeting of Raf1-PABD-EGFP to mitochondria (bottom row). The targeting of MitoPLD to mitochondria occurred regardless of whether the expressed PA-PLA1 construct was the wild type (Fig. 3B, second column from left, second from the bottom row) or the mutant (bottom row), ruling out the possibility that the expression of PA-PLA1 prevents the attachment of MitoPLD to mitochondria. The expression of PA-PLA1 alone did not affect the localization of Raf1-PABD-EGFP (second row). Western blotting showed that the expression levels of MitoPLD and Raf1-PABD-EGFP were not affected by coexpression of PA-PLA1 or the S537A mutant (data not shown). These results suggest that PA-PLA1 cleaved PA produced by MitoPLD on the mitochondrial surface. Next, we measured mitochondrial PA and LPA by mass spectrometry. Mitochondrial fractions were prepared from control cells, MitoPLD-overexpressing cells, and PA-PLA1-overexpressing cells. LC-electrospray ionization-MS/MS analysis was performed as described under “Experimental Procedures.” As shown in Fig. 3C, no apparent differences in the content and composition of PA and LPA were observed among the mitochondrial fractions prepared from control, MitoPLD-, and PA-PLA1-overexpressing cells. These results indicate that the total PA content of mitochondria was not drastically changed upon the overexpression of either MitoPLD or PA-PLA1. Mitochondrial fission is regulated by Drp1, and the fusion is regulated by Mfn1/2 (6). To examine whether or not PA-PLA1 directly affects the distribution of these GTPases, PA-PLA1 was knocked down. As shown in Fig. 4A, treatment of cells with PA-PLA1 siRNA2 (middle panel) or PA-PLA1 siRNA5 (bottom panel) did not affect the distribution of Drp1. The enlarged images show that Drp1 was localized in constricted regions of elongated mitochondria (middle and bottom panels, insets). The PA-PLA1 depletion also did not affect the distribution of Mfn1 (Fig. 4B) or Mfn2 (Fig. 4C). Likewise, overexpression of PA-PLA1 caused little change in the distributions of these fission and fusion GTPases on mitochondria (data not shown).

FIGURE 4.

FIGURE 4.

Distributions of Drp1 and Mfn1/2 are not affected by depletion of PA-PLA1. HeLa cells were treated with the indicated siRNAs for 72 h and then double stained with an antibody against Drp1 (A), Mfn1 (B), or Mfn2 (C) and MitoTracker Red CMXRos. Insets are enlarged images of the boxed areas. Scale bar, 10 μm.

Male PA-PLA1−/− Mice Are Subfertile

To elucidate the in vivo function of PA-PLA1, PA-PLA1−/− mice were generated (Fig. 5). The targeting vector was designed to contain exon 8 flanked by two loxP sites. It also contained a splicing acceptor and a geo marker (a fusion between the β-galactosidase and neomycin resistance genes) between exons 7 and 8 of the mouse PA-PLA1 gene (Fig. 5A). Chimeric mice were obtained by the conventional method, and the male chimeric mice were mated with female wild-type C57BL/6J mice to obtain PA-PLA1+/geo offspring. Southern blotting verified insertion of the geo marker (Fig. 5B). Homozygous PA-PLA1geo/geo mice were obtained by intercrossing heterozygous mice. PA-PLA1geo/geo mice showed no significant defects. A slight reduction in fertility was observed in males, but it was not significant (Fig. 5E).

FIGURE 5.

FIGURE 5.

Subfertility of male PA-PLA1−/− mice. A, schematic representation of the wild-type (+), targeted (geo), and knock-out (−) alleles. The lipase consensus sequence SHSLG is encoded in exon 10. Cre-mediated deletion of exon 8 is supposed to cause a frameshift. Exons of the PA-PLA1 gene and loxP sequences are indicated by black boxes and closed triangles, respectively. FRT, Flp recombination target; SA, splice acceptor sequence of mouse engrailed 2; LacZ, β-galactosidase gene; Neor, neomycin resistance gene; pA, SV40 polyadenylation signal. B, Southern blot analysis of EcoRI-digested genomic DNA derived from the wild-type allele (+/+) and heterozygous targeted allele (+/geo). The 5′ probe in A recognized 13- and 16-kb fragments of the wild-type and targeted alleles, respectively. g denotes geo. C, Southern blot analysis of EcoRV-digested genomic DNA from the wild-type (+/+), heterozygous targeted (+/geo), homozygous targeted (geo/geo), heterozygous (+/−), and knock-out (−/−) alleles. The Neo probe in A recognized 3.3- and 20-kb fragments of the targeted and knock-out alleles, respectively. D, testis lysates (100 μg) were analyzed by Western blotting with a monoclonal antibody against PA-PLA1 and an anti-α-tubulin antibody. The bottom panel shows a longer exposure image. E, average litter size and pregnancy rate of PA-PLA1−/− mice. The numbers of matings were 55, 66, and 24 for male +/+, g/g, and −/−, respectively. ♀, female. The average litter sizes were calculated as the number of pups per number of matings. Error bars represent the S.E. for each set of crossing experiments. F, the average number of spermatozoa collected from the cauda epididymis. Data are means ± S.E. (+/+, n = 11; −/−, n = 10) (left graph). Testis weight was normalized as to body weight. Data are means ± S.E. (+/+, n = 9; −/−, n = 9) (right graph). G, H&E staining of seminiferous tubules of testes from PA-PLA1+/+ and PA-PLA1−/− mice. Scale bar, 40 μm.

We noticed that PA-PLA1geo/geo mice express a tiny amount of PA-PLA1 protein (Fig. 5D). To completely delete the PA-PLA1 gene, PA-PLA1+/geo mice were crossed with transgenic mice expressing Cre recombinase. Heterozygous mice (PA-PLA1+/−) were intercrossed to obtain PA-PLA1−/− mice. Southern blotting verified the loss of exon 8 (Fig. 5C). Western blotting demonstrated a complete loss of PA-PLA1 protein expression (Fig. 5D). PA-PLA1−/− mice were apparently normal. However, PA-PLA1−/− male mice were found to be subfertile (Fig. 5E). The number of sperm (Fig. 5F, left graph), testis weight (Fig. 5F, right graph), and germ cell arrangement in seminiferous tubules (Fig. 5G) were almost normal in PA-PLA1−/− mice.

PA-PLA1 Is Required for Sperm Tail Formation

We then analyzed spermatozoa collected from the cauda epididymis by differential interference contrast microscopy. Strikingly, spermatozoa from PA-PLA1−/− mice were sharply bent between the middle and principal pieces, exhibiting a hairpin-like structure (Fig. 6A). Microtubules were disrupted at that position (Fig. 6B), and about 90% of the spermatozoa from PA-PLA1−/− mice exhibited impaired movement (Fig. 6C). It has been reported that a defect in the annulus, a fibrous ring structure connecting the middle and principal pieces of the mammalian sperm flagellum (30), causes the structure to be bent between the middle and principal pieces (19). Staining with an antibody against SEPT4, a main structural component of the annulus (19), revealed that spermatozoa from PA-PLA1−/− mice possessed an annulus that was not attached to the mitochondrial sheath, whereas that in control mice was attached. A small gap structure, which was not stained with MitoTracker, was present between the mitochondrial sheath and the annulus in spermatozoa from PA-PLA1−/− mice (Fig. 6D, arrows).

FIGURE 6.

FIGURE 6.

Spermatozoa from PA-PLA1−/− mice are bent at the junction of the middle and principal pieces. A, differential interference contrast images of spermatozoa derived from the cauda epididymis of PA-PLA1+/+ and PA-PLA1−/− mice. The lower row shows enlarged images of the boxed areas in the upper row. Scale bar, 20 μm. B, spermatozoa from the cauda epididymis of PA-PLA1+/+ and PA-PLA1−/− mice were triple stained with Hoechst 33342 (blue), MitoTracker Red CMXRos (red), and anti-α-tubulin antibody (green). The lower row shows enlarged images of the boxed areas in the upper row. Scale bar, 20 μm. C, motility of spermatozoa derived from the cauda epididymis was recorded for 10 s. At least 100 spermatozoa were assessed. The data are the averages for two independent experiments. D, spermatozoa collected from the cauda epididymis of PA-PLA1+/+ and PA-PLA1−/− mice were triple stained with Hoechst 33342 (blue), anti-SEPT4 antibody (green), and mitochondrial membrane potential-sensitive dye MitoTracker Red CMXRos or mitochondrial membrane potential-insensitive dye MitoTracker Deep Red FM (red). Arrows indicate the sites where the MitoTracker staining was absent. Scale bar, 20 μm.

PA-PLA1 Is Involved in the Organization of Mitochondria during Spermiogenesis

To elucidate how loss of PA-PLA1 causes the abnormal structure comprising a bent sperm flagellum, we first examined at which stage PA-PLA1 is expressed during spermatogenesis. The PA-PLA1 protein was detected in testicular cells but not in the cauda epididymis containing mature sperm (Fig. 7A). The expression of PA-PLA1 was further examined by immunostaining of cross-sections of seminiferous tubules with a monoclonal antibody against PA-PLA1. Results showed that PA-PLA1 protein was expressed in round and elongating spermatids but not in spermatocytes or spermatogonia (Fig. 7B, top row). Relatively strong staining was observed at stages IX–XII of the cycle of seminiferous epithelium (31), which contained elongating spermatids (steps 9–12).

FIGURE 7.

FIGURE 7.

Stage-specific expression of PA-PLA1 during spermatogenesis. A, total protein lysates (50 μg) of testis and cauda epididymis were analyzed by Western blotting. B, testis sections from PA-PLA1+/+ and PA-PLA1−/− mice were double stained with a monoclonal antibody against PA-PLA1 (green) and Hoechst 33342 (blue). Staining patterns of stages I–VI, VII-VIII, and IX–XII of the seminiferous epithelium cycle are shown. The intense staining between seminiferous tubules is due to nonspecific binding of secondary antibody. No staining was observed in PA-PLA1−/− cross-sections (third row), indicating the specificity of the antibody. Scale bars, 40 μm.

Spermatozoa formed in the testis enter the caput epididymis and then migrate to the cauda region where they are stored. To clarify when the hairpin-like structure is created, we compared the shapes of spermatozoa collected from the testis, caput epididymis, and cauda epididymis of PA-PLA1−/− mice. As shown in Fig. 8A, the ratio of spermatozoa with the hairpin-like structure increased as sperm migrated from the testis to the cauda region. The ratio of spermatozoa with an abnormal microtubule structure increased similarly (Fig. 8B). Most of the spermatozoa from PA-PLA1−/− testis and caput epididymis were found to have a straight junction between the middle and principal pieces (Fig. 8A). In these spermatozoa, a narrow segment adjacent to the mitochondrial sheath was observed, and the mitochondrial sheath and principal piece were separated by this short region (Fig. 8A, enlarged image, arrowheads). This narrow segment corresponds to the gap structure between the mitochondrial sheath and the annulus (Fig. 6D, arrows). As shown in Fig. 8C, the lengths of the mitochondrial sheaths of spermatozoa prepared from testis, caput epididymis, and cauda epididymis of PA-PLA1−/− mice were almost identical but were shorter than those in PA-PLA1+/+ mice. These results suggest that the shortened mitochondrial sheath is the cause of the gap structure between the middle and principal pieces.

FIGURE 8.

FIGURE 8.

PA-PLA1 deficiency produces an abnormal mitochondrial sheath. A, differential interference contrast images of spermatozoa derived from the testis (top row), caput epididymis (middle row), and cauda epididymis (bottom row) of PA-PLA1+/+ and PA-PLA1−/− mice. Insets show enlarged images of the boxed areas. Arrowheads indicate the segment between the mitochondrial sheath and the principal piece. Scale bar, 20 μm. Quantitative data are shown at the bottom. At least 100 spermatozoa were counted for each sample. Data are means ± S.D. (n = 3). B, spermatozoa from PA-PLA1+/+ and PA-PLA1−/− mice were double stained with Hoechst 33342 (blue) and anti-α-tubulin antibody (green). Arrowheads indicate an abnormal microtubule structure. Scale bar, 20 μm. Quantitative data are shown at the bottom. At least 100 spermatozoa were counted for each sample. Data are means ± S.D. (n = 3) C, spermatozoa from PA-PLA1+/+ and PA-PLA1−/− mice were double stained with Hoechst 33342 (blue) and MitoTracker Red CMXRos (red). Images were captured with an Olympus DP70 charge-coupled device camera attached to an Olympus IX70 microscope, and the length of the mitochondrial sheath was determined using ImageJ software. Quantitative data are shown in the bottom graph. Three mice were analyzed for each genotype. For each mouse, 20 spermatozoa were analyzed. Data are means ± S.D. D, spermatozoa from the cauda epididymis of PA-PLA1+/+ and PA-PLA1−/− mice were analyzed by electron microscopy. Upper row scale bar, 2 μm; lower row scale bar, 1 μm. Error bars represent S.D.

The sperm defects found in PA-PLA1−/− mice are quite similar to those recently reported in mitochondrial glutathione peroxidase 4 (mGPx4) knock-out mice (32, 33). mGPx4 is a structural component of the sperm mitochondria capsule. Spermatozoa of mGPx4 knock-out mice have a truncated mitochondrial sheath, and their mitochondrial structure is irregular and swollen. To examine the structure of mitochondria in spermatozoa from PA-PLA1−/− mice, electron microscopy was performed. Results showed that mitochondria in spermatozoa from PA-PLA1−/− mice are irregular and aligned in a disorganized manner (Fig. 8D). Overall, it is most likely that spermatozoa produced in PA-PLA1−/− mice testes possess a disorganized mitochondrial sheath. Because of the absence of rigid connection between the middle and principal pieces, PA-PLA1-deficient spermatozoa may become bent during their migration to the cauda epididymis and/or when their flagella start moving in the cauda epididymis. These results suggest the importance of PA-PLA1 in the mitochondrial organization during spermiogenesis.

KIAA0725p Is Involved in the Mitochondrial Dynamics in MEFs

We examined whether mitochondrial morphology is also affected in MEFs derived from PA-PLA1−/− mice. In contrast to spermatids, no apparent morphological change in mitochondria was observed (Fig. 9).

FIGURE 9.

FIGURE 9.

Mitochondrial morphology in PA-PLA1−/− MEF cells. MEFs isolated from PA-PLA1+/+ and PA-PLA1−/− mice were stained with an antibody against cytochrome c. Two independent cell lines were analyzed for each genotype.

KIAA0725p is a member of the iPLA1 family and, like PA-PLA1, shows phospholipase A1 activity against PA in vitro (13, 23). KIAA0725p is expressed broadly in many tissues (13). To test the possibility that KIAA0725p is also involved in mitochondrial dynamics, KIAA0725p was knocked down in HeLa cells (Fig. 10A). Differing from the case of PA-PLA1, siRNA-mediated knockdown of KIAA0725p did not cause the elongation or aggregation of mitochondria. We showed previously that the subcellular localization of KIAA0725p is different among cell lines (22). In HeLa cells, KIAA0725p is localized to the Golgi and the cytosol, whereas it is predominantly localized to the cytosol in MEFs. We next examined the effects of KIAA0725p depletion in MEFs. MEFs were treated with siRNAs targeting PA-PLA1 or KIAA0725p, and then the morphology of mitochondria was examined (Fig. 10B). siRNA-mediated knockdown of PA-PLA1 did not cause significant changes in mitochondrial morphology in MEFs. Instead, elongation of mitochondrial tubules was observed in MEFs transfected with KIAA0725p siRNA1 (Fig. 10B, fourth row) and siRNA5 (bottom row). In some cells, interconnected mitochondrial aggregates were detected in the perinuclear region (Fig. 10B, fourth and bottom rows, right column). These results suggest that KIAA0725p is involved in the regulation of mitochondrial morphology in MEFs.

FIGURE 10.

FIGURE 10.

KIAA0725p regulates mitochondrial dynamics in MEFs. HeLa cells (A) or MEFs (B) were treated with the indicated siRNAs for 72 h and subsequently stained with an antibody against cytochrome c. Higher magnification views of the boxed areas are shown on the right. Scale bar, 10 μm. B, quantitative data are shown at the bottom. Cells in which most mitochondria were elongated or aggregated were counted. At least 100 cells were analyzed. Data represent the means ± S.D. for three independent experiments. Error bars represent S.D.

DISCUSSION

In this study, we demonstrated that PA-PLA1 regulates mitochondrial morphology. A specific physiological role of PA-PLA1 in mitochondrial function was verified in PA-PLA1-deficient sperm.

It is a little surprising that PA-PLA1 affects mitochondria. Because PA-PLA1 is a cytosolic protein (15), it can affect all membranes in contact with the cytosol. We cannot exclude the possibility that other organelle membranes are also affected by PA-PLA1, but our results suggest that mitochondria are one of the critical targets of PA-PLA1. The phenotype of PA-PLA1−/− mice is quite similar to that of mGPx4−/− mice (32, 33), supporting the idea that PA-PLA1 affects mitochondria. Interestingly, the YOR022c protein, the sole iPLA1 in Saccharomyces cerevisiae, was reported to be localized in mitochondria (34). A recent genome-wide interaction study showed that YOR022c genetically interacts with several genes implicated in mitochondrial dynamics and mitochondrial lipid metabolism. Examples of the genes include UGO1, an outer membrane component implicated in mitochondrial membrane fusion, and UPS1, a phosphatidic acid transfer protein in mitochondria (35).

PA-PLA1 exhibits PLA1 activity toward PA (12, 15, 23). The overexpression and depletion of PA-PLA1 cause the fragmentation and elongation of mitochondria, respectively. MitoPLD has been postulated to facilitate Mfn-mediated mitochondrial fusion by producing PA from cardiolipin (8). Overexpression of PA-PLA1 counteracts that of MitoPLD in terms of mitochondrial dynamics. These results encouraged us to propose a working model that PA-PLA1 hydrolyzes mitochondrial surface PA and thereby regulates mitochondrial morphology. Our results using Raf1-PABD as a PA sensor support this model. However, lipid analysis by mass spectrometry failed to show significant changes in the PA content of mitochondria upon overexpression of MitoPLD or PA-PLA1. It is possible that a small fraction of the total mitochondrial lipids might be metabolized by MitoPLD and PA-PLA1. More sensitive and direct measurement of mitochondrial surface PA is necessary to further verify the model.

Drp1, which is essential for mitochondrial fission (6), was normally targeted to constricted regions of elongated mitochondria in PA-PLA1-knocked down cells (Fig. 4A). Moreover, knockdown of PA-PLA1 retarded CCCP-induced mitochondrial fragmentation (Fig. 2C). These results suggest that PA-PLA1 knockdown does not affect the association of Drp1 with mitochondria but may inhibit the fission of constricted mitochondria. PA and LPA are cone- and inverted cone-shaped lipids that generate negative and positive curvature of membranes, respectively (3). The PA consumption and/or LPA production by PA-PLA1 at mitochondrial constriction sites might be important for mitochondrial fission. The viewpoint that LPA favors the fission of mitochondria is consistent with our recent study, which demonstrated that CI-976, an inhibitor for lysophospholipid acyltransferases such as lysophosphatidic acid acyltransferase (3), causes mitochondrial fragmentation (22). However, given that mitochondrial morphology is regulated by the balance between fusion and fission, it is also possible that PA-PLA1 negatively regulates Mfn-mediated fusion rather than stimulates mitochondrial fission. It has been reported that phospholipase D1 acts on the mitochondrial surface (36, 37). In addition, PA can be generated by the phosphorylation of diacylglycerol and the acylation of LPA. It is possible that PA-PLA1 metabolizes PA produced via several routes.

The results of knock-out mice studies suggest a possible functional link between PA-PLA1 and Mito-PLD in vivo. MitoPLD ablation causes meiotic arrest during spermatogenesis (9, 38). In MitoPLD-depleted cells, the formation of the nuage, a perinuclear structure involved in piRNA biogenesis/function (39), is impaired (9, 38). Huang et al. (9) have proposed that PA produced on the surface of mitochondria by MitoPLD recruits or activates nuage components. Consistent with this idea, expression of MitoPLD is high in spermatocytes undergoing meiosis and low in round spermatids. Meanwhile, PA-PLA1 protein is expressed in round and elongating spermatids but not in spermatocytes. Because the nuage acts as intermitochondrial “cement” (39), it may prohibit the reorganization of mitochondria required for subsequent flagellum formation. As spermatogenesis progresses, PA-PLA1 may metabolize PA and thus adjust the PA level for subsequent mitochondrial reorganization steps in spermatids. MitoPLD might be involved in the formation of piRNA in early stages of spermatogenesis and later in the regulation of mitochondrial morphology. Indeed, loss of MitoPLD affects the mitochondrial morphology in MEFs (9), suggesting that its role is not limited to piRNA generation. Huang et al. (9) have suggested that a PA phosphatase, Lipin 1, may metabolize PA produced by MitoPLD. The relationship between PA-PLA1 and Lipin 1 in the regulation of mitochondrial dynamics should be clarified in the future. Mitochondria align along a flagellum in late elongating spermatids, e.g. step 15 in mice. Prior to this alignment step, pronounced expression of the fusion and fission factors is observed in late round spermatids and early elongating spermatids (40, 41). One report suggested the necessity of intensive homogenization of mitochondria at a certain stage of spermiogenesis (i.e. steps 8–12) (41). It is plausible that PA-PLA1 might be involved in the regulation of mitochondrial fusion and fission at this stage.

A remaining question concerning iPLA1 in mammals concerns functional separation or redundancy between PA-PLA1 and KIAA0725p. KIAA0725p exhibits an enzyme activity similar to that of PA-PLA1 (13, 23). Recent reports have mentioned mutations of the PA-PLA1/DDHD1 gene (16) and KIAA0725p/DDHD2 gene (42, 43) in hereditary spastic paraplegia patients, suggesting that the two proteins have similar physiological significance in the nervous system. Mutations in the Lipin 1 gene in mice (44, 45) and rats (46) induce hind limb paralysis, which is a typical symptom of hereditary spastic paraplegia. This suggests the importance of PA metabolism in these rodents. Although PA-PLA1−/− mice did not show significant gait disturbance, precise neurological examination will be necessary to determine the effect of PA-PLA1 gene deletion on the nervous system. Redundant functions between PA-PLA1 and KIAA0725p may explain the fact that mitochondria in MEFs derived from PA-PLA1−/− mice show a normal morphology (Fig. 9). Consistent with this idea, KIAA0725p knockdown caused mitochondrial elongation in MEFs but not in HeLa cells (Fig. 10). KIAA0725p is predominantly localized to the cytosol in MEFs (22). Perhaps, cytosolic KIAA0725p can act on mitochondrial surface lipids in a manner similar to PA-PLA1. The expression levels and cellular distribution of PA-PLA1 and KIAA0725p may determine which protein mainly functions in each cellular process.

Acknowledgments

We thank Dr. Aizawa of the RIKEN Center for Developmental Biology for donation of the TT2 cells. We also thank Drs. Sekimizu and Hamamoto of the University of Tokyo for genetic manipulation of mice. We are also grateful to Dr. Tagaya of Tokyo University of Pharmacy and Life Sciences and Dr. Shishido for critical reading of the manuscript.

*

This work was supported in part by Grant-in-aid for Scientific Research 23570239 (to K. T.) from the Ministry of Education, Culture, Sports, Science and Technology of Japan.

2
The abbreviations used are:
PA
phosphatidic acid
CCCP
carbonyl cyanide m-chlorophenylhydrazone
iPLA1
intracellular phospholipase A1
LPA
lysophosphatidic acid
mGPx4
mitochondrial glutathione peroxidase 4
MEF
mouse embryonic fibroblast
Mfn
Mitofusin
MitoPLD
mitochondrial PLD
PA-PLA1
phosphatidic acid-preferring phospholipase A1
PLD
phospholipase D
CMXRos
chloromethyl-X-rosamine
PABD
PA binding domain
EGFP
enhanced GFP.

REFERENCES

  • 1. Haucke V., Di Paolo G. (2007) Lipids and lipid modifications in the regulation of membrane traffic. Curr. Opin. Cell Biol. 19, 426–435 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Wang X., Devaiah S. P., Zhang W., Welti R. (2006) Signaling functions of phosphatidic acid. Prog. Lipid Res. 45, 250–278 [DOI] [PubMed] [Google Scholar]
  • 3. Ha K. D., Clarke B. A., Brown W. J. (2012) Regulation of the Golgi complex by phospholipid remodeling enzymes. Biochim. Biophys. Acta 1821, 1078–1088 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Han G. S., Carman G. M. (2010) Characterization of the human LPIN1-encoded phosphatidate phosphatase isoforms. J. Biol. Chem. 285, 14628–14638 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Shindou H., Hishikawa D., Harayama T., Eto M., Shimizu T. (2013) Generation of membrane diversity by lysophospholipid acyltransferases. J. Biochem. 154, 21–28 [DOI] [PubMed] [Google Scholar]
  • 6. Youle R. J., van der Bliek A. M. (2012) Mitochondrial fission, fusion, and stress. Science 337, 1062–1065 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Yang C. Y., Frohman M. A. (2012) Mitochondria: Signaling with phosphatidic acid. Int. J. Biochem. Cell Biol. 44, 1346–1350 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Choi S. Y., Huang P., Jenkins G. M., Chan D. C., Schiller J., Frohman M. A. (2006) A common lipid links Mfn-mediated mitochondrial fusion and SNARE-regulated exocytosis. Nat. Cell Biol. 8, 1255–1262 [DOI] [PubMed] [Google Scholar]
  • 9. Huang H., Gao Q., Peng X., Choi S. Y., Sarma K., Ren H., Morris A. J., Frohman M. A. (2011) piRNA-associated germline nuage formation and spermatogenesis require MitoPLD profusogenic mitochondrial-surface lipid signaling. Dev. Cell 20, 376–387 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Muliyil S., Krishnakumar P., Narasimha M. (2011) Spatial, temporal and molecular hierarchies in the link between death, delamination and dorsal closure. Development 138, 3043–3054 [DOI] [PubMed] [Google Scholar]
  • 11. Tani K., Kogure T., Inoue H. (2013) Intracellular phospholipase A1. Biomol. Concepts 3, 471–478 [DOI] [PubMed] [Google Scholar]
  • 12. Higgs H. N., Han M. H., Johnson G. E., Glomset J. A. (1998) Cloning of a phosphatidic acid-preferring phospholipase A1 from bovine testis. J. Biol. Chem. 273, 5468–5477 [DOI] [PubMed] [Google Scholar]
  • 13. Nakajima K., Sonoda H., Mizoguchi T., Aoki J., Arai H., Nagahama M., Tagaya M., Tani K. (2002) A novel phospholipase A1 with sequence homology to a mammalian Sec23p-interacting protein, p125. J. Biol. Chem. 277, 11329–11335 [DOI] [PubMed] [Google Scholar]
  • 14. Tani K., Mizoguchi T., Iwamatsu A., Hatsuzawa K., Tagaya M. (1999) p125 is a novel mammalian Sec23p-interacting protein with structural similarity to phospholipid-modifying proteins. J. Biol. Chem. 274, 20505–20512 [DOI] [PubMed] [Google Scholar]
  • 15. Higgs H. N., Glomset J. A. (1994) Identification of a phosphatidic acid-preferring phospholipase Al from bovine brain and testis. Proc. Natl. Acad. Sci. U.S.A. 91, 9574–9578 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Tesson C., Nawara M., Salih M. A., Rossignol R., Zaki M. S., Al Balwi M., Schule R., Mignot C., Obre E., Bouhouche A., Santorelli F. M., Durand C. M., Oteyza A. C., El-Hachimi K. H., Al Drees A., Bouslam N., Lamari F., Elmalik S. A., Kabiraj M. M., Seidahmed M. Z., Esteves T., Gaussen M., Monin M. L., Gyapay G., Lechner D., Gonzalez M., Depienne C., Mochel F., Lavie J., Schols L., Lacombe D., Yahyaoui M., Al Abdulkareem I., Zuchner S., Yamashita A., Benomar A., Goizet C., Durr A., Gleeson J. G., Darios F., Brice A., Stevanin G. (2012) Alteration of fatty-acid-metabolizing enzymes affects mitochondrial form and function in hereditary spastic paraplegia. Am. J. Hum. Genet. 91, 1051–1064 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Blackstone C. (2012) Cellular pathways of hereditary spastic paraplegia. Annu. Rev. Neurosci. 35, 25–47 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Shimoi W., Ezawa I., Nakamoto K., Uesaki S., Gabreski G., Aridor M., Yamamoto A., Nagahama M., Tagaya M., Tani K. (2005) p125 is localized in endoplasmic reticulum exit sites and involved in their organization. J. Biol. Chem. 280, 10141–10148 [DOI] [PubMed] [Google Scholar]
  • 19. Ihara M., Kinoshita A., Yamada S., Tanaka H., Tanigaki A., Kitano A., Goto M., Okubo K., Nishiyama H., Ogawa O., Takahashi C., Itohara S., Nishimune Y., Noda M., Kinoshita M. (2005) Cortical organization by the septin cytoskeleton is essential for structural and mechanical integrity of mammalian spermatozoa. Dev. Cell 8, 343–352 [DOI] [PubMed] [Google Scholar]
  • 20. Iinuma T., Shiga A., Nakamoto K., O'Brien M. B., Aridor M., Arimitsu N., Tagaya M., Tani K. (2007) Mammalian Sec16/p250 plays a role in membrane traffic from the endoplasmic reticulum. J. Biol. Chem. 282, 17632–17639 [DOI] [PubMed] [Google Scholar]
  • 21. Arimitsu N., Kogure T., Baba T., Nakao K., Hamamoto H., Sekimizu K., Yamamoto A., Nakanishi H., Taguchi R., Tagaya M., Tani K. (2011) p125/Sec23-interacting protein (Sec23ip) is required for spermiogenesis. FEBS Lett. 585, 2171–2176 [DOI] [PubMed] [Google Scholar]
  • 22. Baba T., Yamamoto A., Tagaya M., Tani K. (2013) A lysophospholipid acyltransferase antagonist, CI-976, creates novel membrane tubules marked by intracellular phospholipase A1 KIAA0725p. Mol. Cell. Biochem. 376, 151–161 [DOI] [PubMed] [Google Scholar]
  • 23. Inoue H., Baba T., Sato S., Ohtsuki R., Takemori A., Watanabe T., Tagaya M., Tani K. (2012) Roles of SAM and DDHD domains in mammalian intracellular phospholipase A1 KIAA0725p. Biochim. Biophys. Acta 1823, 930–939 [DOI] [PubMed] [Google Scholar]
  • 24. Suzuki J., Sukezane T., Akagi T., Georgescu M. M., Ohtani M., Inoue H., Jat P. S., Goff S. P., Hanafusa H., Shishido T. (2004) Loss of c-abl facilitates anchorage-independent growth of p53- and RB-deficient primary mouse embryonic fibroblasts. Oncogene 23, 8527–8534 [DOI] [PubMed] [Google Scholar]
  • 25. Ishihara N., Jofuku A., Eura Y., Mihara K. (2003) Regulation of mitochondrial morphology by membrane potential, and DRP1-dependent division and FZO1-dependent fusion reaction in mammalian cells. Biochem. Biophys. Res. Commun. 301, 891–898 [DOI] [PubMed] [Google Scholar]
  • 26. Smirnova E., Griparic L., Shurland D. L., van der Bliek A. M. (2001) Dynamin-related protein Drp1 is required for mitochondrial division in mammalian cells. Mol. Biol. Cell 12, 2245–2256 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Zhao J., Liu T., Jin S., Wang X., Qu M., Uhlén P., Tomilin N., Shupliakov O., Lendahl U., Nistér M. (2011) Human MIEF1 recruits Drp1 to mitochondrial outer membranes and promotes mitochondrial fusion rather than fission. EMBO J. 30, 2762–2778 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Rizzo M. A., Shome K., Watkins S. C., Romero G. (2000) The recruitment of Raf-1 to membranes is mediated by direct interaction with phosphatidic acid and is independent of association with Ras. J. Biol. Chem. 275, 23911–23918 [DOI] [PubMed] [Google Scholar]
  • 29. Bligh E. G., Dyer W. J. (1959) A rapid method for total lipid extraction and purification. Can. J. Biochem. Physiol. 37, 911–917 [DOI] [PubMed] [Google Scholar]
  • 30. Fawcett D. W. (1970) A comparative view of sperm ultrastructure. Biol. Reprod. 2, Suppl. 2, 90–127 [PubMed] [Google Scholar]
  • 31. Russell L. D. (1990) Histological and Histopathological Evaluation of the Testis, pp. 119–161, Cache River Press, Clearwater, FL [Google Scholar]
  • 32. Imai H., Hakkaku N., Iwamoto R., Suzuki J., Suzuki T., Tajima Y., Konishi K., Minami S., Ichinose S., Ishizaka K., Shioda S., Arata S., Nishimura M., Naito S., Nakagawa Y. (2009) Depletion of selenoprotein GPx4 in spermatocytes causes male infertility in mice. J. Biol. Chem. 284, 32522–32532 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Schneider M., Förster H., Boersma A., Seiler A., Wehnes H., Sinowatz F., Neumüller C., Deutsch M. J., Walch A., Hrabé de Angelis M., Wurst W., Ursini F., Roveri A., Maleszewski M., Maiorino M., Conrad M. (2009) Mitochondrial glutathione peroxidase 4 disruption causes male infertility. FASEB J. 23, 3233–3242 [DOI] [PubMed] [Google Scholar]
  • 34. Huh W. K., Falvo J. V., Gerke L. C., Carroll A. S., Howson R. W., Weissman J. S., O'Shea E. K. (2003) Global analysis of protein localization in budding yeast. Nature 425, 686–691 [DOI] [PubMed] [Google Scholar]
  • 35. Connerth M., Tatsuta T., Haag M., Klecker T., Westermann B., Langer T. (2012) Intramitochondrial transport of phosphatidic acid in yeast by a lipid transfer protein. Science 338, 815–818 [DOI] [PubMed] [Google Scholar]
  • 36. Cowell C. F., Döppler H., Yan I. K., Hausser A., Umezawa Y., Storz P. (2009) Mitochondrial diacylglycerol initiates protein-kinase D1-mediated ROS signaling. J. Cell Sci. 122, 919–928 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Jin J. K., Kim N. H., Lee Y. J., Kim Y. S., Choi E. K., Kozlowski P. B., Park M. H., Kim H. S., Min do S. (2006) Phospholipase D1 is up-regulated in the mitochondrial fraction from the brains of Alzheimer's disease patients. Neurosci. Lett. 407, 263–267 [DOI] [PubMed] [Google Scholar]
  • 38. Watanabe T., Chuma S., Yamamoto Y., Kuramochi-Miyagawa S., Totoki Y., Toyoda A., Hoki Y., Fujiyama A., Shibata T., Sado T., Noce T., Nakano T., Nakatsuji N., Lin H., Sasaki H. (2011) MITOPLD is a mitochondrial protein essential for nuage formation and piRNA biogenesis in the mouse germline. Dev. Cell 20, 364–375 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Pillai R. S., Chuma S. (2012) piRNAs and their involvement in male germline development in mice. Dev. Growth Differ. 54, 78–92 [DOI] [PubMed] [Google Scholar]
  • 40. Hales K. G., Fuller M. T. (1997) Developmentally regulated mitochondrial fusion mediated by a conserved, novel, predicted GTPase. Cell 90, 121–129 [DOI] [PubMed] [Google Scholar]
  • 41. Honda S., Hirose S. (2003) Stage-specific enhanced expression of mitochondrial fusion and fission factors during spermatogenesis in rat testis. Biochem. Biophys. Res. Commun. 311, 424–432 [DOI] [PubMed] [Google Scholar]
  • 42. Schuurs-Hoeijmakers J. H., Geraghty M. T., Kamsteeg E. J., Ben-Salem S., de Bot S. T., Nijhof B., van de Vondervoort I. I., van der Graaf M., Nobau A. C., Otte-Höller I., Vermeer S., Smith A. C., Humphreys P., Schwartzentruber J., FORGE Canada Consortium., Ali B. R., Al-Yahyaee S. A., Tariq S., Pramathan T., Bayoumi R., Kremer H. P., van de Warrenburg B. P., van den Akker W. M., Gilissen C., Veltman J. A., Janssen I. M., Vulto-van Silfhout A. T., van der Velde-Visser S., Lefeber D. J., Diekstra A., Erasmus C. E., Willemsen M. A., Vissers L. E., Lammens M., van Bokhoven H., Brunner H. G., Wevers R. A., Schenck A., Al-Gazali L., de Vries B. B., de Brouwer A. P. (2012) Mutations in DDHD2, encoding an intracellular phospholipase A1, cause a recessive form of complex hereditary spastic paraplegia. Am. J. Hum. Genet. 91, 1073–1081 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Gonzalez M., Nampoothiri S., Kornblum C., Oteyza A. C., Walter J., Konidari I., Hulme W., Speziani F., Schöls L., Züchner S., Schüle R. (2013) Mutations in phospholipase DDHD2 cause autosomal recessive hereditary spastic paraplegia (SPG54). Eur. J. Hum. Genet. 21, 1214–1218 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Douglas D. S., Moran J. L., Bermingham J. R., Jr., Chen X. J., Brindley D. N., Soliven B., Beier D. R., Popko B. (2009) Concurrent Lpin1 and Nrcam mouse mutations result in severe peripheral neuropathy with transitory hindlimb paralysis. J. Neurosci. 29, 12089–12100 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Nadra K., de Preux Charles A. S., Médard J. J., Hendriks W. T., Han G. S., Grès S., Carman G. M., Saulnier-Blache J. S., Verheijen M. H., Chrast R. (2008) Phosphatidic acid mediates demyelination in Lpin1 mutant mice. Genes Dev. 22, 1647–1661 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Mul J. D., Nadra K., Jagalur N. B., Nijman I. J., Toonen P. W., Médard J. J., Grès S., de Bruin A., Han G. S., Brouwers J. F., Carman G. M., Saulnier-Blache J. S., Meijer D., Chrast R., Cuppen E. (2011) A hypomorphic mutation in Lpin1 induces progressively improving neuropathy and lipodystrophy in the rat. J. Biol. Chem. 286, 26781–26793 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES