Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2004 May;42(5):2101–2107. doi: 10.1128/JCM.42.5.2101-2107.2004

Detection of Candida in Concentrated Oral Rinse Cultures by Real-Time PCR

P Lewis White 1, David W Williams 2,*, Tomoari Kuriyama 2, Shamim A Samad 1, Michael A O Lewis 2, Rosemary A Barnes 1
PMCID: PMC404626  PMID: 15131176

Abstract

The incidence of oral candidosis has increased in recent years, largely as a result of the emergence of human immunodeficiency virus infection and the more widespread use of immunosuppressive chemotherapy. This development has been associated with a need for more reliable methods for the detection of Candida. The present study assessed the performance of a real-time PCR and two block-based PCRs for the detection of Candida in 193 concentrated oral rinse culture (CRC) specimens. A total of 102 CRC specimens were positive by culture for Candida; and 96, 90, and 75 of these were also positive by real-time, N18-specific, and internal transcribed spacer (ITS)-specific PCRs, respectively. The five false-negative results by the real-time PCR were all non-Candida albicans positive by culture. Of the 91 culture-negative CRC specimens, 20, 41, and 44 were positive by the real-time PCR and the N18- and ITS-specific PCRs, respectively. All three PCRs detected fungal DNA in 8 culture-negative CRC specimens, with a further 30 being positive by two of the three PCRs. A total of 32 CRC specimens were Candida free by all methods. In summary, a real-time PCR that provides a sensitive, specific, and rapid alternative technique for detection of Candida in the mouth is described.


The predominant fungi isolated from the human mouth belong to the genus Candida, and while there are more than 350 Candida species, approximately 10 of these colonize the oral cavity. Candida albicans is recognized as the most prevalent species (∼70 to 75% of isolates), followed by C. glabrata and C. tropicalis (7% of isolates) (9, 13). The reported rate of oral carriage of Candida yeasts among healthy individuals has been variable but ranges from 35 to 80% (1, 4) and is dependent on the population studied and the sampling methods used.

Debilitation of an individual can result in the occurrence of clinical oral candidosis, which may be defined as acute or chronic pseudomembranous candidosis (oral thrush), acute erythematous candidosis (Candida-associated denture stomatitis), chronic erythematous candidosis, or chronic hyperplastic candidosis (CHC) (3). Previously, host factors that were implicated in the onset of these infections received greater attention than the virulence factors of Candida. This was reflected in many diagnostic microbiological laboratories, where the ability to identify yeast isolates was limited. In recent years there has been increased interest in oral candidosis, partly due to the escalation of human immunodeficiency virus infection and AIDS and the more widespread use of immunosuppressive chemotherapy. As a consequence, there has been an associated increased demand for reliable sampling and identification methods.

Methods for sampling of the mouth for Candida include the taking of a smear (16), swab (15), or imprint specimen for culture (2); culture of whole saliva (24); and concentrated oral rinse culture (CRC) (10, 15). CRC is widely used, and although it does not directly target specific mucosal lesions, it provides a measure of the candidal load and can permit detection of other microbes. Candida levels of 600 CFU/ml of CRC specimen have been reported for healthy commensal carriage (10, 11), with higher numbers (∼2 × 103 to 3 × 103 CFU/ml) evident in individuals with conditions that predispose them to infection (15). Samaranayake et al. (15) compared CRC with imprint culture for detection of oral microbes and found that CRC was superior for yeast detection. They subsequently recommended the use of CRC as the screening approach for detecting oral yeast carriage.

One drawback of detection methods based on culture is the delay before a diagnostic report can be made available to the clinicians. Primary isolation media are routinely incubated for 48 h at 37°C, followed by a possible 72-h incubation for physiological or biochemical identification (20). The advent of differential primary agars, such as CHROMagar Candida (CHROMagar Ltd., Paris, France) and Albicans ID (BioMérieux, Basingstoke, United Kingdom), has enabled the presumptive identification of certain species (14), although physiological identification is still recommended and is a necessity for the majority of species. More recently, the introduction of molecular PCR-based techniques has resulted in the development of tests that can potentially detect Candida directly in oral samples. One such approach, namely, real-time PCR with the LightCycler instrument (Idaho Technologies, Idaho Falls), was recently developed for the sensitive (1 to 5 CFU/ml) and rapid (1-day) detection of seven clinically relevant Candida species in blood (18).

