Skip to main content
Veterinary Research logoLink to Veterinary Research
. 2014 May 21;45(1):57. doi: 10.1186/1297-9716-45-57

Identification and genotyping of feline infectious peritonitis-associated single nucleotide polymorphisms in the feline interferon-γ gene

Li-En Hsieh 1, Ling-Ling Chueh 1,
PMCID: PMC4041894  PMID: 24886103

Abstract

Feline infectious peritonitis (FIP) is an immune-mediated, highly lethal disease caused by feline coronavirus (FCoV) infection. Currently, no protective vaccine or effective treatment for the disease is available. Studies have found that some cats survive the challenge of virulent FCoV isolates. Since cellular immunity is thought to be critical in preventing FIP and because diseased cats often show a significant decrease in interferon-γ (IFN-γ) production, we investigated whether single nucleotide polymorphisms (SNP) in the feline IFN-γ gene (fIFNG) are associated with the outcome of infection. A total of 82 asymptomatic and 63 FIP cats were analyzed, and 16 SNP were identified in intron 1 of fIFNG. Among these SNP, the fFING + 428 T allele was shown to be a FIP-resistant allele (p = 0.03), and the heterozygous genotypes 01C/T and +408C/T were found to be FIP-susceptible factors (p = 0.004). Furthermore, an fIFNG + 428 resistant allele also showed a clear correlation with the plasma level of IFN-γ in FIP cats. For the identification of these three FIP-related SNP, genotyping methods were established using amplification refractory mutation system PCR (ARMS-PCR) and restriction fragment length polymorphisms (RFLP), and the different genotypes could easily be identified without sequencing. The identification of additional FIP-related SNP will allow the selection of resistant cats and decrease the morbidity of the cat population to FIP.

Introduction

Feline infectious peritonitis (FIP) is an immune-mediated disease caused by feline coronavirus (FCoV) infection. Despite the vast number of studies conducted since the recognition of FIP [1], neither effective vaccines nor therapeutic agents are available for the prevention or treatment of this often fatal disease. Therefore, it remains one of the most important feline infectious diseases.

Despite the ubiquitous existence of FCoV in cat populations around the world, the development of FIP was only observed in fewer than 5% of the FCoV-infected cats [2]. In addition, during the past few decades, several studies were conducted using various FCoV isolates, and regardless of the dose of virulent FCoV, some cats survived from the experimental infection [2-11]. Genetic polymorphisms in the host were suggested to be important in the resistance to FIP [2]; however, no specific gene with a clear correlation to resistance to this disease has ever been identified.

The protective immunity to FIP is thought to result mainly from cell-mediated immunity (CMI), and changes in the expression of several cytokines have been observed in cats with either experimentally induced or naturally occurring FIP [2]. The expression of one of the cytokines studied, interferon-γ (IFN-γ), was consistently decreased in diseased animals, and this gene is thought to play a protective role in the pathogenesis of FIP, since it is a key cytokine in CMI [6,8,12-14].

In recent decades, single nucleotide polymorphisms (SNP) in the IFN-γ gene (IFNG) have been found to be associated with various pathological conditions in humans [15] as well as in ruminants and fowl [16-23]. Nevertheless, this gene has not been investigated in cats. To identify a possible association between feline IFNG (fIFNG) SNP and the outcome of FCoV infection, some regions of the fIFNG gene were sequenced and analyzed. Three SNP with statistical relevance were found to be associated with the occurrence of FIP, and polymerase chain reaction (PCR) assays based on these differences were designed as a potential screening test for the selection of FIP-resistant populations.

Materials and methods

Specimens

Whole blood and buccal swabs were collected from 82 FCoV-infected asymptomatic cats and 64 FIP cats from 2005 to 2012 at the National Taiwan University Animal Hospital for the association analysis. All asymptomatic healthy cats were three years old or younger and had positive reverse transcription-nested PCR test results for FCoV infection [24] in any of the following samples upon first arriving at the hospital: whole blood or nasal, oral, conjunctival, or rectal swabs. In addition, these cats showed no FIP-related symptoms when recruited into the study, and except for 12 cats, they stayed healthy for at least two years. All the FIP cases enrolled in this study were cats showing typical clinical signs of FIP and further confirmed by necropsy, histopathological examinations and FCoV detection [24] in disease-associated tissues, i.e. body effusions, kidney, liver, spleen, mesenteric lymph node, lung, and/or brain.

To elucidate the role of host genetic background in the development of FIP, two viral pathogens, i.e. feline immunodeficiency virus (FIV) and feline leukemia virus (FeLV), that cause immunosuppression in cats were checked in FIP cats using nested PCR [25,26], and the positive cats were omitted from the association analysis.

Identification of SNP in the partial fIFNG sequences

The genomic DNA from each cat was extracted using a genomic DNA mini kit (Geneaid Biotech, New Taipei City, Taiwan), and partial fIFNG sequences were amplified by PCR. Briefly, the genomic DNA was amplified with primers aligning to either the 5′ proximal regulatory region and intron 1 or the 5′ untranslated region and exon 2 of fIFNG (Table  1), and the PCR products were then sequenced from both ends using an auto sequencer ABI 3730XL (Applied Biosystems, San Mateo, USA). The sequences were aligned by Geneious 3.8.5 (Biomatters, Auckland, New Zealand), and the polymorphisms were identified.

Table 1.

Primers used for the identification of SNP, ARMS-PCR and RFLP

Primer Orientationa Positionb Sequence (5′ - 3′)c TA d Amplicon size
Identification of SNP
 
 
 
 
 
  5′-PRRe - intron 1
F
−677 ~ -654
CAGGGCAATGCAAAGCTGTGGTAG
65°C
1306 bp
 
R
+629 ~ +607
GCGGCAGTAGAACTTTGAAACCA
 
 
  5′-UTRf - exon 2
F
−44 ~ -25
CGGAGCTACTGATTTCAACT
63°C
1434 bp
 
R
+1390 ~ +1371
GGAAAGAGGTAAGCTGGGTA
 
 
Genotypingg
 
 
 
 
 
  +401
F (universal)
+320 ~ +341
GGGGCATTCATCAGTCTTCCAG
56°C
200 bp
 
R (universal)
+519 ~ +500
AAGGTCAGGGTTAGCATGAA
 
 
 
F (T allele)
+382 ~ +402
TAATTTTGTGGTGAGAATCTA
 
138 bp
 
R (C allele)
+418 ~ +400
CAACATCACAGTCTAATGG
 
99 bp
  +408
F
+320 ~ +341
GGGGCATTCATCAGTCTTCCAG
56°C
200 bp
 
R
+519 ~ +500
AAGGTCAGGGTTAGCATGAA
 
 
  +428
F (universal)
+288 ~ +307
TACCCTCTGCTCAACTTGCT
67°C
232 bp
 
R (universal)
+519 ~ +500
AAGGTCAGGGTTAGCATGAA
 
 
 
F (T allele)
+408 ~ +429
CTGTGATGTTGGGTAGTGTGTC
 
112 bp
  R (C allele) +449 ~ +427 GGCTAGTCATTGTTTCAATAGGC   162 bp

aF: forward; R: reverse.

bThe nucleotide positions start from the first translation start point (+1).

cThe italicizing indicates the target SNP.

dAnnealing temperature.

e5′-proximal regulatory region.

f5′-untranslated region.

gPCR was done with a heating and cooling rate of 3 and 2 °C, respectively.

Linkage disequilibrium (LD) test and association analysis

An LD test and the creation of an LD plot were performed using LD2SNPing v 2.0 (Department of Electronics Engineering, National Kaohsiung University of Applied Science, Kaohsiung, Taiwan) [27]. The associations between SNP and the outcome of FCoV infection were analyzed. A Fisher’s exact test value of P < 0.05 was considered to represent a significant association.

Quantification of IFN-γ levels in the plasma samples of FIP cats

The plasma samples of FIP cats collected at the day of presentation were stored at −20 °C before use. The concentration of IFN-γ in the plasma samples was determined using an antigen capture ELISA (R & D system, McKinley Place NE, USA) following the procedure advised by the manufacturer’s instructions.

Genotyping of SNP by tetra-primer amplification refractory mutation system PCR (ARMS-PCR) and restriction fragment length polymorphisms (RFLP)

For the genotyping of SNP using ARMS-PCR, the PCR reactions contained 1 μL of template DNA, each primer at 500 nM, 200 μM dNTP, 1.5 mM MgCl2, and 0.4 U Phusion DNA polymerase (Thermo Scientific, Waltham, USA) in a total volume of 20 μL with 1× Phusion HF buffer. The primers and PCR conditions are listed in Table  1. The PCR products were resolved in 2% agarose gels and photographed using an imaging system. The PCR for the genotyping of SNP with RFLP was carried out with the same protocol, and the PCR products were digested with HpyCH4III (New England Biolabs, Ipswich, USA) following the manufacturer’s instructions. The digested DNA was resolved in 2% agarose gels and photographed using an imaging system.

Results

Polymorphisms in fIFNG

Due to a lack of information on polymorphisms in fIFNG, DNA from 40 cats, including 20 asymptomatic and 20 FIP cats, was sequenced throughout the proximal regulatory region, the 5′-UTR, exon 1, intron 1 and a partial exon 2 region of fIFNG. In the 2067 bp analyzed, 3 repeat regions and 16 SNP were identified (Figure  1A). Among these 19 polymorphisms, only one was located in the proximal regulatory region, and the others were in intron 1. No polymorphisms were identified in the 5′-UTR, exon 1 or exon 2. Intron 1 was more polymorphic than the upstream region of fIFNG. The allele frequencies of all the SNP surveyed were identified and are listed in Figure  1. The mean allele frequencies of the minor alleles ranged from 4.8% to 47.6%.

Figure 1.

Figure 1

A schematic of the partial fIFNG sequences analyzed in this study. (A) A partial fIFNG sequence of 2067 bp was sequenced in this study, including the 5′ proximal regulatory region, 5′ UTR, exon 1, intron 1 and a partial exon 2 region. Black box: repeat region. White box: 5′ UTR. Gray boxes: exons 1 and 2. ?: a ~115 bp region between 2 repeat regions of unknown sequence. (B) LD plot of the 16 SNP tested in this study. The r2 values between different SNP are indicated by different colors.

The SNP were then subjected to LD analysis. An LD plot of all the SNP for the whole population, including asymptomatic and FIP cats, was generated (Figure  1B). Three pairs of SNP were found to be significantly associated (r2 > 0.8): fIFNG + 230 T/C and fIFNG + 308A/C, fIFNG + 401 T/C and fIFNG + 408 T/C, and fIFNG + 524G/A and fIFNG + 1133G/C. fIFNG + 230 and fIFNG + 308 and fIFNG + 401 and fIFNG + 408 had a high degree of LD and were inherited together 100% of the time.

Association study

To elucidate the association between the identified SNP and the outcome of FCoV infection, the frequency of each genotype (Additional file 1) and allele (Additional file 2) was analyzed in 82 asymptomatic and 63 FIV and FeLV-free FIP cats. From all the SNP tested, only fIFNG + 428C/T was found to be significantly associated with the outcome of the infection. At position +428, there was a higher frequency of the CT genotype in asymptomatic control cats (19.5%) than in FIP cats (6.3%), and the data showed a significant correlation with disease resistance (p = 0.03) (Table  2). Similarly, the analysis of allele frequency and disease outcome also revealed that the T allele at position +428 was significantly associated with resistance to FIP (p = 0.03) (Table  2).

Table 2.

FIP-associated SNP in fIFNG identified in the whole cat population in this study

SNP Control number (%) FIP number (%) OR (95% CI) P
fIFNG + 428
 
 
 
 
  CC
66 (80.5)
60 (93.8)
3.6 (1.2-11.5)
0.03
  CT
16 (19.5)
4 (6.3)
Reference
 
  TT
0 (0.0)
0 (0.0)
a
 
  Allele C
148 (90.2)
124 (96.9)
3.4 (1.1-10.3)
0.03
  Allele T 16 (9.8) 4 (3.1) Reference  

ano OR can be calculated.

Although both types I and II FCoV can cause FIP, type II FCoV has been found to be more related to acute infection [28] and can cause horizontal transmission [29] whereas infection with type I viruses often results in persistent infection [30], therefore the host genotype involved in type I FCoV infection likely influences the resistance to a greater extent. To gain a better insight into the effect of host genetic variation in fIFNG and FIP, 29 type I FCoV-infected FIP cats were selected for further analysis (Additional files 3 and 4). After analyzing the target population, despite no allele of any SNP showing an association with the infection outcome (Table  3), the heterozygous genotype (CT genotype) at positions +401 and +408 were found to be significantly associated with susceptibility to FIP (p = 0.004) (Table  3).

Table 3.

FIP-associated SNP in fIFNG identified in the type I FCoV-infected cats

SNP Control number (%) FIP number (%) OR (95% CI) P
fIFNG + 401
 
 
 
 
  TT
43 (52.4)
11 (37.9)
0.4 (0.2-0.9)
0.004
  CT
26 (31.7)
18 (62.1)
Reference
 
  CC
13 (15.9)
0 (0.0)
n/aa
 
  Allele C
112 (68.3)
40 (69.0)
b
1.00
  Allele T
52 (31.7)
18 (31.0)

 
fIFNG + 408
 
 
 
 
  TT
43 (52.4)
11 (37.9)
0.4 (0.2-0.9)
0.004
  CT
26 (31.7)
18 (62.1)
Reference
 
  CC
13 (15.9)
0 (0.0)
n/aa
 
  Allele C
112 (68.3)
40 (69.0)

1.00
  Allele T 52 (31.7) 18 (31.0)  

anot available.

bno OR can be calculated.

Production of IFN-γ in FIP cats carrying different genotypes

To further validate the correlation between FIP-associated SNP and the production of IFN-γ, the concentration of IFN-γ in the plasma samples from 15 FIP cats was measured. For most of the FIP cats (12/15; 80%), the concentration was below the detection limit (<3.125 pg/mL) except for three cats. The concentrations of IFN-γ for cat 14, 17, and 69 were 52, 138 and > 8000 pg/mL, respectively (Figure  2, Additional file 5). These three animals were the only cats carrying the resistant allele (T allele) at position +428 whereas others were fIFNG + 428CC genotype (Figure  2B, Additional file 5). For the fIFNG + 401/+408, however, no clear correlation between the IFN-γ responses and genotypes was observed (Figure  2A, Additional file 5).

Figure 2.

Figure 2

Plasma concentration of IFN-γ in FIP cats carrying different genotypes at positions +401/+408 (A) and +428 (B). The concentration of IFN-γ was measured using antigen capture ELISA. A dotted line indicates the detection limit of the assay.

Genotyping for disease-related SNP

Through the association analysis and the quantification of plasma IFN-γ level, fIFNG + 428C/T was found to be associated with FIP and the plasma concentration of IFN-γ. In addition to this SNP, fIFNG + 401C/T and fIFNG + 408C/T were also shown to be associated with the type I FCoV-infected FIP population. To develop screening that can easily distinguish the resistant cats from the at-risk ones, ARMS-PCR specific for fIFNG + 428C/T and fIFNG + 401C/T was attempted. Using the tetra primer ARMS-PCR, the different alleles at position +401 could be successfully distinguished: universal control product: 200 bp; T allele: 138 bp; C allele: 99 bp (Figure  3A). Similarly, the C and T alleles could be determined at position +428: universal control product: 232 bp; C allele: 162 bp; T allele: 112 bp (Figure  3C). For fIFNG + 408, RFLP was used for genotyping, and the digested PCR products for the T allele could be found at 151 bp and 54 bp; the digested PCR products for the C allele could be found at 113 bp, 54 bp, and 43 bp (Figure  3B).

Figure 3.

Figure 3

The ARMS-PCR and RFLP established in this study for the genotyping at positions +401 (A), +408 (B) and +428 (C). The primers and PCR conditions are listed in Table 1. The PCR products (A and C) and the RFLP products (B) were resolved in 2% agarose gel and photographed.

Discussion

The occurrence of FIP is thought to be largely affected by viral virulence factors, and their roles in FIP have been intensely studied. Several viral genes, including spike[31-33], accessory gene 3c[34-36] and 7b [37-39], and membrane[40], have been proposed to play important roles in the development of the disease in FCoV-infected cats. As a disease with immunopathogenesis entity, the knowledge of the host genetic factors that affect FIP is still very limited, and only two studies have reported such factors [41,42], in contrast to the considerable quantity of information on the virulence factors.

Addie et al. who conducted the first study, attempted to reveal the genetic background of the cats and their associations with the occurrence of FIP (Table  4) [42]. Considering its important role in the defense against viral infection, feline leucocyte antigen (FLA)-DRB polymorphisms were analyzed in four different domestic shorthaired (DSH) or other purebred populations: FIP, FCoV carrier, transient infection and resistant. However, no association was found between any of the FLA-DRB polymorphisms and the occurrence of FIP, which might be due to the small sample size (FIP: 8 cats; asymptomatic: 17 cats) used. To gain better insight, a larger number of cats in each population was used (FIP: 63 cats; asymptomatic: 82 cats), and the association was clearly observed in the present study (Table  4).

Table 4.

Studies conducted on host genetic polymorphisms and their associations with FIP

Target Method Breed Grouping (number of cats) Polymorphism associated with FIP Reference
FLA-DRB
1. Clonal sequence analysis
DSHb and Pure breed
1. FIP (8)
Non
[42]
2. RSCAa
2. Carrier (4)
3. Transient (10)
4. Resistant (3)
Identified SNP
SNP gene chip
Birman cats
1. FIP (34)
1. A2.191286425 - ELMO1
[41]
2. Healthy (151)
2. A1.196617776 - ERAP1, 2
3. A1.206840008 - ERAP1, 2
4. Un.59861682 - ERAP1, 2
5. E2.65509996 - UI c
fIFNG
PCR and sequencing
DSH and Pure breed
1. FIP (63)
1. fIFNG + 401
This study
2. Healthy (82)
2. fIFNG + 408
  3. fIFNG + 428  

aReference strand mediated conformational analysis.

bDomestic shorthaired.

cUnidentified.

Recently, several FIP-associated SNP were identified by a massive screen of Birman cats using a commercialized SNP gene chip, and the candidate genes were located from 69 kb to more than 1 Mb away from the identified SNP (Table  4) [41]. In contrast to that report, the SNP were located within the candidate gene, fIFNG, in our study, which demonstrates a stronger linkage of the analyzed SNP to the candidate gene. In addition, the cat populations enrolled in this study, including approximately 50% DSH and another 50% pure breed or mixed breed cats, were more variable, and the SNP associated with the disease may have been better represented on the entire cat population.

IFN-γ is a crucial regulatory cytokine in CMI and is important for the control of intracellular pathogens. In FCoV infection, decreased IFN-γ production in FIP cats was consistently observed in multiple studies [6,8,12-14]. In addition, in FCoV-infected non-FIP cats, the peripheral blood mononuclear cells showed a significant increase in the IFN-γ response upon stimulation with the FCoV antigen when compared to the FIP cats [3]. The expression of IFN-γ was thought to protect against FCoV infection. In several studies on human viral infections, i.e., human immunodeficiency virus [43], hepatitis B and hepatitis C [44,45], a similar correlation between the magnitude of the IFN-γ response and disease manifestation was identified. The polymorphisms in IFNG were associated with the diseases caused by these viruses [46-48].

The SNP associated with FIP are located in the intron 1 region. Therefore, it is unlikely that they mediate the outcome of the infection directly by altering the function of IFN-γ. In humans, IFNG polymorphisms have been found that correlate with the expression of IFN-γ. In the promoter region, SNP at positions −183 and −155 were found to influence the binding of activating transcription factor-1 and the nuclear factor-associated T-cell site [49,50]. In addition, the number of CA microsatellite repeats was found to be tightly associated with the SNP at position +874 and to influence the production of IFN-γ by altering the binding activity of nuclear factor kappa-light-chain-enhancer of activated B cells [15]. In ewes, despite the polymorphisms in INFG at position -641, the microsatellite showed a significant effect on IFNG expression in the spleen, although the mechanism that mediates this effect remains unknown. In the present study, a clear correlation between the IFN-γ responses and the genotype at position +428 was observed (Figure  2B). The resistant T allele at position +428 may serve as a major factor to enhance the IFN-γ production upon infections of intracellular pathogens. Despite lacking correlation with the IFN-γ level, the SNP at positions +401 and +408 might still play a minor role in the alteration of the production of IFN-γ. Since the three FIP-related SNP identified in this study are located in a small cluster, it is possible that these polymorphisms alter the binding of one or more transcription factors and work together to influence the immune response to FCoV infection. However, the actual mechanism for the altered expression of IFN-γ remains to be investigated.

In this study, three SNP in fIFNG were found to be associated with the outcome of FCoV infection. Using the ARMS-PCR and RFLP tests established, the three SNP could be distinguished in the ordinary diagnostic laboratory without sequencing, and cats bearing either the susceptible or resistant genotypes could be identified. Since the disease outcome is usually influenced by multiple host genes, other candidate genes, i.e., tumor necrosis factor-α [51,52], interleukin-12 [6] and CD209 [53], are currently being surveyed. A combination of all the FIP-related SNP into a single genotyping microarray will allow the selection of resistant cats before breeding and eventually decrease the morbidity of the cat population to FIP.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

LEH performed the sample preparation, fIFNG amplification and sequencing, measurement of the plasma concentration of IFN-γ, established genotyping methods and prepared the manuscript. LLC conceived the study, participated in the study design and coordination and contributed to the preparation of the manuscript. Both authors read and approved the final manuscript.

Supplementary Material

Additional file 1

Frequencies of the various genotypes and their associations with the outcome of FCoV infection. The CT genotype at position +428 was significantly associated with the resistance of FIP.

Click here for file (22.6KB, docx)
Additional file 2

Frequencies of various alleles and their associations with the outcome of FCoV infection. The T allele at position +428 was significantly associated with the resistance of FIP.

Click here for file (20.3KB, docx)
Additional file 3

Frequencies of various genotypes and their associations with the outcomes of type I FCoV infection. The heterologous genotypes of fIFNG + 401 and fIFNG + 408 were associated with the susceptibility to FIP in type I FCoV-infected cats.

Click here for file (22.2KB, docx)
Additional file 4

Frequencies of various alleles and their associations with the outcomes of type I FCoV infection. No allele of the analyzed SNP was associated with the occurrence of FIP in type I FCoV-infected cats.

Click here for file (20.2KB, docx)
Additional file 5

Concentration of IFN-γ in the plasma samples of FIP cats carrying different genotypes at positions + 401, +408, and +428 on fIFNG. All the FIP cats carrying the CT genotype at position +428 were positive for the detection of plasma IFN-γ.

Click here for file (14.3KB, docx)

Contributor Information

Li-En Hsieh, Email: d98629008@ntu.edu.tw.

Ling-Ling Chueh, Email: linglingchueh@ntu.edu.tw.

Acknowledgements

This work was supported by the grant NSC 102-2313-B-002- 027 from the National Science Council, Taiwan.

References

  1. Holzworth J. Some important disorders of cats. Cornell Vet. 1963;53:157–160. [PubMed] [Google Scholar]
  2. Pedersen NC. A review of feline infectious peritonitis virus infection: 1963-2008. J Feline Med Surg. 2009;11:225–258. doi: 10.1016/j.jfms.2008.09.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Satoh R, Furukawa T, Kotake M, Takano T, Motokawa K, Gemma T, Watanabe R, Arai S, Hohdatsu T. Screening and identification of T helper 1 and linear immunodominant antibody-binding epitopes in the spike 2 domain and the nucleocapsid protein of feline infectious peritonitis virus. Vaccine. 2011;29:1791–1800. doi: 10.1016/j.vaccine.2010.12.106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. de Groot-Mijnes JD, van Dun JM, van der Most RG, de Groot RJ. Natural history of a recurrent feline coronavirus infection and the role of cellular immunity in survival and disease. J Virol. 2005;79:1036–1044. doi: 10.1128/JVI.79.2.1036-1044.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Haijema BJ, Volders H, Rottier PJ. Live, attenuated coronavirus vaccines through the directed deletion of group-specific genes provide protection against feline infectious peritonitis. J Virol. 2004;78:3863–3871. doi: 10.1128/JVI.78.8.3863-3871.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Kiss I, Poland AM, Pedersen NC. Disease outcome and cytokine responses in cats immunized with an avirulent feline infectious peritonitis virus (FIPV)-UCD1 and challenge-exposed with virulent FIPV-UCD8. J Feline Med Surg. 2004;6:89–97. doi: 10.1016/j.jfms.2003.08.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Hohdatsu T, Yamato H, Ohkawa T, Kaneko M, Motokawa K, Kusuhara H, Kaneshima T, Arai S, Koyama H. Vaccine efficacy of a cell lysate with recombinant baculovirus-expressed feline infectious peritonitis (FIP) virus nucleocapsid protein against progression of FIP. Vet Microbiol. 2003;97:31–44. doi: 10.1016/j.vetmic.2003.09.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Dean GA, Olivry T, Stanton C, Pedersen NC. In vivo cytokine response to experimental feline infectious peritonitis virus infection. Vet Microbiol. 2003;97:1–12. doi: 10.1016/j.vetmic.2003.08.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Wasmoen TL, Kadakia NP, Unfer RC, Fickbohm BL, Cook CP, Chu HJ, Acree WM. Protection of cats from infectious peritonitis by vaccination with a recombinant raccoon poxvirus expressing the nucleocapsid gene of feline infectious peritonitis virus. Adv Exp Med Biol. 1995;380:221–228. doi: 10.1007/978-1-4615-1899-0_36. [DOI] [PubMed] [Google Scholar]
  10. Vennema H, de Groot RJ, Harbour DA, Horzinek MC, Spaan WJ. Primary structure of the membrane and nucleocapsid protein genes of feline infectious peritonitis virus and immunogenicity of recombinant vaccinia viruses in kittens. Virology. 1991;181:327–335. doi: 10.1016/0042-6822(91)90499-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Pedersen NC, Boyle JF, Floyd K. Infection studies in kittens, using feline infectious peritonitis virus propagated in cell culture. Am J Vet Res. 1981;42:363–367. [PubMed] [Google Scholar]
  12. Gunn-Moore DA, Caney SM, Gruffydd-Jones TJ, Helps CR, Harbour DA. Antibody and cytokine responses in kittens during the development of feline infectious peritonitis (FIP) Vet Immunol Immunopathol. 1998;65:221–242. doi: 10.1016/S0165-2427(98)00156-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Giordano A, Paltrinieri S. Interferon-gamma in the serum and effusions of cats with feline coronavirus infection. Vet J. 2009;180:396–398. doi: 10.1016/j.tvjl.2008.02.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Gelain ME, Meli M, Paltrinieri S. Whole blood cytokine profiles in cats infected by feline coronavirus and healthy non-FCoV infected specific pathogen-free cats. J Feline Med Surg. 2006;8:389–399. doi: 10.1016/j.jfms.2006.05.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Pravica V, Perrey C, Stevens A, Lee JH, Hutchinson IV. A single nucleotide polymorphism in the first intron of the human IFN-gamma gene: absolute correlation with a polymorphic CA microsatellite marker of high IFN-gamma production. Hum Immunol. 2000;61:863–866. doi: 10.1016/S0198-8859(00)00167-1. [DOI] [PubMed] [Google Scholar]
  16. Maryam J, Babar ME, Nadeem A, Hussain T. Genetic variants in interferon gamma (IFN-gamma) gene are associated with resistance against ticks in Bos taurus and Bos indicus. Mol Biol Rep. 2012;39:4565–4570. doi: 10.1007/s11033-011-1246-8. [DOI] [PubMed] [Google Scholar]
  17. Pant SD, Verschoor CP, Skelding AM, Schenkel FS, You Q, Biggar GA, Kelton DF, Karrow NA. Bovine IFNGR2, IL12RB1, IL12RB2, and IL23R polymorphisms and MAP infection status. Mamm Genome. 2011;22:583–588. doi: 10.1007/s00335-011-9332-8. [DOI] [PubMed] [Google Scholar]
  18. Verschoor CP, Pant SD, Biggar GA, Schenkel FS, Sharma BS, Karrow NA. Identification of SNPs in interferon gamma, interleukin-22, and their receptors and associations with health and production-related traits in Canadian Holstein bulls. Anim Biotechnol. 2011;22:7–15. doi: 10.1080/10495398.2011.536078. [DOI] [PubMed] [Google Scholar]
  19. Dervishi E, Uriarte J, Valderrabano J, Calvo JH. Structural and functional characterisation of the ovine interferon gamma (IFNG) gene: its role in nematode resistance in Rasa Aragonesa ewes. Vet Immunol Immunopathol. 2011;141:100–108. doi: 10.1016/j.vetimm.2011.02.013. [DOI] [PubMed] [Google Scholar]
  20. Darlay RJ, McCarthy AJ, Illot NE, Smith JE, Shaw MA. Novel polymorphisms in ovine immune response genes and their association with abortion. Anim Genet. 2011;42:535–543. doi: 10.1111/j.1365-2052.2011.02180.x. [DOI] [PubMed] [Google Scholar]
  21. Dukkipati VS, Blair HT, Garrick DJ, Lopez-Villalobos N, Whittington RJ, Reddacliff LA, Eppleston J, Windsor P, Murray A. Association of microsatellite polymorphisms with immune responses to a killed Mycobacterium avium subsp. paratuberculosis vaccine in Merino sheep. N Z Vet J. 2010;58:237–245. doi: 10.1080/00480169.2010.69154. [DOI] [PubMed] [Google Scholar]
  22. Downing T, Lynn DJ, Connell S, Lloyd AT, Bhuiyan AK, Silva P, Naqvi AN, Sanfo R, Sow RS, Podisi B, O’Farrelly C, Hanotte O, Bradley DG. Contrasting evolution of diversity at two disease-associated chicken genes. Immunogenetics. 2009;61:303–314. doi: 10.1007/s00251-009-0359-x. [DOI] [PubMed] [Google Scholar]
  23. Kramer J, Malek M, Lamont SJ. Association of twelve candidate gene polymorphisms and response to challenge with Salmonella enteritidis in poultry. Anim Genet. 2003;34:339–348. doi: 10.1046/j.1365-2052.2003.01027.x. [DOI] [PubMed] [Google Scholar]
  24. Herrewegh AA, de Groot RJ, Cepica A, Egberink HF, Horzinek MC, Rottier PJ. Detection of feline coronavirus RNA in feces, tissues, and body fluids of naturally infected cats by reverse transcriptase PCR. J Clin Microbiol. 1995;33:684–689. doi: 10.1128/jcm.33.3.684-689.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Nishimura Y, Goto Y, Pang H, Endo Y, Mizuno T, Momoi Y, Watari T, Tsujimoto H, Hasegawa A. Genetic heterogeneity of env gene of feline immunodeficiency virus obtained from multiple districts in Japan. Virus Res. 1998;57:101–112. doi: 10.1016/S0168-1702(98)00085-9. [DOI] [PubMed] [Google Scholar]
  26. Stiles J, Bienzle D, Render JA, Buyukmihci NC, Johnson EC. Use of nested polymerase chain reaction (PCR) for detection of retroviruses from formalin-fixed, paraffin-embedded uveal melanomas in cats. Vet Ophthalmol. 1999;2:113–116. doi: 10.1046/j.1463-5224.1999.00066.x. [DOI] [PubMed] [Google Scholar]
  27. Chang HW, Chuang LY, Chang YJ, Cheng YH, Hung YC, Chen HC, Yang CH. LD2SNPing: linkage disequilibrium plotter and RFLP enzyme mining for tag SNPs. BMC Genet. 2009;10:26. doi: 10.1186/1471-2156-10-26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lin CN, Su BL, Wang CH, Hsieh MW, Chueh TJ, Chueh LL. Genetic diversity and correlation with feline infectious peritonitis of feline coronavirus type I and II: A 5-year study in Taiwan. Vet Microbiol. 2009;136:233–239. doi: 10.1016/j.vetmic.2008.11.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Wang YT, Su BL, Hsieh LE, Chueh LL. An outbreak of feline infectious peritonitis in a Taiwanese shelter: epidemiologic and molecular evidence for horizontal transmission of a novel type II feline coronavirus. Vet Res. 2013;44:57. doi: 10.1186/1297-9716-44-57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Addie DD, Schaap IA, Nicolson L, Jarrett O. Persistence and transmission of natural type I feline coronavirus infection. J Gen Virol. 2003;84:2735–2744. doi: 10.1099/vir.0.19129-0. [DOI] [PubMed] [Google Scholar]
  31. Rottier PJ, Nakamura K, Schellen P, Volders H, Haijema BJ. Acquisition of macrophage tropism during the pathogenesis of feline infectious peritonitis is determined by mutations in the feline coronavirus spike protein. J Virol. 2005;79:14122–14130. doi: 10.1128/JVI.79.22.14122-14130.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Chang HW, Egberink HF, Halpin R, Spiro DJ, Rottier PJ. Spike protein fusion Peptide and feline coronavirus virulence. Emerg Infect Dis. 2012;18:1089–1095. doi: 10.3201/eid1807.120143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Licitra BN, Millet JK, Regan AD, Hamilton BS, Rinaldi VD, Duhamel GE, Whittaker GR. Mutation in spike protein cleavage site and pathogenesis of feline coronavirus. Emerg Infect Dis. 2013;19:1066–1073. doi: 10.3201/eid1907.121094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Vennema H, Poland A, Foley J, Pedersen NC. Feline infectious peritonitis viruses arise by mutation from endemic feline enteric coronaviruses. Virology. 1998;243:150–157. doi: 10.1006/viro.1998.9045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Chang HW, de Groot RJ, Egberink HF, Rottier PJ. Feline infectious peritonitis: insights into feline coronavirus pathobiogenesis and epidemiology based on genetic analysis of the viral 3c gene. J Gen Virol. 2010;91:415–420. doi: 10.1099/vir.0.016485-0. [DOI] [PubMed] [Google Scholar]
  36. Hsieh LE, Huang WP, Tang DJ, Wang YT, Chen CT, Chueh LL. 3C protein of feline coronavirus inhibits viral replication independently of the autophagy pathway. Res Vet Sci. 2013;95:1241–1247. doi: 10.1016/j.rvsc.2013.08.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Herrewegh AA, Vennema H, Horzinek MC, Rottier PJ, de Groot RJ. The molecular genetics of feline coronaviruses: comparative sequence analysis of the ORF7a/7b transcription unit of different biotypes. Virology. 1995;212:622–631. doi: 10.1006/viro.1995.1520. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Vennema H, Rossen JW, Wesseling J, Horzinek MC, Rottier PJ. Genomic organization and expression of the 3′ end of the canine and feline enteric coronaviruses. Virology. 1992;191:134–140. doi: 10.1016/0042-6822(92)90174-N. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Takano T, Tomiyama Y, Katoh Y, Nakamura M, Satoh R, Hohdatsu T. Mutation of neutralizing/antibody-dependent enhancing epitope on spike protein and 7b gene of feline infectious peritonitis virus: influences of viral replication in monocytes/macrophages and virulence in cats. Virus Res. 2011;156:72–80. doi: 10.1016/j.virusres.2010.12.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Brown MA, Troyer JL, Pecon-Slattery J, Roelke ME, O’Brien SJ. Genetics and pathogenesis of feline infectious peritonitis virus. Emerg Infect Dis. 2009;15:1445–1452. doi: 10.3201/eid1509.081573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Golovko L, Lyons LA, Liu H, Sorensen A, Wehnert S, Pedersen NC. Genetic susceptibility to feline infectious peritonitis in Birman cats. Virus Res. 2013;175:58–63. doi: 10.1016/j.virusres.2013.04.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Addie DD, Kennedy LJ, Ryvar R, Willoughby K, Gaskell RM, Ollier WE, Nart P, Radford AD. Feline leucocyte antigen class II polymorphism and susceptibility to feline infectious peritonitis. J Feline Med Surg. 2004;6:59–62. doi: 10.1016/j.jfms.2003.12.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Bailer RT, Holloway A, Sun J, Margolick JB, Martin M, Kostman J, Montaner LJ. IL-13 and IFN-gamma secretion by activated T cells in HIV-1 infection associated with viral suppression and a lack of disease progression. J Immunol. 1999;162:7534–7542. [PubMed] [Google Scholar]
  44. Guidotti LG, Ando K, Hobbs MV, Ishikawa T, Runkel L, Schreiber RD, Chisari FV. Cytotoxic T lymphocytes inhibit hepatitis B virus gene expression by a noncytolytic mechanism in transgenic mice. Proc Natl Acad Sci U S A. 1994;91:3764–3768. doi: 10.1073/pnas.91.9.3764. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Heim MH. Innate immunity and HCV. J Hepatol. 2013;58:564–574. doi: 10.1016/j.jhep.2012.10.005. [DOI] [PubMed] [Google Scholar]
  46. Qi S, Cao B, Jiang M, Xu C, Dai Y, Li K, Wang K, Ke Y, Ning T. Association of the -183 polymorphism in the IFN-gamma gene promoter with hepatitis B virus infection in the Chinese population. J Clin Lab Anal. 2005;19:276–281. doi: 10.1002/jcla.20090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Kang MW, Pyo CW, Wie SH, Choi HB, Kim SY, Kim YK, Lee JS, Kim TG. Associations of IFN-gamma polymorphism with HIV-1 infection in the Korean population. AIDS Res Hum Retroviruses. 2006;22:297–299. doi: 10.1089/aid.2006.22.297. [DOI] [PubMed] [Google Scholar]
  48. Dai CY, Chuang WL, Hsieh MY, Lee LP, Hou NJ, Chen SC, Lin ZY, Hsieh MY, Wang LY, Tsai JF, Chang WY, Yu ML. Polymorphism of interferon-gamma gene at position +874 and clinical characteristics of chronic hepatitis C. Transl Res. 2006;148:128–133. doi: 10.1016/j.trsl.2006.04.005. [DOI] [PubMed] [Google Scholar]
  49. Chevillard C, Henri S, Stefani F, Parzy D, Dessein A. Two new polymorphisms in the human interferon gamma (IFN-gamma) promoter. Eur J Immunogenet. 2002;29:53–56. doi: 10.1046/j.0960-7420.2001.00281.x. [DOI] [PubMed] [Google Scholar]
  50. Barbulescu K, Meyer zum Buschenfelde KH, Neurath MF. Constitutive and inducible protein/DNA interactions of the interferon-gamma promoter in vivo in [corrected] CD45RA and CD45R0 T helper subsets. Eur J Immunol. 1997;27:1098–1107. doi: 10.1002/eji.1830270509. [DOI] [PubMed] [Google Scholar]
  51. Takano T, Hohdatsu T, Toda A, Tanabe M, Koyama H. TNF-alpha, produced by feline infectious peritonitis virus (FIPV)-infected macrophages, upregulates expression of type II FIPV receptor feline aminopeptidase N in feline macrophages. Virology. 2007;364:64–72. doi: 10.1016/j.virol.2007.02.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Takano T, Hohdatsu T, Hashida Y, Kaneko Y, Tanabe M, Koyama H. A “possible” involvement of TNF-alpha in apoptosis induction in peripheral blood lymphocytes of cats with feline infectious peritonitis. Vet Microbiol. 2007;119:121–131. doi: 10.1016/j.vetmic.2006.08.033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Regan AD, Ousterout DG, Whittaker GR. Feline lectin activity is critical for the cellular entry of feline infectious peritonitis virus. J Virol. 2010;84:7917–7921. doi: 10.1128/JVI.00964-10. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Additional file 1

Frequencies of the various genotypes and their associations with the outcome of FCoV infection. The CT genotype at position +428 was significantly associated with the resistance of FIP.

Click here for file (22.6KB, docx)
Additional file 2

Frequencies of various alleles and their associations with the outcome of FCoV infection. The T allele at position +428 was significantly associated with the resistance of FIP.

Click here for file (20.3KB, docx)
Additional file 3

Frequencies of various genotypes and their associations with the outcomes of type I FCoV infection. The heterologous genotypes of fIFNG + 401 and fIFNG + 408 were associated with the susceptibility to FIP in type I FCoV-infected cats.

Click here for file (22.2KB, docx)
Additional file 4

Frequencies of various alleles and their associations with the outcomes of type I FCoV infection. No allele of the analyzed SNP was associated with the occurrence of FIP in type I FCoV-infected cats.

Click here for file (20.2KB, docx)
Additional file 5

Concentration of IFN-γ in the plasma samples of FIP cats carrying different genotypes at positions + 401, +408, and +428 on fIFNG. All the FIP cats carrying the CT genotype at position +428 were positive for the detection of plasma IFN-γ.

Click here for file (14.3KB, docx)

Articles from Veterinary Research are provided here courtesy of BMC

RESOURCES