Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2014 Jun;52(6):1846–1852. doi: 10.1128/JCM.03005-13

Comparison of Xpert MTB/RIF with Line Probe Assay for Detection of Rifampin-Monoresistant Mycobacterium tuberculosis

Syed Beenish Rufai 1, Parveen Kumar 1, Amit Singh 1, Suneel Prajapati 1, Veena Balooni 1, Sarman Singh 1,✉
Editor: B A Forbes
PMCID: PMC4042801  PMID: 24648554

Abstract

The MTBDRplus line probe assay (LPA) and Xpert MTB/RIF have been endorsed by the World Health Organization for the rapid diagnosis of drug-resistant tuberculosis. However, there is no clarity regarding the superiority of one over the other. In a double-blinded prospective study, we evaluated the efficacy of the Xpert MTB/RIF on samples that were first tested by LPA under the revised national tuberculosis control program of India. A total of 405 sputum samples from suspected drug-resistant tuberculosis patients were included. Of these, 285 smear-positive samples were subjected to LPA. Seventy-two (25.8%) samples showed multidrug resistance, 62 (22.2%) showed rifampin monoresistance, 29 (10.3%) showed isoniazid monoresistance, and 116 (41.5%) were pan-susceptible. Six (2.1%) of the samples gave invalid results. Of the 62 rifampin-monoresistant samples by LPA, 38 (61.4%) showed rifampin resistance, while 21 (33.8%) were found susceptible to rifampin by Xpert MTB/RIF using cartridge version G4. Three (4.8%) samples gave an error. Of the 116 pan-susceptible samples, only 83 were available for Xpert MTB/RIF testing; 4 (5.1%) were rifampin resistant, 74 (94.8%) were susceptible, and 5 (6.0%) showed an error. The 25 discrepant samples were further subjected to MGIT960 drug susceptibility testing. The MGIT960 results showed 100% agreement with LPA results but only 64.4% agreement with Xpert MTB/RIF results. Sequencing analysis of discrepant samples showed 91.3% concordance with LPA but only 8.7% concordance with the Xpert MTB/RIF assay. These findings indicate that by using Xpert MTB/RIF testing we might be underestimating the burden of drug-resistant tuberculosis and indicate that country-specific probes need to be designed to increase the sensitivity of the Xpert MTB/RIF.

INTRODUCTION

The global burden of tuberculosis (TB), particularly with multidrug resistance (MDR), is increasing and has become a major health challenge (1). The disease caused by Mycobacterium tuberculosis resistant to two primary antitubercular drugs, rifampin (RIF) and isoniazid (INH), is known as MDR-TB. Such instances are more common among clinical relapse cases (2). It has been reported that M. tuberculosis that is resistant to RIF is more likely to have concomitant resistance to INH, making RIF resistance a surrogate marker of MDR-TB (3). Early diagnosis of TB and rapid detection of RIF resistance is important for proper management of drug-resistant TB (DR-TB) (4). But in spite of major efforts that are being done to increase case detection, one-third of new TB cases are still missed due to nonavailability of rapid, low-cost, and accurate diagnostic facilities in high-TB-burden countries (5).

Over the last 6 years, efforts have been made to improve and develop rapid diagnostic tools and drug susceptibility testing (DST) for TB. During this period, the World Health Organization (WHO) had issued 10 policy statements for improving diagnosis of TB, including the use of commercial and noncommercial DST methods and implementation of molecular methods such as the line probe assay (LPA) and Xpert MTB/RIF (or GeneXpert) assay (5). These molecular methods are developed to target the rpoB gene, which consists of a 81-bp hot-spot region from codons 507 to 533, called the rifampin resistance-determining region (RRDR) (6). So far more than 50 mutations have been characterized within this region by DNA sequencing but only point mutations at codons 526 or 531 are known to cause high levels of RIF resistance (7). In contrast, mutations in codons 511, 516, 518, 522, and 533 cause low-level resistance to RIF. Mutations conferring RIF resistance occur rarely in other regions of the rpoB gene (8).