The aim of the present study was to assess the performance of this real-time PCR for the detection of Candida species directly in CRC samples. Originally, the real-time assay was developed to detect candidemia, and so it was necessary to determine the detection limit of the real-time PCR for Candida in spiked CRC samples rather than blood. It was also essential to establish how effective the real-time assay was for detection of clinical and commensal populations by direct comparisons to the “gold standard” culture and other molecular approaches.

MATERIALS AND METHODS

Collection of CRC samples and culture.

A total of 145 samples for CRC (Table 1) were taken from patients (49 males, 96 females) attending the Oral Medicine Clinic of the Dental School, University of Wales College of Medicine, Cardiff, United Kingdom. As the patients were sampled as part of the routine mycological diagnostic service, they were suspected of being clinically colonized with Candida. In addition, a further 48 samples for CRC were obtained from healthy volunteers (20 males, 28 females) who had no clinical signs of oral candidosis. The procedure used for CRC sample collection involved rinsing of the mouth with 10 ml of sterile phosphate-buffered saline (PBS; 0.1 M; pH 7.2), which was held in the mouth for 1 min prior to collection in a sterile container. Each rinse was centrifuged (2,000 × g; 10 min), the supernatant was removed, and the deposit was resuspended in 1 ml of PBS. A portion (50 μl) of the concentrate was inoculated onto Sabouraud dextrose agar (Lab M, Bury, United Kingdom) with a spiral plater system (Don Whitley Scientific, Shipley, United Kingdom) prior to incubation at 37°C for 48 h. Suspected Candida colonies were subcultured onto plates of CHROMagar Candida, which were incubated for 48 h at 37°C for isolation of multiple yeast species. The remaining 950 μl of the sample for CRC was stored at −20°C prior to DNA extraction. Confirmation of yeast identity was achieved with the API 32C system (BioMérieux).

TABLE 1.

Agreement between culture and PCR for detection of Candida in CRC samplesa

Clinical sign(s) No. of samples No. of samples positive by culture % Agreement with culture (no. of samples PCR positive)
Real-time PCR
ITS-specific PCR
N18-specific PCR
Sensitivity Specificity Sensitivity Specificity Sensitivity Specificity
Lichen planus 19 10 80 (8) 78 (2) 67 (6b) 44 (5) 80 (8) 44 (5)
BMS, sore mouth 48 24 96 (23) 63 (9) 71 (17) 50 (11c) 79 (19) 46 (13)
Angular cheilitis 5 3 100 (3) 50 (1) 67 (2) 0 (2) 100 (3) 0 (2)
Coated tongue 1 0 ND 0 (1) ND 100 (0) ND 0 (1)
Dry mouth 14 11 100 (11) 67 (1) 91 (10) 67 (1) 100 (11) 67 (1)
Leukoplakia 4 4 75 (3) ND 100 (4) ND 100 (4) ND
Ulceration 2 0 ND 100 (0) ND 50 (1) ND 50 (1)
Pemphigoid 2 1 100 (1) 50 (1) 100 (1) 0 (1) 100 (1) 0 (1)
Fissured tongue 1 0 ND 100 (0) ND 0 (1) ND 0 (1)
Perioral dermatitis 1 1 100 (1) ND 100 (1) ND 100 (1) ND
CHC 7 6 100 (6) 100 (0) 83 (5) 100 (0) 67 (4) 0 (1)
PC 14 8 100 (8) 67 (2) 75 (6) 50 (3) 75 (6) 50 (3)
CEC 19 12 83 (10) 100 (0) 50 (6) 57 (3) 100 (12) 57 (3)
AEC 5 4 100 (4) 100 (0) 100 (4) 0 (1) 100 (4) 0 (1)
Previous candidosis 3 1 100 (1) 50 (1) 100 (1) 100 (0) 100 (1) 100 (0)
Healthy mouthsd 48 17 100 (17) 94 (2) 71 (12) 52 (15) 94 (16) 74 (8)
Total 193 102 94 (96) 78 (20) 74 (75) 51 (44) 88 (90) 55 (41)
a

Abbreviations: ND, not determined; BMS, burning mouth syndrome; CHC, chronic hyperplastic candidosis; CEC, chronic erythematous candidosis; PC, pseudomembranous candidosis; AEC, acute erythematous candidosis.

b

One isolate not tested.

c

Two isolates not tested.

d

Clinically healthy oral mucosa with no history of oral candidosis.

Detection limits of PCR with CRC samples.

Ten control strains of Candida (Table 2) were cultured in yeast nitrogen base medium (Becton Dickinson, Oxford, United Kingdom) supplemented with 0.5% (wt/vol) glucose for 24 h at 37°C. The resulting yeast growth was harvested by centrifugation, washed three times in PBS, and enumerated with a hemocytometer counting chamber. Serial decimal dilutions were prepared in PBS to provide an estimated 106 to 100 yeasts/ml, and these were used to evaluate the sensitivities and the specificities of the PCRs.

TABLE 2.

Detection of 10 Candida species in CRC samples by PCR

Candida species Isolate reference Lower detection limit (no. of yeasts/ml) ofa:
Real-time PCR ITS-specific PCR N18-specific PCR
C. albicans GDH 2346 100-101 104-105 101-102
C. dubliniensis CD36 NCPF 3949 101-102 104-105 101-102
C. krusei Lab strain 101-102 104-105 101-102
C. viswanathii Lab strain 100-101 105-106 100-101
C. guilliermondii Y02.02 ND 105-106 100-101
C. glabrata Y33.149 102-103 104-105 101-102
C. famata Lab strain ND 103-104 100-101
C. inconspicua Lab strain 104-105 103-104 101-102
C. parapsilosis NCPF 3104 100-101 105-106 101-102
C. tropicalis Lab strain 100-101 104-105 101-102
a

The sensitivity of culture is 1 colony in 50 μl or 20 CFU/ml of concentrate. ND, not detected.

Extraction of DNA from concentrated rinse samples.

DNA was extracted from 950 μl of CRC concentrate and spiked control samples by use of the QIAamp DNA Mini kit (Qiagen, Crawley, United Kingdom), as described by White et al. (18). The extracted DNA was resuspended in 50 μl of Tris-EDTA buffer. Portions of this template DNA were then used for PCR (Table 3). Negative controls of uninoculated PBS were also included for DNA extraction and PCR.

TABLE 3.

Primers and conditions of specific PCRs used in the study

Primer or probe (sequence) Components of PCRsa No. of cycles DNA denaturation conditions Primer annealing conditions Primer extension conditions
ITS 1 (5′-TTC GTA GGT GAA CCT GCG G-3′) and ITS 2 (5′-GCT GCG TTC TTC ATC GAT GC-3′) 1× Taq buffer, 0.2 mM each dNTP, 0.5 μM each primer, 1.5 mM MgCl2, 2.5 U of Taq polymerase, 5 μl of extracted DNA (equivalent to 100 μl of rinse concentrate)b 30 95°C for 1 min 55°C for 1 min 72°C for 2 min
N18F (5′-TTT GAT GAT TCA TAA TAA CTT TT) and N18R (5′-CGT CCC TAT TAA TCA TTA CGA T) 1× PCR buffer (1.5 mM MgCl2), 0.2 mM each dNTP, 0.75 μM each primer, 2.5 U of Taq polymerase, 10 μl of DNA template (equivalent to 200 μl of rinse concentrate)b 35 Initial denaturation at 94°C for 5 min 94°C for 1 min 55°C for 1 min 72°C for 1.5 min and final cycle at 72°C for 7 min
L18F (5′-CTC GTA GTT GAA CCT TGG), L18R (5′-GCC TGC TTT GAA CAC TCT), and Cyanine 5-labeled probe (TTTTGATGCGTACTGGACCCTGT) 5 μl Light Cycler master mixture (Biogene), 0.5 μl of each primer (final concentration, 0.6 μM), 0.5 μl of SYBR Green (diluted 1:1,000), 1 μl of Candida probe (final concentration, 300 nM), 1 μl of template DNA (equivalent to 20 μl of rinse concentrate)b 60 Initial denaturation at 95°C for 15 s and then 95°C for 0 s 62°C for 2 s 74°C for 2 s
a

The reaction mixtures were 50 μl for the ITS- and N18-specific PCRs and 10 μl for the LightCycler PCR. Taq buffer components, 10 mM Tris-HCl, 50 mM KCl, 0.1% Triton X-100 (pH 9.0). dNTP, deoxynucleoside triphosphate.

b

Assuming 100% DNA extraction efficiency.

PCR detection of Candida.

The real-time PCR assay (18) used panfungal primers (primers L18F and L18R) to amplify a variable region within the 18S rRNA gene. The resulting 140-bp product was detected by SYBR Green incorporation and hybridization of a cyanine 5-labeled Candida-specific probe (18) (Fig. 1). One of the block-based PCRs used primers and reaction conditions previously described for fungal DNA amplification (23); however, the second block-based PCR used new primers N18F and N18R, which were designed to be Candida specific (Table 3). The Candida-specific block-based PCR (with primers N18F and N18R) targeted the 18S rRNA gene and amplified a 620-bp product spanning the region from 238 to 857 bp in the 18S rRNA gene of C. albicans (GenBank accession no. M60302.1). The amplicons generated by both block-based systems were detected by standard agarose gel electrophoresis and ethidium bromide staining.

FIG. 1.

FIG. 1.

Real-time PCR melting curve showing a positive sample (top) and a negative sample (bottom). The first peak indicates probe melting, and the second peak indicates amplicon melting.

RESULTS

Detection limits of PCR with CRC samples.

The limits of detection of the PCRs were initially assessed to confirm that the previous methodology used with blood samples was transferable to CRC samples. Table 2 presents the limits of detection for the real-time and block-based PCR systems for 10 Candida species. Real-time PCR detected all species except C. guilliermondii and C. famata. The Candida-specific (N18) block-based PCR showed good levels of detection that actually matched those of the real-time PCR for certain species (Table 2 and Fig. 2). The internal transcribed spacer (ITS) block-based PCR detected a wide range of Candida species but had consistently lower levels of detection (Table 2).

FIG. 2.

FIG. 2.

Products obtained by N18-specific PCR for diluted suspensions with 100 to 106 C. albicans (a) and C. dubiniensis (b) yeasts/ml.

Culture and PCR detection of Candida in CRC samples.

To compare the performance of the gold standard culture with those of the molecular methods, a clinical study of samples from 145 people with from various oral conditions was performed. In addition to this population, samples from a further 48 healthy control people with no symptoms of oral candidosis were tested to determine the degree of false-positive, clinically insignificant results generated by each assay.

Candida was detected by culture in 85 (59%) of the 145 clinical CRC samples and in 17 (38%) of the 48 healthy control CRC samples. Of the 85 clinical CRC samples that were culture positive, C. albicans was evident in 72 (85%). Other yeasts detected by culture, either in combination with C. albicans or alone, were C. glabrata (n = 4), C. krusei (n = 2), Candida inconspicua (n = 1), Candida spp. (n = 15), and Saccharomyces cerevisiae (n = 1). More than one Candida species was detected in 10 of the 85 samples positive by culture. C. albicans was the only species detected by culture in the 17 positive healthy control CRC samples.

Real-time PCR demonstrated that 97 (67%) of the 145 clinical CRC samples and 19 (40%) of the 48 healthy control CRC samples were positive for Candida. The N18-specific block-based PCR was positive for 109 (75%) clinical CRC samples and 22 (46%) of the healthy control CRC samples. In comparison, the ITS-specific PCR gave positive results for 93 (64%) clinical CRC samples and 25 (52%) healthy control CRC samples.

Table 1 and Fig. 3 present the agreement between Candida culture and PCR detection of Candida in the CRC samples. By using culture as the gold standard, the overall sensitivity and specificity of the real-time PCR were 94 and 78%, respectively, with only six culture-positive clinical CRC samples being negative by the real-time PCR. All six were culture negative for C. albicans. All culture-positive healthy control CRC samples were positive by real-time PCR.

FIG. 3.

FIG. 3.

Percent agreement of PCR and culture.

Compared with the real-time PCR, a lower correlation with CRC positivity was evident by the block-based PCRs. The N18-specific PCR achieved a sensitivity and a specificity of 88 and 55%, respectively. By using 95% confidence intervals (12) it was decided that the difference in sensitivity between the real-time PCR and the N18-specific PCR was not significant (95% confidence intervals, 14 to −2%). However, by using the same statistical method it was shown that the real-time PCR assay was 11 to 34% (95% confidence intervals) more specific than the N18-specific PCR. The sensitivity and specificity of the ITS-specific PCR were 74 and 51%, respectively (Fig. 3), with both of these values being statistically significantly inferior to those of the real-time assay (results not included). The positive and negative predictive values were 83 and 92%, 69 and 81%, and 63 and 63% for the real-time PCR, the N18-specific PCR, and the ITS-specific PCR, respectively.

Among the 91 culture-negative CRC samples, the real-time PCR revealed that 20 were positive; this compares with 41 and 44 positive samples by the N18- and ITS-specific PCRs, respectively. Thirty-two culture-negative CRC samples were negative by all three PCRs. All three PCRs were positive for eight culture-negative CRC samples, and a further 30 culture-negative CRC samples were positive by two of the three PCRs (Fig. 4).

FIG. 4.

FIG. 4.

Agreement between negative culture and PCR results.

Categorization of the culture-negative CRC samples into clinical (n = 60) and healthy control (n = 31) groups shows that only two (6%) samples from healthy controls that were culture negative by CRC were positive by the real-time PCR. In comparison, 18 (30%) culture-negative clinical CRC samples were positive by the real-time PCR. Eight (26%) culture-negative CRC samples from healthy controls were N18-specific PCR positive, and 33 (55%) of the culture-negative clinical CRC samples were also N18-specific PCR positive. Analysis of the ITS-specific PCR data revealed that 15 (48%) culture-negative healthy control CRC samples were PCR positive, and similar results were obtained for the culture-negative clinical CRC samples, 29 (48%) of which were ITS-specific PCR positive (Fig. 3 and 4).

DISCUSSION

PCR for fungal detection has primarily been limited to research laboratories but has recently been introduced into certain diagnostic mycology laboratories, especially in cases of possible fungemia, where rapid diagnosis is a necessity and culture from blood has proven problematic (5). Since PCRs are gradually being integrated alongside standard laboratory methods, it was thought that it would be of benefit to assess specific PCRs for candidal detection in CRC samples.

Initial studies with spiked CRC samples indicated a real-time PCR detection sensitivity of 1 to 10 yeasts/ml for C. albicans, C. parapsilosis, C. tropicalis, and C. viswanathii. The detection levels were lower for other Candida species (C. dubliniensis, C. glabrata, C. kefyr, and C. inconspicua). The Candida-specific probe did not hybridize to amplicons from C. guilliermondii or C. famata, a finding that was in agreement with our previous assessment of the PCR with blood samples (18). The Candida-specific probe had originally been designed for the detection of Candida in patients with candidemia, a condition that is primarily attributed to C. albicans and, to a lesser extent, C. tropicalis, C. parapsilosis, C. glabrata, and C. krusei (18). Modification of the probe to enable detection of C. guilliermondii and C. famata is possible, although the significance of these two species in oral candidosis remains uncertain. Having established that the real-time PCR methodology was applicable to these spiked control oral samples, the performance of the PCR was determined with 193 CRC samples. Forty-eight of these CRC samples were from individuals considered free of oral candidosis. These samples were included to ensure that an increased sensitivity of detection by real-time PCR would not result in the production of large numbers of false-positive (clinically insignificant) results. This situation would have negated the value of the PCR as a suitable clinical test; however, the results show that the real-time PCR and the gold standard culture produced comparable results for our healthy population.

Culture of the 145 clinical CRC samples from patients with a variety of oral signs and symptoms revealed that 85 were positive for Candida, representing a colonization rate of 59%. This value was noticeably higher than the 35% carriage rate for the 48 CRC samples from healthy mouths (17 positive samples), which compares favorably with the 36.8% rate published by Abu-Elteen and Abu-Alteen (1). In the case of candidal presence from patients with various disease states, the higher incidence observed was expected, although comparison with other studies is problematic due to the diversity of patient groups. The overall incidence of C. albicans in the 102 culture-positive CRC samples was 87%. This high incidence of C. albicans relative to those of the other species concurs with most studies of the candidal epidemiology of the mouth (6, 8). An interesting observation from the culture data was the apparent high incidence (compared with that in the healthy mouths) of Candida in oral conditions not primarily associated with the yeasts. This observation was particularly evident for patients with lichen planus, burning mouth syndrome, and dry mouth. The significance of Candida in these cases is uncertain, but the altered oral state in these patients may, in part, offer an environment more favorable to candidal colonization. Similar high incidences of Candida from the mouths of individuals with leukoplakia (82%), lichen planus (47%), and burning mouth syndrome have been reported (6, 7).

Overall, the real-time PCR compared favorably with culture, with the results of the real-time PCR achieving 94% agreement with those of culture for the culture-positive samples. The six samples with false-negative results were all non-C. albicans by culture, and therefore, the results probably relate to the failure of the probe to hybridize to the amplicon. Conversely, 20 real-time PCR-positive samples (18 clinical CRC samples and 2 healthy control CRC samples) were detected among the 91 culture-negative CRC samples, possibly highlighting the higher sensitivity of real-time PCR (1 to 10 yeasts/ml) compared with that of CRC (>20 CFU/ml of concentrate). In addition, the PCR approach was not reliant on the presence of viable organisms, thereby further enhancing its relative sensitivity over culture. Fifteen of the 20 real-time PCR-positive, culture-negative samples were positive by at least one other PCR, and 8 culture-negative CRC samples were positive by all PCR methods. These findings accentuate the failure of culture to detect Candida in certain oral samples.

Both block-based PCRs produced more than double the number of culture-negative, PCR-positive results for CRC samples than real-time PCR, although the clinical significance of these results is uncertain. Dividing the culture-negative CRC samples into clinical and healthy control CRC samples reveals that the percentage of PCR-positive samples among the healthy control samples was much higher for the block-based PCRs (N18-specific PCR, 26%; ITS-specific PCR, 48%) than for the real-time PCR (6%). If culture is considered the gold standard, these findings could raise a question over the clinical relevance of block-based PCR-positive results for culture-negative samples.

As the number of N18-specific PCR-positive samples was greater than the number of culture-positive samples for both the healthy control and clinical populations but the 95% confidence intervals were approximately the same for both populations (2 to 26% for healthy controls, 4 to 24% for the clinical cases), the clinical significance of the additional N18-specific PCR-positive clinical samples is ambiguous. Conversely, as the real-time PCR detected Candida in only 6% of the culture-negative healthy control CRC samples (i.e., it did not produce large numbers of false-positive, clinically irrelevant results), the rise to a 30% rate of detection for the clinical (symptomatic) group is of interest. This is confirmed by the 95% confidence intervals, which determined that the number of healthy control samples positive by real-time PCR was not statistically different from the number of the healthy control samples positive by culture (95% confidence interval, 11 to −3%), whereas the number of additional clinical samples positive by real-time PCR was 2 to 15% greater (95% confidence intervals) than the number of clinical samples positive by culture, and as such, the results for the samples could be considered true positive.

The lower specificities of the block-based PCR methods over that of real-time PCR could, in part, account for the increased incidence of positive results by the block-based PCRs. Since our experiments with spiked samples confirmed the overall greater sensitivity of real-time PCR than other molecular methods, it was likely that specificity largely contributed to the increased numbers of block-based PCR-positive samples. However, different PCR conditions and template volumes may also have had an effect. Determination of whether the results for block-based PCR-positive, culture-negative CRC samples were true positive or false positive would require additional testing, such as sequencing or restriction fragment length polymorphism analysis (21, 22, 23), thus increasing the complexity, cost, and time required to obtain an assay result.

The question about the significance of culture-negative CRC samples and clinical relevance needs to be raised, particularly when positive results are evident by real-time PCR. It has been suggested that the presence of elevated numbers of Candida organisms indicates infection rather then normal commensal carriage (9). However, Candida levels up to 9 × 103 CFU/ml were evident in healthy controls in our studies, and on occasion, these levels were higher than those in patients with oral candidosis (data not shown). In patients with CHC, hyphal penetration of the oral mucosa occurs, and in these patients low numbers of yeasts may be recoverable from the mucosal surface (17). The value of culture in patients with CHC may therefore be limited, particularly if CRC is used for yeast isolation. Furthermore, when patients have received antifungal therapy the candidal load may be significantly reduced but not eradicated, partly explaining the high recurrence of oral candidosis among certain patients (19). In these circumstances the improved sensitivity of real-time PCR would be advantageous.

Acknowledgments

We thank Pat Bishop and Gillian Fellows (Clinical Microbiology, Dental School, University of Wales College of Medicine) for collection and identification of candidal strains.

REFERENCES

  • 1.Abu-Elteen, K. H., and R. M. Abu-Alteen. 1998. The prevalence of Candida albicans populations in the mouths of complete denture wearers. New Microbiol. 21:41-48. [PubMed] [Google Scholar]
  • 2.Arendorf, T. M., and D. M. Walker. 1979. Oral candidal populations in health and disease. Br. Dent. J. 147:267-272. [DOI] [PubMed] [Google Scholar]
  • 3.Axell, T., L. P. Samaranayake, P. A. Reichart, and I. Olsen. 1997. A proposal for reclassification of oral candidosis. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 84:111-112. [DOI] [PubMed] [Google Scholar]
  • 4.Ben-Aryeh, H., E. Blumfield, R. Szargel, D. Laufer, and I. Berdicevsky. 1995. Oral Candida carriage and blood group antigen secretor status. Mycoses 38:355-358. [DOI] [PubMed] [Google Scholar]
  • 5.Bodey, G. P. 1988. The emergence of fungi as major hospital pathogens. J. Hosp. Infect. 11(Suppl. A):411-426. [DOI] [PubMed] [Google Scholar]
  • 6.Krogh, P., P. Holmstrup, J. J. Thorn, P. Vedtofte, and J. J. Pindborg. 1987. Yeast species and biotypes associated with oral leukoplakia and lichen planus. Oral Surg. Oral Med. Oral Pathol. 63:48-54. [DOI] [PubMed] [Google Scholar]
  • 7.Kurnatowska, A. J. 2001. Search for correlation between symptoms and signs of changes in the oral mucosa and presence of fungi. Mycoses 49:379-382. [DOI] [PubMed] [Google Scholar]
  • 8.Lipperheide, V., G. Quindós, Y. Jiménez, J. Pontón, J. V. Bagán-Sebastián, and J. M. Aguirre. 1996. Candida biotypes in patients with oral leukoplakia and lichen planus. Mycopathologia 134:75-82. [DOI] [PubMed] [Google Scholar]
  • 9.MacFarlane, T. W. 1990. Ecology and epidemiology of Candida, p. 21-46. In L. P. Samaranayake and T. W. MacFarlane (ed.), Oral candidosis. Butterworth and Co., London, United Kingdom.
  • 10.McKendrick, A. J. W., M. I. Wilson, and D. M. G. Main. 1967. Oral Candida and long-term tetracycline therapy. Arch. Oral Biol. 12:281-290. [DOI] [PubMed] [Google Scholar]
  • 11.McKendrick, A. J. W. 1968. Denture stomatitis and angular cheilitis in patients receiving long-term tetracycline therapy. Br. Dent. J. 124:412-417. [PubMed] [Google Scholar]
  • 12.Newcombe, R. G. Improved confidence intervals for the difference between binomial proportions based on paired data. Stat. Med. 17:2635-2680. [PubMed]
  • 13.Odds, F. C. 1988. Ecology of Candida and epidemiology of candidosis, p. 68-92. In Candida and candidosis: a review and bibliography, 2nd ed. Baillière Tindall, London, United Kingdom.
  • 14.Odds, F. C., and R. Bernaerts. 1994. CHROMagar Candida, a new differential isolation medium for presumptive identification of clinically important Candida species. J. Clin. Microbiol. 32:1923-1929. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Samaranayake, L. P., T. W. MacFarlane, P.-J. Lamey, and M. M. Ferguson. 1986. A comparison of oral rinse and imprint sampling techniques for the detection of yeast, coliform and Staphylococcus aureus carriage in the oral cavity. J. Oral Pathol. 15:386-388. [DOI] [PubMed] [Google Scholar]
  • 16.Shechtman, L. B., L. Funaro, T. Robin, E. J. Bottone, and J. Cuttner. 1984. Clotrimazole treatment of oral candidiasis in patients with neoplastic disease. Am. J. Med. 76:91-94. [DOI] [PubMed] [Google Scholar]
  • 17.Walker, D. M., and T. M. Arendorf. 1990. Candidal leucoplakia, chronic multifocal candidosis and median rhomboid glossitis, p. 184-199. In L. P. Samaranayake and T. W. MacFarlane (ed.), Oral candidosis. Butterworth and Co., London, United Kingdom.
  • 18.White, P. L., A. Shetty, and R. A. Barnes. 2003. Detection of seven Candida species using the Light-Cycler system. J. Med. Microbiol. 52:229-238. [DOI] [PubMed] [Google Scholar]
  • 19.Wilson, M. J., D. W. Williams, M. D. L. Forbes, I. G. Finlay, and M. A. O. Lewis. 2001. A molecular epidemiological study of sequential oral isolates of Candida albicans from terminally ill patients. J. Oral Pathol. Med. 30:206-212. [DOI] [PubMed] [Google Scholar]
  • 20.Williams, D. W., and M. A. O. Lewis. 2000. Isolation and identification of Candida from the oral cavity. Oral Dis. 6:3-11. [DOI] [PubMed] [Google Scholar]
  • 21.Williams, D. W., M. J. Wilson, M. A. O. Lewis, and A. J. C. Potts. 1995. Identification of Candida species by PCR and restriction fragment length polymorphism analysis of intergenic spacer regions of ribosomal DNA. J. Clin. Microbiol. 33:2476-2479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Williams, D. W., M. J. Wilson, M. A. O. Lewis, and A. J. C. Potts. 1996. Identification of Candida species in formalin-fixed, paraffin-embedded oral mucosa by sequencing of ribosomal DNA. J. Clin. Pathol. Mol. Pathol. 49:M23-M28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Williams, D. W., W. A. Coulter, M. J. Wilson, A. J. C. Potts, and M. A. O. Lewis. 2001. Identification of Candida dubliniensis, based on ribosomal DNA sequence analysis. Br. J. Biomed. Sci. 58:11-16. [PubMed] [Google Scholar]
  • 24.Williamson, J. J. 1968. Method of counting Candida albicans in saliva. J. Dent. Res. 47:979. [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES