Abstract
A multiplex PCR-based method was designed for the simultaneous detection of the main pathogens involved in warm-water streptococcosis in fish (Streptococcus iniae, Streptococcus difficilis, Streptococcus parauberis, and Lactococcus garvieae). Each of the four pairs of oligonucleotide primers exclusively amplified the targeted gene of the specific microorganism. The sensitivity of the multiplex PCR using purified DNA was 25 pg for S. iniae, 12.5 pg for S. difficilis, 50 pg for S. parauberis, and 30 pg for L. garvieae. The multiplex PCR assay was useful for the specific detection of the four species of bacteria not only in pure culture but also in inoculated fish tissue homogenates and naturally infected fish. Therefore, this method could be a useful alternative to the culture-based method for the routine diagnosis of warm-water streptococcal infections in fish.
Streptococcal infections, which have increased in number during the last decade as a consequence of the intensification of aquaculture, are responsible for significant economic losses in the fish farm industry. Streptococcosis of fish, from a clinical point of view, is a generic term used to designate similar, but different, diseases in which any one of at least six different species of gram-positive cocci, including streptococci, lactococci, and vagococci, are involved (2, 20). The main pathogenic species responsible for these streptococcal infections are Streptococcus parauberis, Streptococcus iniae, Streptococcus difficilis, Lactococcus garvieae, Lactococcus piscium, Vagococcus salmoninarum, and Carnobacterium piscicola (2, 13-15). Water temperature is considered a predisposing factor for the onset of the disease caused by these pathogens. Thus, outbreaks associated with infections by L. piscium, V. salmoninarum, and C. piscicola usually occur at water temperatures below 15°C and are termed cool-water streptococcosis (20). On the other hand, outbreaks that occur at water temperatures above 15°C, or warm-water streptococcosis, are produced by L. garvieae, S. iniae, S. parauberis, and S. difficilis (20). Infections associated with these bacterial pathogens have been reported in many different countries and in different marine and freshwater fish species (1, 5, 7, 8, 10-15, 17, 18, 22-25), but the economic and health impacts of warm-water streptococcosis are especially noticeable in Mediterranean countries (8, 12, 15). Fish with warm-water streptococcosis exhibit very similar symptoms and clinical signs regardless of the etiological agent (2, 10-12, 15, 20), and therefore a definitive diagnosis of the etiological agent has to be based on the microbiological analysis of diseased fish. Warm-water streptococcosis-associated pathogens can be identified by culture-based methods and biochemical tests. Nevertheless, biochemical identification of some of these bacteria can be difficult when using commercial identification systems because they are not included in the databases of currently available commercial systems. Individual PCR assays have been developed for detection and identification of the fish pathogens associated with warm-water streptococcosis (3, 19, 21, 26). However, a large number of individual PCR assays would be necessary if single primer sets are used on a large number of clinical samples, which can be a relatively costly and time-consuming process. The simultaneous detection of several pathogens with a multiplex PCR (m-PCR) approach would be relatively rapid and cost-effective. An m-PCR assay for the simultaneous detection of Aeromonas salmonicida, Yersinia ruckeri, and Flavobacterium psychrophilum has been described recently (9). In this work, an m-PCR assay was developed for the simultaneous detection of S. iniae, S. difficilis, S. parauberis, and L. garvieae from pure cultures and fish tissues.
Bacterial strains and growth conditions.
Collection and clinical strains of S. iniae, S. difficilis, S. parauberis, and L. garvieae used in the present study are listed in Table 1. S. iniae ATCC 29178T, S. difficilis CIP 103768T, S. parauberis NCDO 2020T, and L. garvieae ATCC 43921T were used as positive controls. Clinical isolates of L. garvieae and S. parauberis were isolated in pure cultures from the livers, kidneys, and spleens of diseased rainbow trout and turbot, respectively (10, 24). L. garvieae isolates from humans were kindly provided by L. M. Teixeira (Instituto de Microbiología, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil). Clinical isolates of S. iniae were supplied by J. Black and J. Birrell (FRS Marine Laboratory, Aberdeen, Scotland), J. C. de Azavedo (Department of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Ontario, Canada), and S. K. P. Lau (Department of Microbiology, University of Hong Kong, Hong Kong, People's Republic of China).
TABLE 1.
Bacterial target species assayed in the PCR experiments
| Microorganism | Straina | Source and geographic origin |
|---|---|---|
| S. iniae | ATCC 29178T | Amazon dolphin, North America |
| ATCC 29177 | Dolphin, North America | |
| CIP 103769 | Tilapia, Israel | |
| MT 2375 | Unknown fish, Scotland | |
| MT 2376 | Tilapia, United States | |
| MT 2377 | Unknown fish, Scotland | |
| MT 2378 | Hybrid striped bass, United States | |
| P1 | Human cellulitis, China | |
| P2 | Human osteomyelitis, China | |
| 9116 | Human cellulitis, Canada | |
| 9033 | Brain fish, Canada | |
| 9066 | Fish swab, Canada | |
| 9098 | Tilapia swab, Canada | |
| S. difficilis | CIP 103768T | Tilapia brain, Israel |
| CIP 103853 | Fish brain, Israel | |
| S. parauberis | NCDO 2020T | Bovine mastitis, United Kingdom |
| 94/16 | Turbot, Spain | |
| 94/23 | Turbot, Spain | |
| 94/43 | Turbot, Spain | |
| L. garvieae | ATCC 43921T | Bovine mastitis, United Kingdom |
| ATCC 49156T | Yellowtail, Japan | |
| 1684 | Rainbow trout, Italy | |
| 1925 | Rainbow trout, Spain | |
| 1935 | Rainbow trout, Spain | |
| 1990 | Rainbow trout, Spain | |
| 2008 | Water, Spain | |
| 2398 | Trout, France | |
| 4316 | Rainbow trout, Spain | |
| 4976 | European eel, Spain | |
| 4982 | European eel, Spain | |
| IM-86 | Human infection, Brazil | |
| 306-79 | Human infection, United States | |
| 364-88 | Human infection, United States |
ATCC, American Type Culture Collection, Manassas, Va.; CIP, Collection of Institut Pasteur, Paris, France; CECT, Spanish Type Culture Collection, Burjasot, Valencia, Spain; NCDO, National Collection of Dairy Organisms, Reading, United Kingdom (at present, transferred to the National Collection of Industrial, Food and Marine Bacteria [NCIMB], Aberdeen, Scotland).
Other species and phylogenetically related bacteria used as negative controls for the specificity studies of the m-PCR assay were as follows: Streptococcus agalactiae CECT 183T, STR 34, STR59, and STR 63 (clinical strains from milk samples obtained from sheep and cows affected by subclinical mastitis, isolated by E. Fernández of the Department of Animal Health, Veterinary School, Complutense University, Madrid, Spain); Streptococcus equi subsp. equi CECT 989T; Streptococcus equi subsp. zooepidemicus 1248 (a clinical isolate from a pig, isolated by A. Vela of the Department of Animal Health, Veterinary School, Complutense University, Madrid, Spain); Streptococcus phocae MT 2468 (a clinical isolate from salmon) and Streptococcus pneumoniae MT 1907 (a clinical isolate from fish), both supplied by J. Black and J. Birrell (FRS Marine Laboratory, Aberdeen, Scotland); Streptococcus pyogenes CECT 985T; Streptococcus salivarius CECT 805T; Streptococcus suis CECT 958T; Streptococcus uberis CECT 994T; Aerococcus viridans NCDO 1225T; Carnobacterium piscicola ATCC 35586T, 01/5423, and 01/5685 (clinical isolates from diseased rainbow trout, isolated at the Department of Animal Health, Veterinary School, Complutense University, Madrid, Spain), Lactococcus lactis subsp. lactis CECT 185T; Lactococcus piscium CECT 4493T; Vagococcus fluvialis NCDO 2497T; and Vagococcus salmoninarum NCFB 2777T.
All bacterial strains were grown on Columbia blood agar plates (bioMérieux España S.A.) for 24 to 48 h at 30 or 22°C, depending on the characteristics of the individual organisms.
Isolation of bacterial DNAs.
Bacterial chromosomal DNA used in PCR assays was extracted by the phenol-chloroform method described previously (4). Purified DNA was dissolved in 100 μl of distilled water and then stored at −20°C until use.
Primers and m-PCR amplification conditions.
The target gene and oligonucleotide primer set used for the detection of each of the four fish bacterial pathogens in the m-PCR are indicated in Table 2. All primers were synthesized by ISOGEN Bioscience BV (Maarssen, The Netherlands). The m-PCR was optimized for the simultaneous detection of the four microorganisms by testing two or more concentrations of MgCl2 (1, 1.5, 2, and 5 mM), deoxynucleoside triphosphates (0.2 mM and 0.25 mM), and polymerase (1 and 1.5 U).
TABLE 2.
Primer sequences used for PCR amplification and the expected amplicon sizes
| Primer pair | Sequences (5′ to 3′) | Target gene | PCR amplicon (bp) | Pathogen |
|---|---|---|---|---|
| Sdi 61 | AGGAAACCTGCCATTTGCG | 16S-23S RNA intergenic spacer | ||
| Sdi 252 | CAATCTATTTCTAGATCGTGG | 192 | S. difficilis | |
| Spa 2152 | TTTCGTCTGAGGCAATGTTG | |||
| Spa 2870 | GCTTCATATATCGCTATACT | 23S rRNA | 718 | S. parauberis |
| LOX-1 | AAGGGGAAATCGCAAGTGCC | |||
| LOX-2 | ATATCTGATTGGGCCGTCTAA | lctO | 870 | S. iniae |
| pLG-1 | CATAACAATGAGAATCGC | |||
| pLG-2 | GCACCCTCGCGGGTTG | 16S rRNA | 1,100 | L. garvieae |
The optimized m-PCR was performed in 100-μl reaction mixtures containing DNA template (50 to 70 ng of chromosomal bacterial DNA or 10 μl of DNA extracted from bacterial suspensions or fish tissue), 2 mM MgCl2, a 1 μM concentration of each primer a 0.25 mM concentration of each deoxynucleoside triphosphate (Biotools; B & M Laboratories S.A.), and 1.5 U of Biotools DNA polymerase (Biotools; B & M Laboratories S.A.) along with its amplification buffer. The amplifications were carried out in a Mastercycler gradient thermal cycler (Eppendorf) with the following parameters: an initial denaturation step of 94°C for 2 min; 25 serial cycles of a denaturation step of 92°C for 1 min, annealing at 55°C for 1 min, and extension at 72°C for 90 s; and a final extension step of 72°C for 5 min. A negative control (no template DNA) and a positive control (50 ng of purified DNA of one or more of the four type strains indicated above) were included in each batch of PCRs. PCR-generated products were detected by electrophoresis of 20 μl of each amplification mixture in 2% agarose gels in 1% Tris-acetate-EDTA buffer. Gels were stained with ethidium bromide (0.5 μg ml−1).
Sensitivity and specificity of the m-PCR assay.
The specificity of the m-PCR assay was evaluated by testing the four primer sets with the purified DNAs of all the strains (separately or in different combinations) indicated above. Positive PCR amplification of DNA templates from L. garvieae, S. iniae, S. parauberis, and S. difficilis produced a single fragment, of the expected, for each pathogen (1,100, 870, 718, and 192 bp, respectively), as shown in Fig. 1 (lanes 3 to 6). The four bacterial pathogens were simultaneously amplified with relatively equal DNA band intensities (Fig. 1, lane 7). No DNA amplification was observed with the other phylogenetically related bacteria, with the exception of S. agalactiae when the primer set Sdi 61-Sdi 252 was used. A 192-bp amplicon similar to that exhibited by S. difficilis (Fig. 1, lane 6) was observed with S. agalactiae strains (data not shown), which is in agreement with previous results (23). This can be explained by the high level of genetic relatedness of the two species (3, 23). However, the implications of this nonspecific amplification in ichthyopathological diagnosis are not especially noteworthy because S. difficilis can be considered a phenotypic marine variant of S. agalactiae (23), which has also been reported as a fish pathogen (16).
FIG. 1.
Amplification products obtained using the m-PCR assay developed for the simultaneous detection of L. garvieae (1,100 bp), S. iniae (870 bp), S. parauberis (718 bp), and S. difficilis (192 bp). Lanes 1 and 8, 100-bp DNA ladder (Biotools B & M Laboratories S.A., Madrid, Spain); lane 2, negative control; lane 3, L. garvieae ATCC 43921T; lane 4, S. iniae ATCC 29178T; lane 5, S. parauberis NCDO 2020T; lane 6, S. difficilis CIP 103786T; lane 7, mixture of the four bacteria together; lane 9, liver tissue from trout inoculated with L. garvieae, S. difficilis, and L. piscium; lane 10, kidney tissue from sea bream inoculated with S. parauberis, S. iniae, and V. salmoninarum; lane 11, liver tissue from trout inoculated with S. iniae, L. garvieae, and C. piscicola; lane 12, liver tissue from trout inoculated with S. iniae, L. garvieae, S. difficilis, and L. piscium; lanes 13 to 15, fish tissues obtained during three naturally occurring L. garvieae outbreaks.
The sensitivity of the m-PCR assay was tested using pure DNA and bacterial suspensions of S. iniae ATCC 29178T, S. difficilis CIP 103768T, S. parauberis NCDO 2020T, and L. garvieae ATCC 43931T. All m-PCRs assessing limits of detection were performed in triplicate. One hundred nanograms of purified genomic DNA of each type strain was twofold serially diluted in sterile water down to 3 pg per PCR. Aliquots of 5 μl of each dilution were mixed together with the same volume of the respective dilutions of the other bacteria, and the mixtures were used as DNA templates for the m-PCR assay. The sensitivity of m-PCR when using purified DNA of the bacterial type strains was 25 pg for S. iniae, 12.5 pg for S. difficilis, 30 pg for S. parauberis, and 50 pg for L. garvieae. Also, bacterial suspensions of each type strain were prepared from log-phase cultures on brain-heart infusion broth (Difco) and further adjusted to an optical density equivalent to 6 MacFarland units. Initial bacterial suspensions were 10-fold diluted five times and then 2-fold serially diluted in 0.9% saline solution. These dilutions were used to determine the initial concentration of each bacterium, as well as for subsequent DNA extractions for PCR. The concentration of each bacterium (2 × 109 cells of L. garvieae or S. difficilis/ml and 4 × 109 cells of S. iniae or S. parauberis/ml) was determined by surface plating (0.1 ml) of the appropriate dilutions onto Columbia blood agar plates (bioMérieux España S.A.). Also, 100 μl of each dilution was mixed with the same volume of the respective dilution of each of the other bacteria. The mixture was processed for DNA extraction (6), and the DNA obtained was dissolved in 10 μl of sterile distilled water and added directly to the PCR mixture. The detection limits per m-PCR were the amounts of DNA templates resulting from 62 to 31 cells for S. iniae, S. parauberis, and L. garvieae and 250 to 125 cells for S. difficilis (Fig. 2).
FIG. 2.
Sensitivity of detection of L. garvieae, S. iniae, S. parauberis, and S. difficilis by m-PCR of pure-culture bacterial suspensions of the four bacterial pathogens. Lane 1, 100-bp DNA ladder (Biotools; B & M Laboratories S.A., Madrid, Spain); lane 2, negative control; lanes 3 to 14, 4 × 106, 4 × 105, 4 × 104, 4 × 103, 2 × 103, 1 × 103, 5 × 102, 250, 125, 62, 31, and 15 cells of S. iniae and S. parauberis, respectively, and 2 × 106, 2 × 105, 2 × 104, 2 × 103, 1 × 103, 5 × 102, 250, 125, 62, 31, 15, and 7 cells of L. garvieae and S. difficilis, respectively.
m-PCR for the detection of bacterial pathogens in artificially inoculated and naturally infected fish tissue homogenates.
The sensitivity and specificity of the m-PCR assay were also determined with artificially inoculated fish tissue homogenates. Brains, livers, and kidneys were aseptically obtained from five rainbow trout and five sea bream of market size. These organs were weighed and blended with the appropriate volume of 0.9% saline solution to obtain a 1/10 dilution of each organ. The specificity was tested using different mixture combinations of the four targets as well as the other phylogenetically related bacterial species employed in the study. Noninoculated tissue homogenates were used as controls. Specific positive amplifications in all inoculated tissue homogenates were consistently observed only for each corresponding pathogen, while no DNA amplifications were observed with other, nontargeted bacteria (Fig. 1, lanes 9 to 12). Noninoculated tissues were always PCR negative.
Bacterial suspensions containing 2.4 × 106 cells of S. iniae or S. difficilis, 4.8 × 106 cells of S. parauberis, or 2 × 106 cells of L. garvieae were obtained and serially diluted as described above. To test the sensitivity of the m-PCR, aliquots of 0.1 ml of tissue homogenate were inoculated (100 μl) with respective dilutions of pure cultures of the four pathogens. Fifty-microliter volumes of inoculated fish tissue homogenates were processed for DNA extraction (6). The total extracted DNA was dissolved in 10 μl of sterile distilled water and used for PCR experiments. The detection limit of the m-PCR assay for fish tissues was 5 × 103 cells/g for S. iniae, 1.2 × 104 cells/g for S. difficilis, 1 × 104 cells/g for S. parauberis, and 2.5 × 103 cells/g for L. garvieae. No differences in PCR amplification results were observed regardless of the fish species or type of tissue.
Naturally diseased rainbow trout and European eels with clinical signs compatible with streptococcosis (erratic swimming, lethargy, darkening of the skin, exophthalmia, ascitis, enlargement of spleen and liver, and hemorrhagic enteritis and encephalitis), taken from different fish farms, were simultaneously investigated by m-PCR and microbiological analysis in order to identify the etiological agent. The fish were sacrificed, and brains, livers, and kidneys were removed and diluted 1/10 as described above. Fifty-microliter volumes of the tissue homogenates were processed for DNA extraction and PCR experiments. For microbiological analysis, a loopful of each tissue homogenate was streaked onto a Columbia blood agar plate (bioMérieux España S.A.) and incubated at 30°C for 24 h. In addition, tissue homogenates were 10-fold serially diluted to determine the bacterial concentration: 100-μl volumes of the appropriate dilutions were surfaced plated onto Columbia blood agar plates (bioMérieux España S.A.), which were incubated for 24 h at 30°C. Bacterial isolates were biochemically characterized with the Rapid ID32 STREP system (bioMérieux España S.A.) and identified as L. garvieae. In the m-PCR assay, the amplification of a single DNA band of 1,100 bp, specific for L. garvieae, was obtained from the samples of naturally diseased fish (Fig. 1, lanes 13 to 15). Conventional microbiological analysis confirmed the PCR results, and L. garvieae was isolated from all of the PCR-positive samples. Samples that were m-PCR negative were also negative by the culture method. The concentration of L. garvieae in tissues of naturally infected fish ranged between 5 × 103 and 1.5 × 107 cells/g.
These results show that this m-PCR assay is an effective tool for the rapid and specific detection of S. iniae, S. difficilis, S. parauberis, and L. garvieae, the main pathogens involved in warm-water streptococcosis, obtained not only in pure culture but also from inoculated-fish tissue homogenates and naturally infected fish. Therefore, it could be a useful alternative to the culture-based method for the routine diagnosis of warm-water streptococcal infections in fish.
Acknowledgments
We thank L. M. Teixeira, S. K. P. Lau, J. C. de Azavedo, J. Black, and J. Birrell for clinical bacterial samples. We also thank F. Uruburu (Director of the Spanish Type Culture Collection) for providing the collection CECT strains.
This study was supported by project ACU00-004-C2-2 of the Ministerio Español de Ciencia y Tecnología. A. I. Mata was a recipient of a grant from Comunidad de Madrid.
REFERENCES
- 1.Alcaide, E., E. Sanjuan, F. de la Gandara, A. García-Gómez, and F. de la Gandara. 2000. Susceptibility of amberjack (Seriola dumerili) to bacterial fish pathogens. Bull. Eur. Assoc. Fish Pathol. 20:153-156. [Google Scholar]
- 2.Bercovier, H., C. Ghittino, and A. Eldar. 1997. Immunization with bacterial antigens: infections with streptococci and related organisms. Dev. Biol. Stand. 90:153-160. [PubMed] [Google Scholar]
- 3.Berridge, B. R., H. Bercovier, and P. F. Frelier. 2001. Streptococcus agalactiae and Streptococcus difficile 16S-23S intergenic rDNA: genetic homogeneity and species-specific PCR. Vet. Microbiol. 78:165-173. [DOI] [PubMed] [Google Scholar]
- 4.Blanco, M. M., A. Gibello, A. I. Vela, M. A. Moreno, L. Domínguez, and J. F. Fernández-Garayzábal. 2002. PCR detection and PFGE DNA macro-restriction analyses of clinical isolates of Pseudomonas anguilliseptica from winter disease outbreaks in sea bream, Sparus aurata. Dis. Aquat. Org. 50:19-27. [DOI] [PubMed] [Google Scholar]
- 5.Bromage, E. S., A. Thomas, and L. Owens. 1999. Streptococcus iniae, a bacterial infection in barramundi, Lates calcarifer. Dis. Aquat. Org. 36:177-181. [DOI] [PubMed] [Google Scholar]
- 6.Casas, I., L. Powell, P. E. Klapper, and G. M. Cleator. 1995. New method for the extraction of viral RNA and DNA from cerebrospinal fluid for use in the polymerase chain reaction assay. J. Virol. Methods 53:25-36. [DOI] [PubMed] [Google Scholar]
- 7.Chen, S. C., L. L. Liaw, H. Y. Su, S. C. Ko, C. Y. Wu, H. C. Chaung, Y. H. Tsai, K. L. Yang, Y. C. Chen, T. H. Chen, G. R. Lin, S. Y. Cheng, Y. D. Lin, J. L. Lee, C. C. Lai, Y. J. Weng, and S. Y. Chu. 2002. Lactococcus garvieae, a cause of disease in grey mullet, Mugil cephalus L., in Taiwan. J. Fish Dis. 25:727-732. [Google Scholar]
- 8.Currás, M., B. Magariños, A. E. Toranzo, and J. L. Romalde. 2002. Dormancy as survival strategy of the fish pathogen Streptococcus parauberis in the marine environment. Dis. Aquat. Org. 52:129-136. [DOI] [PubMed] [Google Scholar]
- 9.del Cerro, A., I. Márquez, and J. A. Guijarro. 2002. Simultaneous detection of Aeromonas salmonicida, Flavobacterium psychrophilum, and Yersinia ruckeri, three major fish pathogens, by multiplex PCR. Appl. Environ. Microbiol. 68:5177-5180. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Doménech, A., J. F. Fernández-Garayzábal, C. Pascual, J. A. García, M. T. Cutuli, M. A. Moreno, M. D. Collins, and L. Domínguez. 1996. Streptococcosis in cultured turbot, Scophthalmus maximus (L.), associated with Streptococcus parauberis. J. Fish Dis. 19:33-38. [Google Scholar]
- 11.Eldar, A., Y. Bejerano, and H. Bercovier. 1994. Streptococcus shiloi and Streptococcus difficile: two new streptococcal species causing a meningo-encephalitis in fish. Curr. Microbiol. 28:139-143. [Google Scholar]
- 12.Eldar, A., Y. Bejerano, A. Livoff, A. Horovitcz, and H. Bercovier. 1995. Experimental streptococcal meningo-encephalitis in cultured fish. Vet. Microbiol. 43:33-40. [DOI] [PubMed] [Google Scholar]
- 13.Eldar, A., A. Horovitcz, and H. Bercovier. 1997. Development and efficacy of a vaccine against Streptococcus iniae infection in farmed rainbow trout. Vet. Immunol. Immunopathol. 56:175-183. [DOI] [PubMed] [Google Scholar]
- 14.Eldar, A., M. Goria, C. Ghittino, A. Zlotkin, and H. Bercovier. 1999. Biodiversity of Lactococcus garvieae strains isolated from fish in Europe, Asia, and Australia. Appl. Environ. Microbiol. 65:1005-1008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Eldar, A., and C. Ghittino. 1999. Lactococcus garvieae and Streptococcus iniae infections in rainbow trout, Oncorhynchus mykiss: similar but different diseases. Dis. Aquat. Org. 36:227-231. [DOI] [PubMed] [Google Scholar]
- 16.Evans, J. J., P. H. Klesius, P. M. Gilbert, C. A. Shoemaker, M. A. Al-Sarawi, J. Landsberg, R. Duremdez, A. Al-Marzouk, and S. Al-Zenki. 2002. Characterization of beta-haemolytic group B Streptococcus agalactiae in cultured seabream, Sparus auratus L., and wild mullet, Liza klunzingeri (Day), in Kuwait. J. Fish Dis. 25:505-513. [Google Scholar]
- 17.Kusuda, R., K. Hawai, C. Salati, C. R. Banner, and J. L. Fryer. 1991. Enterococcus seriolicida sp. nov., a fish pathogen. Int. J. Syst. Bacteriol. 41:406-409. [DOI] [PubMed] [Google Scholar]
- 18.Lau, S. K. P., P. C. Y. Woo, H. Tse, K.-W. Leung, S. S. Y. Wong, and K. Y. Yuen. 2003. Invasive Streptococcus iniae infections outside North America. J. Clin. Microbiol. 41:1004-1009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Mata, A. I., M. M. Blanco, L. Domínguez, J. F. Fernández-Garayzábal, and A. Gibello. Development of a PCR assay for Streptococcus iniae based on the lactate oxidase (lctO) gene with potential diagnostic value. Vet. Microbiol., in press. [DOI] [PubMed]
- 20.Muzquiz, J. L., F. M. Royo, C. Ortega, I. De Blas, I. Ruiz, and J. L. Alonso. 1999. Pathogenicity of streptococcosis in rainbow trout (Oncorhynchus mykiss): dependence on age of diseased fish. Bull. Eur. Assoc. Fish Pathol. 19:114-119. [Google Scholar]
- 21.Riffon, R., K. Sayasith, H. Khalil, P. Dubreuil, M. Drolet, and J. Lagace. 2001. Development of a rapid and sensitive test for identification of major pathogens in bovine mastitis by PCR. J. Clin. Microbiol. 39:2584-2589. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Shoemaker, C. A., P. H. Klesius, and J. J. Evans. 2001. Prevalence of Streptococcus iniae in tilapia, hybrid striped bass, and channel catfish on commercial fish farms in the United States. Am. J. Vet. Res. 62:174-177. [DOI] [PubMed] [Google Scholar]
- 23.Vandamme, P., L. A. Devriese, B. Pot, K. Kersters, and P. Melin. 1997. Streptococcus difficile is a nonhemolytic group B, type Ib Streptococcus. Int. J. Syst. Bacteriol. 37:463-464. [DOI] [PubMed] [Google Scholar]
- 24.Vela, A. I., J. Vázquez, A. Gibello, M. M. Blanco, M. A. Moreno, P. Liébana, C. Albendea, B. Alcalá, A. Mendez, L. Domínguez, and J. F. Fernández-Garayzábal. 2000. Phenotypic and genetic characterization of Lactococcus garvieae isolated in Spain from lactococcosis outbreaks, and comparison with isolates of other countries and sources. J. Clin. Microbiol. 38:3791-3795. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Weinstein, M. R., M. Litt, D. A. Kertesz, P. Wyper, D. Rose, M. Coulter, A. McGerr, R. Facklam, C. Ostach, B. M. Willey, A. Borczyk, and D. E. Low. 1997. Invasive infections due to a fish pathogen, Streptococcus iniae. N. Engl. J. Med. 337:367-373. [DOI] [PubMed] [Google Scholar]
- 26.Zlotkin, A., A. Eldar, C. Ghittino, and H. Bercovier. 1998. Identification of Lactococcus garvieae by PCR. J. Clin. Microbiol. 36:983-985. [DOI] [PMC free article] [PubMed] [Google Scholar]