Skip to main content
Molecular Vision logoLink to Molecular Vision
. 2014 May 27;20:691–703.

First report of OPA1 screening in Greek patients with autosomal dominant optic atrophy and identification of a previously undescribed OPA1 mutation

Smaragda Kamakari 1,✉, George Koutsodontis 1, Miltiadis Tsilimbaris 2, Athanasios Fitsios 3, Georgia Chrousos 3
PMCID: PMC4037535  PMID: 24883014

Abstract

Purpose

To describe the genotype–phenotype correlation in four Greek pedigrees with autosomal dominant optic atrophy (ADOA) and OPA1 mutations.

Methods

Seven patients from four unrelated families (F1, F2, F3, F4) were clinically assessed for visual acuity, color vision, ptosis, afferent pupillary defects, and visual fields and underwent orthoptic assessment, slit-lamp biomicroscopy, and fundus examination to establish their clinical status. Genomic DNA was extracted from peripheral blood samples from all participants. The coding region (exons 1–28), including the intron-exon boundaries of the OPA1 gene, was screened in the probands of the four families, as well as in seven additional family members (four affected and three unaffected) with PCR and direct DNA sequencing.

Results

All patients presented bilateral decrease in best-corrected visual acuity and temporal pallor of the optic disc. The visual fields of the adult patients showed characteristic scotomata. Other signs were present in some patients such as decreased color discrimination and a gray crescent within the neuroretinal rim. After the OPA1 gene was sequenced, a previously undescribed heterozygous splice-site mutation c.784–1G>T in intron 7 was detected in family F2. In families F1, F3, and F4, a previously reported in-frame deletion c.876_878delTGT/p.(Val294del), the frameshift c.2366delA/p.(Asn789Metfs*11), and splice-site c.1140+5G>C mutations were detected, respectively.

Conclusions

This is the first report of molecular characterization of Greek patients with ADOA. Our findings provide additional information regarding the genotype-phenotype correlation and establish the role of the OPA1 gene in Greek patients with ADOA.

Introduction

Autosomal dominant optic atrophy (ADOA) is a hereditary optic neuropathy characterized by bilateral and symmetric optic nerve pallor associated with insidious decrease in visual acuity with onset usually in early childhood. ADOA (estimated prevalence between 1/50,000 worldwide [1] and 1/10,000 in Denmark [2-4]) and Leber hereditary optic neuropathy (LHON; prevalence between 1/30,000 and 1/50,000 [5,6]) are the most common forms of inherited optic neuropathies. Even though evidence of dominantly inherited optic neuropathy was presented before 1900, only after the description of 19 families by the ophthalmologist Kjer was ADOA (also called Kjer type optic atrophy) recognized. The diagnostic criteria established in several studies during the past few decades [3,7] include slowly progressive bilateral visual impairment, dyschromatopsia, loss of sensitivity in the central visual field, and temporal optic disc atrophy beginning before the age of 10 years [8]. The precise age of onset is rarely established; most patients are diagnosed when they enter school or only incidentally following the examination of other affected family members [9].

Optic atrophy shows genetic heterogeneity. Thus far, eight genes (OPA1: Gene ID: 4976; OMIM: 165500; OPA2: Gene ID: 4977; OMIM 311050; OPA3: Gene ID: 80207; OMIM 606580; OPA4: Gene ID: 58156; OMIM 605293; OPA5: Gene ID: 692222; OMIM 610708; OPA6: Gene ID: 777778; OMIM 258500; OPA7/ TMEM126A: Gene ID: 84233; OMIM 612988; OPA8: HGNC: Gene ID 39750) have been implicated. OPA1 is the most frequently mutated ADOA gene [10,11].

OPA1 is situated on chromosome 3q28–29, spans approximately 100 kb, and is composed of 30 coding exons. Alternative splicing generates several isoforms. The main isoform is 960 amino acids long, encoded by 28 exons [10]. The OPA1 protein is a ubiquitously expressed mitochondrial protein with similarity to dynamin-related GTPases, located mostly on the mitochondrial inner membrane [12,13]. OPA1 consists of five domains: the mitochondrial target signal (MTS), N-terminal coiled-coil domain, GTPase domain, dynamin central region, and C-terminal coiled-coil domain. OPA1 seems to have a key role in regulating mitochondrial dynamics and the apoptotic process [14]. To date, more than 250 mutations have been described in the OPA1 gene [15,16], most of which are localized to the N-terminal leader sequence (exons 1–2), the GTPase domain (exons 8–16), and the C-terminal coiled-coil region (exons 27–28) [17].

In this study, we screened the OPA1 gene for mutations in four unrelated Greek families affected with ADOA and identified four different mutations one of which has not been previously described. This is the first report of OPA1 mutations in Greek patients with ADOA.

Methods

Clinical evaluation

This study adhered to the tenets of the Declaration of Helsinki and the ARVO statement on human subjects and was approved by the Human Subjects Review Committee at the University Hospital of Heraklion, Crete. Informed written consent was obtained from all study participants. Seven patients from four unrelated Greek families were clinically examined. The inheritance pattern of the four families was autosomal dominant.

All individuals were evaluated for the following clinical ophthalmic parameters: best-corrected visual acuity (BCVA), color vision, orthoptic assessment, eyelid ptosis (positive if the margin of the upper eyelid was more than 2 mm below the superior limbus), presence of relative afferent pupillary defects (RAPD), slit-lamp biomicroscopy of the anterior segment, and fundus examination with particular attention to the optic nerve head characteristics (when possible, fundus photographs were obtained). Assessment of visual fields using automated threshold perimetry were also obtained in the adult patients.

Best-corrected visual acuity was measured using the Snellen chart. The Snellen ratios were then converted to logarithm of the minimum angle of resolution (logMAR) values for the purpose of the study. Color vision was evaluated using Ishihara pseudoisochromatic plates (15 plates). The clinical diagnosis of ADOA was based on a positive family history, a history of gradually bilateral visual impairment beginning at an early age, dyschromatopsia, characteristic abnormalities in the visual fields (cecocentral scotomata), and typical abnormalities of the optic disc (temporal pallor of the optic disc).

Mutation screening of the OPA1 gene

Total genomic DNA was extracted from whole blood samples on an iPrep purification instrument using the iPrep PureLink gDNA Blood Kit (Invitrogen, Life Technologies, Carlsbad, CA) according to the manufacturer’s instructions.

Primer sequences for exons 1–28 and flanking intronic splice sites of the OPA1 gene were as reported in [17] except for primers of exon 1 which were designed using the Web Primer program. All primer sequences are shown in Table 1. PCR reactions were performed in a 25 μl total reaction volume, containing 50-100 ng genomic DNA, 2.5 μl of 10xPCR buffer (w/o MgCl2), 3 μl of 10 mM dNTPs mix, 0.75 μl of 50 mM MgCl2, 1.75 μl of 10 μΜ forward primer, 1.75 μl of 10 μΜ reverse primer and 0.25 μl of 5 U/μl Platinum Taq DNA polymerase (Invitrogen, Life Technologies). Amplification was performed with the following cycling profile: incubation at 94 °C for 5 min followed by 36 cycles of 45 s denaturation at 94 °C, 45 s annealing at 58 °C and 45 s elongation at 72°C. The last cycle was followed by a final extension of 3 min at 72°C. Excess primers and dNTPs were removed using exonuclease I and shrimp alkaline phosphatase, and PCR products were sequenced with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. All sequences were analyzed in forward and reverse directions on an ABI3500 fluorescent sequencer (Applied Biosystems). Nucleotide sequences were compared with the published DNA sequence of OPA1 gene (GenBank accession number NG_011605.1) and isoform 1 (GenBank accession number NM_015560.1). For the OPA1 gene, cDNA numbering +1 corresponds to A in the ATG translation initiation codon of OPA1 isoform 1.

Table 1. PCR primers used in this study.

Exon Primer (5’-3’)
Exon1
CACTTCCTGGGTCATTCCTGGA

AGAATTTTCGGGTTGGGTAGGG
Exon 2
CCCTCTCTGATCTTTCTTCCAT

TAATTGGAAAACCAGGAGGA
Exon 3
TATTTGGCATGCAGAGCATC

TCTCTTTCCTCGAGATGACCA
Exon 4
GGGTTGTCATGAGGATTAAACAA

CATGTATTTTTCCTCCATGGTTC
Exon 5
AAAGGCGATTTGATTCTTTGAA

TCTTTCAAGACTACCTACATGAACAA
Exon 6
AAAAATTTAACTTGCTGTACATTCTG

CACCTTCCAAATTTTGCTCTG
Exon 7
TCAAGATTTTGGAAGATTTTAATTTAG

CACACAACGTTAAGCGGTAAAA
Exon 8
CCGTTTTAGTTTTTACGATGAAGA

TTTTTGCTAGTTGGCAAGTTCA
Exon 9
AAAAACTCAGAGCAGCATTACAAA

CCTAAGGAACCTCACTGAGACG
Exon 10,11
CATACGGGCTGTGGGAATTA

CCATAAAACGTCACTGAAATGAA
Exon 12,13
GAATTTTTAGAATACATTTCACCAAAA

TGGATTGCTAAAGAAGAAAACAT
Exon 14
GACACAGGGGTATAATTTGTACTGA

TTCTCGCAACAAAGAATTTGA
Exon 15,16
TTTTGCTTTCTAAATTGTATATTACGC

TGAAAACAGTTCAATTTAAGCTACTC
Exon 17
CATTCGCAGACTTGGTGGTA

TGTCTTAATTTGCTTGCTTCTTT
Exon 18
CCACTTTAACCACTACATCTGGAA

AGCTTATCAGATTTTTCTCTCAACA
Exon 19
TCTGAAAATCATGACAGGGTAAA

CAAGGCAACAATAAATCACTGC
Exon 20
TGATACTTCAGTCAAGCTGTTTTT

CAGCTCCTACTCCCTTCAGA
Exon 21
TTTTTCATGTTAACCATTGAAGTATG

GAGGCTGATACCCCAGTATACAA
Exon 22
TTTTTCCATATTTACTAAGCTGTCAA

TCACCACTGTGAACTCAGAACTC
Exon 23
TTCCTTTATTTCAACTGCCTTCA

AATGCCTGAATTAAAATGAACAA
Exon 24
TCAAGCACCAAATTATGAACCA

GCAGATTCCTGCTTCTCAGC
Exon 25
TGTACAACTTCTCAGTGTGGTTGA

GCATATTTTGACAACTGTTGCTT
Exon 26
AAGCTTAGGACATATCTACTGGTTCT

TGGGAAGTATTTTGGCATCC
Exon 27
TCTTTATTCATTTATAAAAACGATGC

AAATGGGAAAGGTGGAAAGG
Exon 28
CCTCCTGATTTGTGATACCTTTG
CAAGCAGGATGTAAATGAAGCA

Results

Clinical findings

All patients were Greek and of Greek origin. No patient had a history of neurologic diseases or any other ocular disorders. Seven patients from four families were clinically assessed. The four probands were F1 II:5, F2 II:1, F3 III:24, and F4 III:1. The proband F2 II:1 is the father of patient F2 III:1, patient F3 II:11 is the father of proband F3 III:24, and patient F4 II:1 is the father of proband F4 III:1 (Figure 1A, Figure 2A, Figure 3A, Figure 4A). The age of onset ranged from 5 to 12 years.

Figure 1.

Figure 1

DNA sequence analysis of exon 9 and flanking sequences of the OPA1 gene in family F1. A: Pedigree F1. The arrow indicates the proband. Affected and unaffected individuals are represented with black and open circles, respectively. Males are represented with a quadrant and females with a circle. The asterisk sign indicates individuals clinically and genetically examined. B: Mutant sequence in proband F1 II:5. The antisense sequence confirmed the same in-frame mutation. C: Normal sequence. The horizontal lines in B and C indicate deletion of the three nucleotides TGT (c.876_878delTGT) resulting in the in-frame deletion of valine at codon 294 of the OPA1 protein [p.(Valdel294)].

Figure 2.

Figure 2

DNA sequence analysis of exon 8 and flanking sequences of the OPA1 gene in family F2. A: Pedigree F2. The arrow indicates the proband. Affected and unaffected individuals are represented with black and open circles, respectively. Males are represented with a quadrant and females with a circle. The asterisk sign indicates individuals both clinically and genetically examined. B: Mutant sequence in proband F2 II:1. The antisense sequence confirmed the same splicing site mutation. C: Normal sequence. The arrows in B and C indicate the position of the G to T substitution at the 3′ acceptor splice site of intron 7 (c.784–1G>T).

Figure 3.

Figure 3

DNA sequence analysis of exon 24 and flanking sequences of the OPA1 gene in family F3. A: Pedigree F3. The arrow indicates the proband. Affected and unaffected individuals are represented with black and open circles, respectively. Males are represented with a quadrant and females with a circle. The asterisk sign indicates individuals both clinically and genetically examined. Questions marks indicate probably affected family members. B: Mutant sequence in proband F3 III:24. The antisense sequence confirmed the same in-frame mutation. C: Normal sequence. The arrows in B and C indicate the deletion of nucleotide A (c.2366delA) resulting in the frameshift p.(Asn789Metfs*11) mutation of the OPA1 protein.

Figure 4.

Figure 4

DNA sequence analysis of exon 11 and flanking sequences of the OPA1 gene in family F4. A: Pedigree F4. The arrow indicates the proband. Affected and unaffected individuals are represented with black and open circles, respectively. Males are represented with a quadrant and females with a circle. The asterisk sign indicates individuals both clinically and genetically examined. B: Mutant sequence in proband F4 III:1. C: Normal sequence. The arrows in B and C indicate the position of the G to C substitution at the fifth nucleotide of the 5′ donor site of intron 11.

Best-corrected visual acuity ranged from 20/25 to 20/400 (0.1–1.3 logMAR units). In ADOA, visual impairment is generally moderate although in some cases it might extend to legal blindness [8]. No patient showed asymmetry in VA, defined as the difference of two lines in Snellen charts, between eyes.

Visual field (automated perimetry) demonstrated cecocentral scotomata in the adult patients (patients F1 II:5, F2 II:1, F3 II:11, F4 II:1). Cecocentral scotomata are the most characteristic feature in people affected with ADOA as shown in Figure 5 (F1 II:5). Color vision testing with the Ishihara pseudoisochromatic plates ranged from severely compromised (1/15 correct plates) to quite normal (14/15 correct plates). A reliable color test from the youngest patient, F2 III:1, was not possible. Color vision examination in previous studies has shown that mixed color defect accounts for more than 80% of the color deficits documented [8]. Afferent pupillary defects were uncommon in the group with only one patient exhibiting a trace of afferent pupillary defect in both eyes (F2 II:1).

Figure 5.

Figure 5

Left Humphrey 30–2 visual field showing a cecocentral scotoma of the proband F1 II:5.

The orthoptic assessment documented normal ocular motility in all patients, and there was no upper eyelid ptosis. We paid considerable attention to these features because additional associated clinical manifestations (chronic progressive external ophthalmoplegia, ataxia, sensorineural deafness, sensory-motor neuropathy, and myopathy [18,19]), the syndromic forms of ADOA or ADOA plus [16], account for 20% of all DOA cases with OPA1 mutation [20] and could be missed, particularly in patients with a mild to moderate degree of ptosis or ophthalmoplegia [19]. External ophthalmoplegia and neurologic signs occur from the third decade of life, while visual failure occurs in the first decade [20]. Therefore, some of our probands could manifest handicaps later in life that were not present in the current examination. In addition, almost one third of the family members manifested either pure DOA or DOA plus phenotypes although they carry the same OPA1 mutation [20].

The fundus examination revealed moderate to marked pallor of the temporal quadrant of each optic disc in all patients. An example of this feature is shown in patient F3 III:24 (Figure 6). The degree of temporal pallor was symmetric in every individual. Ophthalmologic fundus examination in patients with ADOA typically discloses bilateral and symmetric temporal of diffuse pallor of the optic disc [21].

Figure 6.

Figure 6

Fundus photograph of the right eye shows optic nerve temporal pallor in the patient F3 III:24 with dominant optic atrophy.

One optic nerve examined, in patient F3 III:24, had a gray crescent situated temporally (gray pigment within the substance of neuroretinal rim tissue; Figure 7). This finding has been reported in previous studies by others [22,23]. None of the participants presented anterior segment abnormalities. No electrophysiological investigation was performed since electrophysiology does not contribute to the diagnosis of ADOA [9].

Figure 7.

Figure 7

Fundus photograph of the left optic disc showing gray crescent situated temporally in patient F3 III:24.

Mutation analysis

We identified one unreported and three previously reported OPA1 gene mutations in the probands of four unrelated families. Specifically, proband F1 II:5 (family F1) had a heterozygous 3-bp in-frame deletion, c.876_878delTGT, in exon 9 that is predicted to result in a premature termination codon (p.(Val294fsx667); Figure 1B). This mutation has been previously reported once [20]. The proband has two children who appeared unaffected. Only one was genetically tested and found to be negative for the mutation.

Proband F2 II:1 (family F2) had a heterozygous splicing site mutation, c.784–1G>T, in intron 7 (Figure 2B). This mutation has not been previously described. He has one affected child (F2 III:1) who was found positive for the same mutation. This mutation was not detected in 100 unrelated healthy control individuals.

Proband F3 III:24 (family F3) had a heterozygous, one nucleotide deletion, c.2366delA in exon 24 (Figure 3B). This frameshift mutation results in the substitution of ten amino acids starting with methionine at codon 789 and in a premature stop at codon 799 of the OPA1 protein. This mutation has been previously reported [24]. We screened four relatives of the proband: his affected father, who was found positive for the mutation, and his three unaffected siblings (F3 III:22, F3 III:25, F3 III:26), one of whom was revealed to be positive for the mutation (F3 III:26). The proband’s younger brother (3 years old) was under the expected age of onset (F3 III:25).

Proband F4 III:1 (family F4) had a heterozygous, splice-site mutation, c.1140+5G>C, in intron 11 (Figure 4B). This mutation has been previously reported [25,26]. We also screened her affected father (F4 II:1), who had the same mutation. Clinical and genetic findings are summarized in Table 2.

Table 2. Clinical and genetic characterization of probands and their relatives with ADOA.

Family pedigree Gender Age at examination Age of onset Visual acuity (Right/left) Optic nerve head Color vision (OD=Right Eye, OS=Left Eye) Mutation Exon Type of mutation
F1II5
F
59
7
1.0/1.3
temporal pallor
0/15 OD
0/15 OS
c.876_878delTGT, p.(Val294del)
9
In-frame deletion
F2II1
M
45
12
0.8/0.8
temporal pallor
14/15 OD
14/15 OS
c.784–1G>T
Intron 7
Splice site Novel
F2III1
F
5
5
0.6/0.6
temporal pallor
-
F3II11
M
50
10
0.1/0.2
temporal pallor
1/15 OD
1/15 OS
c.2366delA,p.(Asn789Metfs*11)
24
Frameshift
F3III24
M
15
10
0.2/0.3
temporal pallor
1/15 OD
1/15 OS
F4II1
M
43
10
0.4/0.3
temporal pallor
14/15 OD
14/15 OS
c.1140+5G>C Intron 11 Splice site
F4III1 F 6 6 0.4/0.2 temporal pallor 14/15 OD
14/15 OS

Discussion

Greek patients with suspected ADOA have never been screened for OPA1 mutations. This is the first report of clinical and genetic characterization of Greek patients with identification of OPA1 mutations.

In this study, we included four unrelated Greek families with clinically diagnosed optic atrophy and screened the entire coding and flanking sequences of the OPA1 gene in the four probands. We identified four different mutations as follows: a previously undescribed heterozygous splice-site mutation, c.784–1G>T, in intron 7, a previously reported heterozygous in-frame deletion mutation, c.876_878delTGT/p.(Val294del), in exon 9 leading to a one amino acid deletion, a previously reported frameshift mutation, c.2366delA/p.(Asn789Metfs*11), in exon 24 and a previously reported splice-site mutation, c.1140+5G>C, in intron 11 of the OPA1 gene. Our genetic analysis included seven additional members of the four families (four affected and three unaffected).

More than 250 OPA1 mutations have been reported to date. At the protein level, 40% of mutations lead to premature translation termination, 27% are missense mutations, 27% are splicing mutations, and 6% are either deletions or duplications [25]. In the present study, the four mutations detected include an in-frame deletion mutation, a frameshift mutation, and two splice-site mutations.

The one amino acid deletion p.(Val294del) was detected in family F1. Several lines of evidence support the pathogenicity of this mutation. Specifically, valine at residue 294 is highly conserved among all five close eukaryotic homologs, including mouse, salmon, Xenopus, Drosophila melanogaster, and Caenorhabditis elegans. This mutation is located in the highly conserved GTPase domain and has been previously reported once in two related patients [20]. The authors report that this mutation has not been detected in a panel of 150–300 age-matched controls. Furthermore, a similar mutation involving deletion of Val294 as well as its preceding residue Val293 [p.(Val293_Val294del; c.877_882delGTGGTT)] has been detected in a patient with DOA and not found in a panel of 1,000 control chromosomes [26]. The absence of the genetic change involving deletion of Valine 294 in a large number of control chromosomes strongly supports that this is a disease-causing mutation. The two previously reported related patients (age 59 and 75) who carried the same mutation as our patient (age 59) presented childhood onset optic atrophy as well as extraocular features including neuropathy, hereditary spastic paraplegia, and migraine (but not ptosis or ophthalmoplegia) whereas two additional affected members of the family (children of the 59-year-old patient) presented isolated optic atrophy. We did not observe any indication of neurologic signs or symptoms or other extrabulbar ophthalmological manifestations (eyelid ptosis or ophthalmoplegia) in the past medical history of our patient carrying the same OPA1 mutation. Her unaffected daughter tested negative for this mutation, which further supports that Val294del is the disease-causing mutation. Finally, nonsense mutations affecting neighboring amino acids Arg290 and Glu297, located within the same GTPase domain, have also been reported [27-29].

Among the reported mutations of the OPA1 gene, more than 20% are splice-site mutations, which are presumed to result in the in-frame skipping of exons or premature termination of OPA1 translation. The previously undescribed splice-site mutation c.784–1G>T detected in family F2 affects the critical guanine at the 3′ acceptor splice site of intron 7. Schimpf et al. [25] reported a similar mutation c.784–1G>Α and showed that this caused in-frame skipping of exon 8 (K262-R290del, Human Genome Mutation Database, CS080724). Of note, cDNA analysis of the c.784–1G>T mutation, presented in this study, similarly causes in-frame skipping of exon 8 (data not shown).

A second splice-site mutation, c.1140+5G>C was detected in family F4. This mutation has been previously reported [25,26] and through cDNA analysis was shown to lead to the complete skipping of exon 11 thus causing the deletion of the corresponding amino acids Leu356_Glu380 of the OPA1 protein [25].

The last mutation c.2366delA/p.(Asn789Metfs*11) has been previously detected in only two patients [24] and is a frameshift mutation in exon 24 resulting in the substitution of ten amino acids, and in a premature stop at codon 799, leading to the loss of the 162 C-terminal amino acids of the OPA1 protein. This mutation was tested in five members of family F3, including the affected father and his four children, one affected son 15 years old, one son under the age of onset, and two apparently unaffected daughters in their early 20s. Both affected members carried the mutation. One of the presumed unaffected daughters (21 years old), never clinically evaluated previously, surprisingly tested positive for the mutation. Her positive genetic result requires further investigation; however, she has not agreed to be clinically examined. The son, under the age of onset of the illness, tested negative for the mutation, thus excluding the risk of him being affected and relieving the parents of anxiety and frequent unnecessary ophthalmological examinations. This once more proves the value of genetic testing for detecting presymptomatic carriers or excluding the risk of being affected.

Although more than 250 OPA1 gene mutations have been reported to date, mutations in Greek patients have not been reported. We detected four OPA1 mutations, one of which was previously unreported. The current study is the first report of mutations causing isolated ADOA in Greek families enabling genetic counseling of the probands and their families.

Acknowledgments

We are grateful to Dr. Christophoros Giatzakis for critical reading and comments of the manuscript. The project was financially supported by the EU FP6, Integrated Project ‘EVI-GENORET’ (LSHG-CT-2005-512036; S.K)

References

  • 1.Lyle WM. Genetic risks: a reference for eye care practitioners. Waterloo (Canada): University of Waterloo Press; 1990. [Google Scholar]
  • 2.Eiberg H, Kjer B, Kjer P, Rosenberg T. Dominant optic atrophy (OPA1) mapped to chromosome 3q region I. Linkage analysis. Hum Mol Genet. 1994;3:977–80. doi: 10.1093/hmg/3.6.977. [DOI] [PubMed] [Google Scholar]
  • 3.Kjer B, Eiberg H, Kjer P, Rosenberg T. Dominant optic atrophy mapped to chromosome 3q region. II. Clinical and epidemiological aspects. Acta Ophthalmol Scand. 1996;74:3–7. doi: 10.1111/j.1600-0420.1996.tb00672.x. [DOI] [PubMed] [Google Scholar]
  • 4.Thiselton DL, Alexander C, Morris A, Brooks S, Rosenberg T, Eiberg H, Kjer B, Kjer P, Bhattacharya SS, Votruba M. A frameshift mutation in exon 28 of the OPA1 gene explains the high prevalence of dominant optic atrophy in the Danish population: evidence for a founder effect. Hum Genet. 2001;109:498–502. doi: 10.1007/s004390100600. [DOI] [PubMed] [Google Scholar]
  • 5.Man PY, Griffiths PG, Brown DT, Howell N, Turnbull DM, Chinnery PF. The epidemiology of Leber hereditary optic neuropathy in the North East of England. Am J Hum Genet. 2003;72:333–9. doi: 10.1086/346066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Puomila A, Hämäläinen P, Kivioja S, Savontaus ML, Koivumäki S, Huoponen K, Nikoskelainen E. Epidemiology and penetrance of Leber hereditary optic neuropathy in Finland. Eur J Hum Genet. 2007;15:1079–89. doi: 10.1038/sj.ejhg.5201828. [DOI] [PubMed] [Google Scholar]
  • 7.Kjer P. Infantile optic atrophy with dominant mode of inheritance: a clinical and genetic study of 19 Danish families. Acta Ophthalmol Suppl. 1959;164(Supp 54):1–147. [PubMed] [Google Scholar]
  • 8.Votruba M, Moore AT, Bhattacharya SS. Clinical features, molecular genetics, and pathophysiology of dominant optic atrophy. J Med Genet. 1998;35:793–800. doi: 10.1136/jmg.35.10.793. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Amati-Bonneau P, Milea D, Bonneau D, Chevrollier A, Ferré M, Guillet V, Gueguen N, Loiseau D, de Crescenzo MA, Verny C, Procaccio V, Lenaers G, Reynier P. OPA1-associated disorders: phenotypes and pathophysiology. Int J Biochem Cell Biol. 2009;41:1855–65. doi: 10.1016/j.biocel.2009.04.012. [DOI] [PubMed] [Google Scholar]
  • 10.Almind GJ, Ek J, Rosenberg T, Eiberg H, Larsen M, Lucamp L, Brøndum-Nielsen K, Grønskov K. Dominant optic atrophy in Denmark - report of 15 novel mutations in OPA1, using a strategy with a detection rate of 90%. BMC Med Genet. 2012;13:65. doi: 10.1186/1471-2350-13-65. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Lenaers G, Hamel C, Delettre C, Amati-Bonneau P, Procaccio V, Bonneau D, Reynier P, Milea D. Dominant optic atrophy. Orphanet J Rare Dis. 2012;7:46. doi: 10.1186/1750-1172-7-46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Olichon A, Emorine LJ, Descoins E, Pelloquin L, Brichese L, Gas N, Guillou E, Delettre C, Valette A, Hamel CP, Ducommun B, Lenaers G, Belenguer P. The human dynamin-related protein OPA1 is anchored to the mitochondrial inner membrane facing the inter-membrane space. FEBS Lett. 2002;523:171–6. doi: 10.1016/s0014-5793(02)02985-x. [DOI] [PubMed] [Google Scholar]
  • 13.Satoh M, Hamamoto T, Seo N, Kagawa Y, Endo H. Differential sublocalization of the dynamin-related protein OPA1 isoforms in mitochondria. Biochem Biophys Res Commun. 2003;300:482–93. doi: 10.1016/s0006-291x(02)02874-7. [DOI] [PubMed] [Google Scholar]
  • 14.Olichon A, Baricault L, Gas N, Guillou E, Valette A, Belenguer P, Lenaers G. Loss of OPA1 perturbates the mitochondrial inner membrane structure and integrity, leading to cytochrome c release and apoptosis. J Biol Chem. 2003;278:7743–6. doi: 10.1074/jbc.C200677200. [DOI] [PubMed] [Google Scholar]
  • 15.Ferré M, Amati-Bonneau P, Tourmen Y, Malthièry Y, Reynier P. eOPA1: an online database for OPA1 mutations. Hum Mutat. 2005;25:423–8. doi: 10.1002/humu.20161. [DOI] [PubMed] [Google Scholar]
  • 16.Skidd PM, Lessell S, Cestari DM. Autosomal Dominant Hereditary Optic Neuropathy (ADOA): A Review of the Genetics and Clinical Manifestations of ADOA and ADOA+. Semin Ophthalmol. 2013;28:422–6. doi: 10.3109/08820538.2013.825296. [DOI] [PubMed] [Google Scholar]
  • 17.Li Y, Deng T, Tong Y, Peng S, Dong B, He D. Identification of two novel OPA1 mutations in Chinese families with autosomal dominant optic atrophy. Mol Vis. 2008;14:2451–7. [PMC free article] [PubMed] [Google Scholar]
  • 18.Amati-Bonneau P, Valentino ML, Reynier P, Gallardo ME, Bornstein B, Boissière A, Campos Y, Rivera H, de la Aleja JG, Carroccia R, Iommarini L, Labauge P, Figarella-Branger D, Marcorelles P, Furby A, Beauvais K, Letournel F, Liguori R, La Morgia C, Montagna P, Liguori M, Zanna C, Rugolo M, Cossarizza A, Wissinger B, Verny C, Schwarzenbacher R, Martín MA, Arenas J, Ayuso C, Garesse R, Lenaers G, Bonneau D, Carelli V. OPA1 mutations induce mitochondrial DNA instability and optic atrophy 'plus' phenotypes. Brain. 2008;131:338–51. doi: 10.1093/brain/awm298. [DOI] [PubMed] [Google Scholar]
  • 19.Payne M, Yang Z, Katz BJ, Warner JE, Weight CJ, Zhao Y, Pearson ED, Treft RL, Hillman T, Kennedy RJ, Meire FM, Zhang K. Dominant optic atrophy, sensorineural hearing loss, ptosis, and ophthalmoplegia: a syndrome caused by a missense mutation in OPA1. Am J Ophthalmol. 2004;138:749–55. doi: 10.1016/j.ajo.2004.06.011. [DOI] [PubMed] [Google Scholar]
  • 20.Yu-Wai-Man P, Griffiths PG, Gorman GS, Lourenco CM, Wright AF, Auer-Grumbach M, Toscano A, Musumeci O, Valentino ML, Caporali L, Lamperti C, Tallaksen CM, Duffey P, Miller J, Whittaker RG, Baker MR, Jackson MJ, Clarke MP, Dhillon B, Czermin B, Stewart JD, Hudson G, Reynier P, Bonneau D, Marques W, Jr, Lenaers G, McFarland R, Taylor RW, Turnbull DM, Votruba M, Zeviani M, Carelli V, Bindoff LA, Horvath R, Amati-Bonneau P, Chinnery PF. Multi-system neurological disease is common in patients with OPA1 mutations. Brain. 2010;133:771–86. doi: 10.1093/brain/awq007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Votruba M, Thiselton D, Bhattacharya SS. Optic disc morphology of patients with OPA1 autosomal dominant optic atrophy. Br J Ophthalmol. 2003;87:48–53. doi: 10.1136/bjo.87.1.48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Fournier AV, Damji KF, Epstein DL, Pollock SC. Disc excavation in dominant optic atrophy: differentiation from normal tension glaucoma. Ophthalmology. 2001;108:1595–602. doi: 10.1016/s0161-6420(01)00696-0. [DOI] [PubMed] [Google Scholar]
  • 23.Puomila A, Huoponen K, Mäntyjärvi M, Hämäläinen P, Paananen R, Sankila EM, Savontaus ML, Somer M, Nikoskelainen E. Dominant optic atrophy: correlation between clinical and molecular genetic studies. Acta Ophthalmol Scand. 2005;83:337–46. doi: 10.1111/j.1600-0420.2005.00448.x. [DOI] [PubMed] [Google Scholar]
  • 24.Baris O, Delettre C, Amati-Bonneau P, Surget MO, Charlin JF, Catier A, Derieux L, Guyomard JL, Dollfus H, Jonveaux P, Ayuso C, Maumenee I, Lorenz B, Mohammed S, Tourmen Y, Bonneau D, Malthiery Y, Hamel C, Reynier P. Fourteen novel OPA1 mutations in autosomal dominant optic atrophy including two de novo mutations in sporadic optic atrophy. Hum Mutat. 2003;21:656. doi: 10.1002/humu.9152. [DOI] [PubMed] [Google Scholar]
  • 25.Schimpf S, Fuhrmann N, Schaich S, Wissinger B. Comprehensive cDNA study and quantitative transcript analysis of mutant OPA1 transcripts containing premature termination codons. Hum Mutat. 2008;29:106–12. doi: 10.1002/humu.20607. [DOI] [PubMed] [Google Scholar]
  • 26.Ferré M, Bonneau D, Milea D, Chevrollier A, Verny C, Dollfus H, Ayuso C, Defoort S, Vignal C, Zanlonghi X, Charlin JF, Kaplan J, Odent S, Hamel CP, Procaccio V, Reynier P, Amati-Bonneau P. Molecular screening of 980 cases of suspected hereditary optic neuropathy with a report on 77 novel OPA1 mutations. Hum Mutat. 2009;30:E692–705. doi: 10.1002/humu.21025. [DOI] [PubMed] [Google Scholar]
  • 27.Alexander C, Votruba M, Pesch UE, Thiselton DL, Mayer S, Moore A, Rodriguez M, Kellner U, Leo-Kottler B, Auburger G, Bhattacharya SS, Wissinger B. OPA1, encoding a dynamin-related GTPase, is mutated in autosomal dominant optic atrophy linked to chromosome 3q28. Nat Genet. 2000;26:211–5. doi: 10.1038/79944. [DOI] [PubMed] [Google Scholar]
  • 28.Pesch UE, Leo-Kottler B, Mayer S, Jurklies B, Kellner U, Apfelstedt-Sylla E, Zrenner E, Alexander C, Wissinger B. OPA1 mutations in patients with autosomal dominant optic atrophy and evidence for semi-dominant inheritance. Hum Mol Genet. 2001;10:1359–68. doi: 10.1093/hmg/10.13.1359. [DOI] [PubMed] [Google Scholar]
  • 29.Yu-Wai-Man P, Griffiths PG, Burke A, Sellar PW, Clarke MP, Gnanaraj L, Ah-Kine D, Hudson G, Czermin B, Taylor RW, Horvath R, Chinnery PF. The prevalence and natural history of dominant optic atrophy due to OPA1 mutations. Ophthalmology. 2010;117:1538–46. doi: 10.1016/j.ophtha.2009.12.038. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Molecular Vision are provided here courtesy of Emory University and the Zhongshan Ophthalmic Center, Sun Yat-sen University, P.R. China

RESOURCES