Of the two recently introduced molecular diagnostic methods for RIF resistance detection, LPA technology is based on reverse hybridization of DNA on the strip, while the Xpert MTB/RIF assay is based on real-time PCR. The strip-based DNA hybridization has two commercial assays, INNO-LiPA RIF TB (Innogenetics, Ghent, Belgium) and the Genotype MTBDRplus (Hain Life-Science, Nehren, Germany) (here referred as to LPA). Both LPA and Xpert MTB/RIF assays have shown good performance (98% sensitivity) for RIF resistance detection compared with the gold standard phenotypic DST (4). The standard turnaround time (TAT) for reporting the LPA results is 2 to 3 days, per WHO guidelines. The Xpert MTB/RIF assay has further improved the TAT, and the results can be obtained within 3 h, depending upon the timings of sample receiving and reporting of the result. The technology is considered a game changer. It is based on hemi-nested real-time PCR and molecular beacon technology that detects M. tuberculosis and RIF resistance-conferring mutations directly from clinical samples. It is advocated mainly for use with smear-positive samples, where its sensitivity is reported to be 98%. In smear-negative/culture-positive samples its detection rate is low (72.5% to 76.9%) (9), though its accuracy may vary from region to region due to variation in the circulating M. tuberculosis strains (10).

Both of these technologies are well established for rapid diagnosis and RIF resistance detection in M. tuberculosis, but a systematic comparison of these two techniques with standard liquid culture (MGIT960)-based DST is rarely carried out. To the best of our knowledge, no such data have been published from high-TB-burden countries. In only one study, these technologies were compared with each other for their diagnostic performance, emphasizing the importance of smear positivity and smear negativity of the samples (11). So far, however, no large study has been published that compared these two assays with other gold standard techniques such as MGIT960 culture DST and DNA sequencing. This is probably because not many laboratories have all of these facilities simultaneously. Comparison of these two technologies with the gold standard is crucial in order to validate the accuracy of each test in local laboratory settings, especially before rolling out a particular method in a TB control program. Here, we report the efficacy and accuracy of the Xpert MTB/RIF and LPA in cases of RIF monoresistance compared to the gold standard MGIT960 culture-based DST, with further reconfirmation of these results with rpoB gene sequencing.

MATERIALS AND METHODS

Clinical samples.

A total of 405 sputum specimens (one sample each) from suspected DR-TB patients in the Punjab state of India were received at the TB laboratory, Division of Clinical Microbiology and Molecular Medicine, All India Institute of Medical Sciences, New Delhi, India, for LPA testing under the programmatic management of drug-resistant tuberculosis (PMDT) plan of the revised national tuberculosis control program (RNTCP) (12). The laboratory is accredited as an intermediate reference laboratory (IRL) for LPA testing by RNTCP, India, and certified by the Foundation for Innovative New Diagnostics (FIND)/Stop TB for phenotypic DST. Since the observations were made as a part of national TB control program, a separate ethics clearance was not required (13).

Sample processing.

All sputum samples were received through courier delivery in a cold chain and were processed using the N-acetyl-l-cysteine-sodium citrate-NaOH (NALC-NaOH) method (14). Samples were decanted following centrifugation, and the sediments were resuspended in 3 ml of phosphate buffer solution. Several aliquots were prepared from the processed sample, per the quantity of the original sample. Processed samples were used to perform Ziehl-Neelsen (ZN) staining, MGIT960 culture, and LPA, according to the manufacturers' instructions. Remaining sample aliquots were stored at −80°C for further use and quality control.

Line probe assay.

The LPA was performed according to the manufacturer's protocol (15). The test is based on DNA strip technology and has three steps: DNA extraction, multiplex PCR amplification, and reverse hybridization. All three steps were performed as per the WHO recommendations (16).

Xpert MTB/RIF test.

This study was done in a double-blinded manner. After getting the RIF monoresistance LPA results, one of us asked the persons in charge of the Xpert MTB/RIF to run these samples in the Xpert MTB/RIF without disclosing the purpose of the study and LPA results. The Xpert MTB/RIF test was performed by using the newer version (G4) of cartridges per the manufacturer's instruction (Cepheid, Sunnyvale, CA). A total of 145 samples were subjected to Xpert MTB/RIF retesting; of which 62 were RIF monoresistant and 83 were pan-susceptible by LPA (See Fig. 1, flow chart). Aliquots of these decontaminated samples were taken out of −80°C storage and thawed, and sample reagent buffer containing NaOH and isopropanol was added at the ratio of 3:1, followed by incubation at room temperature for 15 min. Two milliliters of the samples were then transferred into the Xpert MTB/RIF cartridge, and after proper mixing, the cartridge was loaded into the GeneXpert instrument. The results generated after 2 h were recorded using software version 4.3. Reported results were M. tuberculosis negative or positive, with semiquantified bacillary load as high, medium, intermediate, low, or very low, and whether the M. tuberculosis present in the sample is RIF susceptible or resistant (17).

FIG 1.

FIG 1

Algorithm and protocol of the study with summary of results of LPA, Xpert MTB/RIF, MGIT 960, and sequencing of the 81-bp rpoB gene region.

MGIT960 culture and DST (SIRE MGIT-DST).

SB performed phenotypic DST on the discrepant samples. A 500-μl sample was taken out from another aliquot of decontaminated sample and inoculated in Bactec-MGIT960. After the culture flashed positive, streptomycin, isoniazid, rifampin, and ethambutol (SIRE) MGIT-DST was performed per the manufacturer's protocol (18).

DNA sequencing.

For further confirmation of the MGIT960 DST results, DNAs from LPA and Xpert MTB/RIF discordant samples were subjected to sequencing of the 81-bp rpoB gene, as described by Campbell et al. (19). The sequence data were aligned and compared with the H37Rv0667 strain of M. tuberculosis.

Data analysis.

All of the LPA, Xpert MTB/RIF, and MGIT 960-DST data were maintained on MS Excel 2007. The agreement between LPA and Xpert MTB/RIF results was statistically calculated, and the overall accuracies of results for LPA and Xpert MTB/RIF were compared with the gold standard SIRE MGIT-DST and sequencing results.

RESULTS

Line probe assay.

Out of 285 smear-positive samples, 6 (2.1%) gave invalid results on the LPA. Of the remaining 279 samples, 116 (41.5%) were susceptible to both RIF and INH, 72 (25.8%) had MDR, 29 (10.4%) showed INH monoresistance, and 62 (22.2%) showed RIF monoresistance. Thus, out of 134 samples that had resistance to RIF either as monoresistance (n = 62) or as part of MDR (n = 72), only RIF-monoresistant samples (n = 62) were further analyzed by Xpert MTB/RIF (Fig. 1 and Table 1). The wild-type (WT) rpoB probe hybridization band pattern showed that band 8 (WT8) was missing in 37.1% (23/62) RIF-monoresistant samples (Table 2). Thirty-three (53.2%) samples yielded positive hybridization results with the mutation-specific probes, in which the S531L mutation was most frequent (27/33 [81.8%]). Other mutations were also observed, but at a low level (D516V [6.06%], H526Y [9.09%], and H526D [3.03%], respectively).

TABLE 1.

Comparison of LPA, Xpert MTB/RIF, and MGIT-DST results on sputum samples

LPA results (n = 145) (no. of samples) No. (%) of samples with indicated result in:
Xpert MTB/RIF (n = 145)
MGIT-DST (n = 25)a
Resistant Susceptible Errorb Resistant Susceptible Contaminated
LPA RIFr (62) 38 (64.4) 21a (35.5) 3 20 (100) 0 1
LPA RIFs (83) 4a (5.4) 74 (94.5) 5 0 3 (100) 1
a

Discrepant results between LPA and Xpert MTB/RIF.

b

Not included in the further analysis.

TABLE 2.

Mutations detection by LPA and Xpert MTB/RIF in rifampin-resistant M. tuberculosis strains and comparison of the discrepant sample with MGIT-DST and sequencing

Codon region detected by LPA No. of samples with codon region detected by LPA (n = 62) Codon region detected by Xpert MTB/RIF No. of samples found by Xpert MTB/RIF (n = 62) to bea:
No. of samples found by MGIT-DST (n = 21) to beb:
Sequencing results (n = 20)
Resistant Sensitive Resistant Sensitive No. (mutation) No mutation
W1, 2 (507–513) 1 Probe A (507–511) 2 0
W2 (509–513) 1
W3 (513–517) 1 Probe B (512–518) 5 0
W3,4 (513–519) 1
W4 (516–519) 1
MUT 1 (D516V) 2
W 5,6 (520–525) 1 Probe C (518–523) 1 0
MUT 2a (H526Y) 3 Probe D (523–529) 4 0
MUT 2b (H526D) 1
W8 (531–533) 23 Probe E (529–533) 6 17 16 0 14 (L533P) 2
MUT 3 (S531L) 27 20 4 4 4 (S531L) 0
Total 62 38a 21 20b 18 2
a

Three samples gave errors in Xpert MTB/RIF.

b

One sample was contaminated.

Xpert MTB/RIF.

Of the 62 RIF-monoresistant samples by LPA, 3 (4.83%) samples showed errors (2 samples showed probe errors and 1 sample showed invalid results). Thus, the remaining 59 samples were used for further analysis. Out of these 59 samples, 38 (64.4%) had RIF-resistant M. tuberculosis and 21 (35.5%) were found to have RIF-susceptible M. tuberculosis (Tables 1 and 2). On comparative analysis, mutations detected by four probes (A, B, C, and D) of the Xpert MTB/RIF matched (100%) with the mutations detected in similar codon regions by the LPA. However, probe E was not hybridized in 52% of cases which were detected by LPA at the same codon region (531 to 533). This is an important observation and may indicate that in this geographical region, this probe has no or minimal utility.

Of the 116 samples that were susceptible by LPA, 83 samples were available for the Xpert MTB/RIF assay, as others had insufficient sample volume required for testing. Of these, 5 (6.02%) samples showed errors (3 samples showed probe errors and 2 samples showed invalid results), 74 (94.87%) were susceptible, and 4 (5.12%) were RIF resistant (Table 2). Thus, the overall concordances between the LPA and Xpert MTB/RIF were 64.4% and 94.5% for the detection of RIF-resistant and RIF-susceptible strains, respectively. The 25 (21 + 4) discrepant samples had a smear scores of scanty (n = 1), 1+ (n = 7), 2+ (n = 10), and 3+ (n = 7) per the WHO classification. In the Xpert MTB/RIF, 10 samples showed bacillary load as high, 9 as medium, and 6 as low.

MGIT960 DST results.

M. tuberculosis cultures obtained from 25 LPA and Xpert MTB/RIF discrepant samples were tested by the MGIT960 culture DST method as the gold standard. Of these, 21 were LPA RIFr and Xpert MTB/RIFs and 4 were LPA RIFs and Xpert MTB/RIFr. In MGIT960, one culture from each group got contaminated. Of the remaining 23 M. tuberculosis isolates, all showed concordance with LPA results but high discordance with Xpert MTB/RIF results (Table 1 and Fig. 1).

DNA sequencing results.

To further confirm the MGIT960 culture DST results, the 81-bp region of the rpoB gene was sequenced in 20 LPA RIFr and Xpert MTB/RIFs and 3 LPA RIFs and Xpert MTB/RIFr samples. For the LPA RIFr and Xpert MTB/RIFs results, sequencing of the rpoB gene showed mutations in 18 samples, but no mutation was detected in 2 samples. Interestingly, in 14 samples, a rare point mutation at codon 533 (CTG to CCG) was found, and in 4 samples the S531L mutation was found (Tables 2 and 3). In 3 samples which were LPA RIFs and Xpert MTB/RIFr, sequencing of the rpoB gene did not show any mutations (Table 3).

TABLE 3.

Sequencing analysis of 23 discordant samples for the 81-bp rpoB regiona

Sample identification no. Aligned sequence
H37Rv0667 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG
27 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG
82 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTTGGCGCTG
121 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCCG
129 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCCG
130 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG
144 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCCG
145 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCCG
149 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCCG
171 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCCG
176 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG
180 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCCG
209 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTTGGCGCTG
227 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCCG
232 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCCG
233 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTTGGCGCTG
244 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCCG
251 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCCG
252 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCCG
255 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTTGGCGCTG
285 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCCG
293 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG
335 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG
339 GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCCG
a

The 81-bp region includes 27 codons (codons 507 to 533). The results were analyzed by comparison with the standard sequence of H37Rv0667 (boldface letters). Fourteen samples showed a mutation at codon 533 (CTG→CCG), four samples showed a mutation at codon 531 (TCG→TTG), and no mutation was observed in five samples.

DISCUSSION

Studies have shown that in high-TB-burden countries resistance to INH is very common, and the isolate may not be resistant to RIF (13). Conversely, if the isolate is RIF resistant, it is more likely that it is also INH resistant, thus making RIF resistance a surrogate marker for the identification of MDR-TB (3). It is also well established that isolates harboring mutations between codons 526 and 531 show high-level resistance to RIF and that these genetic markers carry very high accuracy in RIF resistance detection (13, 20, 21). Molecular technologies like LPA and Xpert MTB/RIF are the most promising technologies to detect these mutations. The LPA test detects RIF as well as INH resistance due to mutations in the inhA and katG genes, while the Xpert MTB/RIF can detect only RIF resistance.

Of the 405 samples, only 285 (70.3%) were smear positive. Hence, our microscopy detection rate in DR-TB-suspected cases was commendable. Of the 285 smear-positive samples which were subjected to the LPA test, 41.5% were found susceptible to INH and RIF, while 22.2% samples showed RIF monoresistance, which can be expected in a high-TB-burden country like India (8, 13). Much lower RIF monoresistance levels were reported from another high-TB-burden country (South Africa [13.5%]) and a low-TB-burden country (United States [13%]) (22, 23). In the present study, high RIF resistance could be due to the fact that most of the samples were received from relapse cases, which were on category II treatment for more than 2 months. This shows that these patients were not taking the prescribed dose or the drug was not being absorbed optimally, and that might have led to positive selection in the resistant strains of M. tuberculosis (13, 24). As expected, the S531L mutation was the most frequent (81.8%) mutation in RIF-monoresistant strains (8). Several other workers from outside India have also reported similar mutation patterns (25, 26). Interestingly, a rare mutation at codon 533 (CTG to CCG) was also found in RIF-resistant discrepant samples by sequencing analysis, as reported earlier in a few studies (27–29).

One of the most important and obvious reason for the use of the Xpert MTB/RIF is significantly reduced turnaround time for detection. Not only is the TAT reduced to 2 to 3 h, this test can also detect rifampin resistance simultaneously (30). However, after its wide use and analyses of several hundred thousand samples, reports have started emanating that it can give false-negative and false-positive RIF resistance results (31–33). The Xpert MTB/RIF version G4 assay was developed by the manufacturers to increase the assay's robustness and mitigate against potential false RIF-resistant results and to improve the detection of probe E mutants that were difficult to detect with the G3 version (34). The analytical study from South Africa demonstrated that the G4 assay has reduced false RIF-resistant results (35). However, in the present study we did not find the newer version to be so improved, particularly for India. Our study shows that only 64.4% of RIF-monoresistant TB cases were correctly diagnosed by the Xpert MTB/RIF. The remaining 35.6% of cases were detected as falsely RIF susceptible. In our study, the new G4 version cartridges did not detect mutations at P533L in the probe E region, indicating that further improvements, such as the addition of another probe for the detection of mutations at the L533P codon, may be needed. Further, standardization of the cutoff threshold cycle (CT) value of the new probe and its wider validation, especially on Indian isolates, is advisable.

Sequencing analysis of 23 discrepant samples showed 91.3% concordance with LPA but only 8.7% concordance with the Xpert MTB/RIF assay. In 2 samples, no mutations were detected by Sanger sequencing. This could be explained by the fact that about 5% of resistance mutations can be missed by Sanger sequence analysis but detected by LPA and also by phenotypic methods such as MGIT960 DST (36, 37). Nevertheless 94.5% of RIF-susceptible isolates were correctly detected by the Xpert MTB/RIF. In the Xpert MTB/RIF, the probe E (529 to 533) is identical to the W8 (531 to 533) region of the LPA. Indeed, it covers two additional codons, yet it did not recognize the mutation in a large number (52%) of DNA samples. This needs further investigation at the manufacturer's level, comparing it with other competing but standard methods.

These findings are extremely important for national TB control program managers, who need to evaluate the performance of the Xpert MTB/RIF before rolling it out in the DR-TB control programs. We suggest that each country carry out such evaluation work, to prepare guidelines for the use of the Xpert MTB/RIF at the national level. Studies will also be required to find out reasons why the Xpert MTB/RIF gives such high false-positive RIF susceptibility results. These observations also show that relying only on the Xpert MTB/RIF results may be a disastrous step for TB control programs, as this test gives alarmingly high false-negative results and the resistant M. tuberculosis isolates are falsely labeled as susceptible, thereby making the program managers complacent and underestimating the threat of MDR-TB. False-negative reports of RIF resistance can keep patients unnecessarily on first-line drugs for a long duration, thus leaving the patients inappropriately treated. This can lead to the amplification and spread of MDR and XDR TB.

ACKNOWLEDGMENTS

We thank Brijesh Kumar, Virendra Kapil, and Vinod Kumar (all from the Department of Laboratory Medicine, AIIMS, New Delhi) for their technical help. We also thank the State TB Officer, Punjab, WHO consultant Priyanka Aggarwal, and the DMC staff of 9 districts of Punjab for recruiting the TB patients and sending their samples in good condition. Our thanks to C. N. Parmasivan, B. Vellopore, and Rahul Thakur of FIND (Foundation for Innovative New Diagnostics) for providing LPA kits and accessories under the PMDT program of RNTCP and K. S. Sachdeva of the Central TB Division, Government of India, for coordinating with the Punjab State TB officer.

We declare that we have no conflicts of interest.

Footnotes

Published ahead of print 19 March 2014

REFERENCES

  • 1.Chiang CY, Van Weezenbeek C, Mori T, Enarson DA. 2013. Challenges to the global control of tuberculosis. Respirology 18:596–604. 10.1111/resp.12067 [DOI] [PubMed] [Google Scholar]
  • 2.Goble M, Iseman MD, Madsen LA, Waite D, Ackerson L, Hobsburg CR., Jr 1991. Treatment of 171 patients with pulmonary tuberculosis resistant to isoniazid and rifampin. N. Engl. J. Med. 328:527–532 [DOI] [PubMed] [Google Scholar]
  • 3.Somoskovi A, Parsons LM, Salfinger M. 2001. The molecular basis of resistance to isoniazid, rifampin, and pyrazinamide in Mycobacterium tuberculosis. Respir. Res. 2:164–168. 10.1186/rr54 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Brossier F, Veziris N, Truffot-Pernot C, Jarlier V, Sougakoff W. 2006. Performance of the genotype MTBDR line probe assay for detection of resistance to rifampin and isoniazid in strains of Mycobacterium tuberculosis with low- and high-level resistance. J. Clin. Microbiol. 44:3659–3664. 10.1128/JCM.01054-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Lawn SD, Mwaba P, Bates M, Piatek A, Alexander H, Marais BJ, Cuevas LE, McHugh TD, Zijenah L, Kapata N, Abubakar I, McNerney R, Hoelscher M, Memish ZA, Migliori GB, Kim P, Maeurer M, Schito M, Zumla 2013. Advances in tuberculosis diagnostics: the Xpert MTB/RIF assay and future prospects for a point of care test. Lancet Infect. Dis. 13:349–361. 10.1016/S1473-3099(13)70008-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Li J, Xin J, Zhang L, Jiang L, Cao H, Li L. 2012. Rapid detection of rpoB mutations in rifampin resistant M. tuberculosis from sputum samples by denaturing gradient gel electrophoresis. Int. J. Med. Sci. 9:148–156. 10.7150/ijms.3605 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Ahmad S, Mokaddas E, Fares E. 2002. Characterization of rpo B mutations in rifampin-resistant clinical Mycobacterium tuberculosis isolates from Kuwait and Dubai. Diagn. Microbiol. Infect. Dis. 44:245–252. 10.1016/S0732-8893(02)00457-1 [DOI] [PubMed] [Google Scholar]
  • 8.Mani C, Selvakumar N, Narayanan S, Narayanan PR. 2001. Mutations in the rpoB gene of multidrug-resistant Mycobacterium tuberculosis clinical isolates from India. J. Clin. Microbiol. 39:2987–2990. 10.1128/JCM.39.8.2987-2990.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Boehme CC, Nicol MP, Nabeta P, Michael JS, Gotuzzo E, Tahirli R, Gler MT, Blakemore R, Worodria W, Gray C, Huang L, Caceres T, Mehdiyev R, Raymond L, Whitelaw A, Sagadevan K, Alexander H, Albert H, Cobelens F, Cox H, Alland D, Perkins MD. 2011. Feasibility, diagnostic accuracy, and effectiveness of decentralized use of the Xpert MTB/RIF test for diagnosis of tuberculosis and multidrug resistance: a multicentre implementation study. Lancet 377:1495–1505. 10.1016/S0140-6736(11)60438-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Makinen J, Marttila HJ, Marjamaki M, Viljanen MK, Soini H. 2006. Comparison of two commercially available DNA line probe assays for detection of multidrug-resistant Mycobacterium tuberculosis. J. Clin. Microbiol. 44:350–352. 10.1128/JCM.44.2.350-352.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Barnard M, Gey van Pittius NC, van Helden PD, Bosman M, Coetzee G, Warren RM. 2012. The diagnostic performance of the GenoType MTBDRplus version 2 line probe assay is equivalent to that of the Xpert MTB/RIF assay. J. Clin. Microbiol. 50:3712–3716. 10.1128/JCM.01958-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Revised National Tuberculosis Control Programme. 2012. Guidelines on programmatic management of drug resistant TB (PMDT) in India. Ministry of Health & Family Welfare, New Delhi, India: http://tbcindia.nic.in/pdfs/guidelines%20for%20pmdt%20in%20india%20-%20may%202012.pdf [Google Scholar]
  • 13.Kumar P, Balooni V, Sharma BK, Kapil V, Sachdeva KS, Singh S. 2014. High degree of multidrug resistance and hetero-resistance in pulmonary TB patients from Punjab state of India. Tuberculosis 94:73–80. 10.1016/j.tube.2013.10.001 [DOI] [PubMed] [Google Scholar]
  • 14.Kent PT, Kubica GP. 1985. Public health mycobacteriology: a guide for a level III laboratory. Centers for Disease Control and Prevention, Atlanta, GA [Google Scholar]
  • 15.Hain Lifescience GmbH. GenoTypeMTBDRplus, version 2.0 product insert. Nehren, Germany. http://www.hain-lifescience.de/en/instructions-for-use.html
  • 16.World Health Organization. 2008. Molecular line probe assay for rapid screening of patients at risk of multidrug-resistant tuberculosis (MDR-TB). World Health Organization, Geneva, Switzerland: http://www.who.int/tb/features_archive/policy_statement.pdf [Google Scholar]
  • 17.Boehme CC, Nabeta P, Hillemann D. 2010. Rapid molecular detection of tuberculosis and rifampin resistance. N. Engl. J. Med. 363:1005–1015. 10.1056/NEJMoa0907847 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Becton, Dickinson & Company. BACTEC MGI-960 SIRE kit for the antimycobacterial susceptibility testing of Mycobacterium tuberculosis. http://www.bd.com/ds/technicalCenter/clsi/clsi-960sire.pdf Becton, Dickinson & Company, Franklin Lakes, NJ [Google Scholar]
  • 19.Campbell PJ, Morlock GP, Sikes RD, Dalton TL, Metchock B, Starks AM, Hooks DP, Cowan LS, Plikaytis BB, Posey JE. 2011. Molecular detection of mutations associated with first- and second-line drug resistance compared with conventional drug susceptibility testing of Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 55:2032–2041. 10.1128/AAC.01550-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Williams DL, Spring L, Collins L, Miller LP, Heifets LB, Gangadharam PR, Gillis TP. 1998. Contribution of rpoB mutations to development of rifamycin cross-resistance in Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 42:1853–1857 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Yang B, Koga H, Ohno H, Ogawa K, Fukuda M, Hirakata Y, Maesaki S, Tomono K, Tashiro T, Kohno S. 1998. Relationship between antimycobacterial activities of rifampicin, rifabutin and KRM-1648 and rpoB mutations of Mycobacterium tuberculosis. J. Antimicrob. Chemother. 42:621–628. 10.1093/jac/42.5.621 [DOI] [PubMed] [Google Scholar]
  • 22.Mukinda FK, Theron D, van der Spuy GD, Jacobson KR, Roscher M, Streicher EM, Musekiwa A, Coetzee GJ, Victor TC, Marais BJ, Nachega JB, Warren RM, Schaaf HS. 2012. Rise in rifampicin monoresistant tuberculosis in Western Cape, South Africa. Int. J. Tuberc. Lung Dis. 16:196–202. 10.5588/ijtld.11.0116 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Ridzon R, Whitney GC, McKenna MT, Taylor JP, Ashkar SH, Nitta AT, Harvey SM, Valway S, Woodley C, Cooksey R, Onorato IM. 1998. Risk factors for rifampin monoresistant tuberculosis. Am. J. Respir. Crit. Care Med. 157:1881–1884. 10.1164/ajrccm.157.6.9712009 [DOI] [PubMed] [Google Scholar]
  • 24.Davies J, Davies D. 2010. Origins and evolution of antibiotic resistance. Microbiol. Mol. Biol. Rev. 74:417–433. 10.1128/MMBR.00016-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.de Oliveira MM, da Silva Rocha A, Cardoso Oelemann M, Gomes HM, Fonseca L, Werneck-Barreto AM, Valim AM, Rossetti ML, Rossau R, Mijs W, Vanderborght B, Suffys P. 2003. Rapid detection of resistance against rifampicin in isolates of Mycobacterium tuberculosis from Brazilian patients using a reverse-phase hybridization assay. J. Microbiol. Methods 53:335–342. 10.1016/S0167-7012(02)00253-1 [DOI] [PubMed] [Google Scholar]
  • 26.Hillemann D, Weizenegger M, Kubica T, Richter E, Niemann S. 2005. Use of the genotype MTBDR assay for rapid detection of rifampin and isoniazid resistance in Mycobacterium tuberculosis complex isolates. J. Clin. Microbiol. 43:3699–3703. 10.1128/JCM.43.8.3699-3703.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Singh A, Gopinath K, Singh N, Singh S. 15 November 2013. Deciphering the sequential events during the invivo acquisition of drug resistant in Mycobacterium tuberculosis. Int. J. Mycobacteriol. 10.1016/j.ijmyco.2013.10.006 [DOI] [PubMed] [Google Scholar]
  • 28.Ma X, Wang H, Deng Y, Liu Z, Xu Y, Pan X, Musser JM, Graviss EA. 2006. rpoB gene mutations and molecular characterization of rifampin-resistant Mycobacterium tuberculosis isolates from Shandong Province, China. J Clin Microbiol. 44:3409–3412. 10.1128/JCM.00515-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Cavusoglu C, Hilmioglu S, Guneri S, Bilgic A. 2002. Characterization of rpoB mutations in rifampin-resistant clinical isolates of Mycobacterium tuberculosis from Turkey by DNA sequencing and line probe assay. J. Clin. Microbiol. 40:4435–4438. 10.1128/JCM.40.12.4435-4438.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Miotto P, Piana F, Penati V, Canducci F, Migliori GB, Cirillo DM. 2006. Use of genotype MTBDR assay for molecular detection of rifampin and isoniazid resistance in Mycobacterium tuberculosis clinical strains isolated in Italy. J. Clin. Microbiol. 44:2485–2491. 10.1128/JCM.00083-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Hilleman D, Rusch-Gerdes S, Boehme C, Ritchter E. 2011. Rapid molecular detection of extrapulmonary tuberculosis by the automated GeneXpert MTB/RIF system. J. Clin. Microbiol. 49:1202–1205. 10.1128/JCM.02268-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Marlowe EM, Novak Weekley SM, Cumpio J, Sharp SE, Momeny MA, Babst A, Carlson JS, Kawamura M, PandoriM 2011. Evaluation of the Cepheid Xpert MTB/RIF assay for direct detection of Mycobacterium tuberculosis complex in respiratory specimens. J. Clin. Microbiol. 49:1621–1623. 10.1128/JCM.02214-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Somoskovi A, Deggim V, Ciardo D, Bloemberg GV. 2013. Diagnostic implications of inconsistent results obtained with the Xpert MTB/RIF assay in detection of Mycobacterium tuberculosis isolates with an rpoB mutation associated with low-level rifampin resistance. J. Clin. Microbiol. 51:3127–3129. 10.1128/JCM.01377-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Foundation for Innovative New Diagnostics (FIND). 2011. Performance of Xpert MTB/RIF version G4 assay. FIND, Geneva, Switzerland: www.stoptb.org/wg/gli/assets/documents/map/findg4cartridge.pdf [Google Scholar]
  • 35.Stevens W. 2012. Analysis of needed interface between molecular diagnostic tests and conventional mycobacteriology. 43rd Union World Conference on Lung Health, Kuala Lumpur, Malaysia [Google Scholar]
  • 36.Folkvardsen DB, Vibeke O, Thomsen Rigouts Leen Rasmussen EM, Bang D, Bernaerts G, Werngren J, Toro JC, Hoffner S, Hillemann D, Svensson E. 2013. Rifampicin hetereoresistance in Mycobacterium tuberculosis cultures detected by phenotypic and genotypic drug susceptibility test methods. J. Clin. Microbiol. 51:4220–4222. 10.1128/JCM.01602-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Folkvardsen DB, Svensson E, Thomsen V, Rasmussen EM, Bang D, Werngren J, Hoffner S, Hillemann D, Rigoutsd L. 2013. Can molecular methods detect 1% isoniazid resistance in Mycobacterium tuberculosis? J. Clin. Microbiol. 51:1596–1599. 10.1128/JCM.00472-13 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES