Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Feb 1.
Published in final edited form as: Prostaglandins Leukot Essent Fatty Acids. 2013 Dec 18;90(0):47–54. doi: 10.1016/j.plefa.2013.12.006

Effect of sex hormones on n-3 polyunsaturated fatty acid biosynthesis in HepG2 cells and in human primary hepatocytes

Charlene M Sibbons a, J Thomas Brenna b, Peter Lawrence b, Samuel P Hoile a, Rebecca Clarke-Harris a, Karen A Lillycrop c, Graham C Burdge a,*
PMCID: PMC4046896  NIHMSID: NIHMS583716  PMID: 24411721

Abstract

Female humans and rodents have been shown to have higher 22:6n-3 status than males. Sex hormones are involved, but it is unclear whether higher 22:6n-3 status and biosynthesis in females is mediated by the action of estrogen or progesterone. We investigated the specificity of the effects of physiological concentrations of sex hormones on the mRNA expression of genes involved in polyunsaturated fatty acid (PUFA) biosynthesis and on the conversion of [d5]-18:3n-3 to longer chain fatty acids in HepG2 cells. Progesterone, but not 17α-ethynylestradiol (EE2) or testosterone, increased the mRNA expression of FADS2, FADS1, ELOVl 5 and ELOVl 2. Progesterone induced similar changes in primary human hepatocytes, although the increase in expression was only significant for FADS2. This was accompanied by reduced methylation of specific CpG loci in the FADS2 promoter located within a putative cAMP response element binding protein binding domain in HepG2 cells. Progesterone, but not EE2 or testosterone, increased conversion of [d5]-18:3n-3 to 20:5n-3, 22:5n-3 and 22:6n-3. Together these findings show that progesterone up-regulates n-3 PUFA biosynthesis by increasing the mRNA expression of genes involved in this pathway, possibly via changes in the epigenetic regulation of FADS2, in human liver cells in vitro.

Keywords: Omega-3 polyunsaturated fatty acids, eicosapentaenoic acid, docosahexaenoic acid, estrogen, progesterone, testosterone, FADS, elongase

1. Introduction

The relative proportions of polyunsaturated fatty acids (PUFA) are an important influence on cell function as they influence the biophysical properties of the phospholipid bilayer and provide substrates for phospholipase-mediated signalling pathways. 20:5n-3 and 22:6n-3 can be obtained preformed from dietary sources such as oily fish. However, most mammalian species have some capacity for the synthesis of these fatty acids from the n-3 essential fatty acid 18:3n-3 which is present in specific plant oils. Such molecular transformation involves desaturation at the Δ6 position by Δ6 desaturase to form 18:4n-3, elongation of the carbon chain by elongase-2 activity to form 20:4n-3, and desaturation at the Δ5 position by Δ5 desaturase to form 20:5n-3(1). Conversion of 20:5n-3 to 22:6n-3 involves further elongation by elongase -2 or -5 activity to form 22:5n-3 and elongation by elongase-2 activity to form 24:5n-3. 24:6n-3 is then formed by desaturation at the Δ6 position by Δ6 desaturase. 24:6n-6 is then translocated to peroxisomes where one cycle of fatty acid β-oxidation converts 24:6n-3 to 22:6n-3 which is then returned to the endoplasmic reticulum(1).

Sex appears to be an important influence on 22:6n-3 status and capacity for synthesis of 20:5n-3 and 22:6n-3 from 18:3n-3 in humans. A meta-analysis of 51 studies of the PUFA content of plasma, erythrocyte or adipose tissue in 8,541 subjects has shown the proportion of 22:6n-3 to be 37% lower in men than women (2). In addition, a meta-analysis of 2,907 subjects also showed the proportion of 22:6n-3 to be 47% lower in men than in women (3). Such sex differences in 22:6n-3 status appear to be independent of dietary background (1, 4). Female rodents have also been shown to have higher plasma and liver 22:6n-3 status than males (5–8). Studies in which dietary 18:3n-3 intake was increased in men have shown a dose-related increase in 20:5n-3 and 22:5n-3, but not in 22:6n-3. This implies constraint in the reactions that follow 22:5n-3 synthesis (5). The effect of 18:3n-3 supplementation on 20:5n-3 and 22:6n-3 status in women is not known. Studies that have used 18:3n-3 labelled with stable isotopes to measure its conversion to longer chain metabolites have confirmed the findings of the observational and dietary intervention studies which showed that women were shown to convert more 18:3n-3 to 22:6n-3 than men(9–11). In rats, the mRNA expression of Fads2, which encodes Δ6 desaturase, and Fads1, which encodes Δ5 desaturase, have been shown to be higher in the liver of females than males (6, 12) which demonstrates that at least part of the effect of sex hormones on n-3 PUFA metabolism is mediated through differences in mRNA expression. Together the findings of these studies indicate that sex hormones play a central role in the regulation of PUFA synthesis and status.

There have been relatively few studies of the effects of sex hormones on 22:6n-3 status or synthesis. Women who use an oral contraceptive pill have higher 22:6n-3 status (13) and greater conversion of 18:3n-3 to 22:6n-3 than those who do not. Male transsexuals undergoing hormone therapy treated with synthetic estrogens combined showed increased 22:6n-3 levels in blood compared to untreated men, while those treated with cyproterone acetate, and anti-androgen and weak progesterone mimetic, showed no difference to untreated men (13). Treatment of postmenopausal women with conjugated estrogens and medroxyprogesterone acetate also increased 20:4n-6 and 22:6n-3 levels in blood compared to untreated individuals (14). Furthermore, female transsexuals who were treated with testosterone showed a reduction in 22:6n-3 status (13). Such findings point to a specific positive effect of females sex hormones estrogens on 22:6n-3 synthesis. However, it is not clear which hormone is involved. One recent study in rats has shown that the increase in 22:6n-3 status associated with pregnancy was associated positively with progesterone concentration (6). Such effects were associated with increased mRNA expression of Fads2. These findings imply that the regulation of PUFA synthesis by sex hormones involves effects on the transcription of genes that encode key genes in this pathway.

In order to investigate the specificity of the effects of hormones on the regulation of n-3 PUFA synthesis, we treated the human hepatocarcinoma cell line HepG2 with a ?physiologically relevant estrogen (17α-ethynylestradiol (EE2) which has similar potency to naturally occurring 7β-estradiol (15)), progesterone and testosterone. Because sex hormones have been shown previously to alter Fads2 mRNA expression in rat liver, we measured the effect of treatment with these hormones on the mRNA expression of FADS and ELOVL genes. We then determined whether any changes in mRNA levels were associated with altered synthesis of 20:5n-3 and 22:6n-3. In addition, we investigated whether any effects of sex hormones on genes involved in n-3 PUFA metabolism in HepG2 cells were also induced in primary human hepatocytes.

2. Materials and methods

2.1 Materials

HepG2 cells and primary hepatocytes were obtained from ECACC and Invitrogen. [17,17,18,18,18-d5]-18:3n-3 (98%) was purchased from Cambridge Isotope Laboratories. Primers for real time PCR were from Biomers (FADS2) and Qiagen (FADS1, ELOVL2, ELOVL5 and cyclophilin). Pyrosequencing and PCR and sequencing primers were synthesised by Biomers. All other reagents were obtained from Sigma and PAA, with noted exceptions.

2.2 Cell culture

Cells were maintained at 37°C under 5% CO2. HepG2 cells were grown in DMEM-high glucose (Sigma) supplemented with 2 mM L-glutamine, penicillin/streptomycin (100 U/ml and100 ug/ml, respectively) and 10% (v/v) fetal bovine serum. HepG2 cells were transferred to 90 mm culture dishes (Greiner) and left to adhere overnight before treatment with hormones. Primary hepatocytes were grown as instructed by the manufacturers (Invitrogen). All media was warmed to 37°C and primary hepatocytes were thawed in CHRM medium at 37°C and then added to collagen coated (5 ug/cm2) 6 well plates (Greiner) in 2 ml of plating medium (Williams E medium containing: 5% Fetal Bovine Serum, 1 μM DMSO and 18 ml of thawing/plating cocktail) per well. The plates were incubated for 4–6 hours after which they were agitated to loosen debris and the media was then removed and replaced with incubation medium (Williams E medium containing: 0.1 μM of DMSO and 20 ml of cell maintenance cocktail). Primary hepatocytes could not be sub-cultured so were incubated overnight and then used in directly in experiments.

HepG2 cells were incubated for 72 hours with EE2 (0.07, 0.7 or 7 nmoles/l), progesterone (10, 25 or 50 nmoles/l) or testosterone (10, 25 or 50 nmoles/l) or no hormone supplement (untreated). Primary human hepatocytes were incubated for 72 hours with the highest concentration of EE2 or progesterone, 7 nM and 50 nM respectively or remained untreated. The media and hormone supplements were replenished daily. These concentrations of hormone were used as they represent physiological relevant concentrations observed in plamsa.

2.3 Measurement of mRNA expression

Total RNA was isolated from cells using Tri-reagent (Sigma). Complementary DNA was prepared and amplified using real-time RT PCR, which was performed using SYBR Green Jumpstart Ready Mix (Sigma) in a final volume of 25 μl. Samples were analysed in duplicate and expression was normalized to the housekeeping gene cyclophillin. Cycle parameters were 95°C for 2 minutes then 40 cycles of 95°C for 30 seconds, 55°C (cyclophilin, FADS1, ELOVL2 and ELOVL5) or 52°C (FADS2) for 1 minute and 72°C for 1 minute. Expression was determined by the standard curve method.

2.4 Measurement of DNA methylation

HepG2 cells were incubated for 72 hours with 50 nmoles/l progesterone or left untreated. Cells were removed from plates in HBSS and cell pellets were then frozen for subsequent DNA extraction. Bisulfite conversion was carried out using the EZ DNA methylation kit (ZymoResearch). The pyrosequencing reaction was carried out using primers listed in Table 1. Modified DNA was amplified using KAPA2G Robust Hot Start Taq DNA polymerase (Labtech). PCR products were immobilised on streptavidin–sepharose beads (GE Healthcare UK Ltd.), washed, denatured and released into annealing buffer containing the sequencing primers. Pyrosequencing was carried out using the SQA kit on a PSQ 96MA machine (Biotage, Uppsala, Sweden), and the percentage methylation was calculated using the Pyro Q CpG software (Biotage).

Table 1.

Oligonucleotide primers used in real time RTPCR assays
Gene Forward primer Reverse primer
FADS1 CCAGACTCCACTTCTCAA GCCAGTTCACCAATCAGC
FADS2 Quanitect Primer Assay HS_FADS1_1_SG
ELOVl 2 Quanitect Primer Assay HS_ELOVL2_1_SG
ELOVL 5 Quanitect Primer Assay HS_ELOVL5_1_SG
Oligonucleotide primers used in DNA methylation assays
PCR primers

Start CpG End CpG Length of amplicon (bp) Forward primer Reverse primer
-1661 -1665 168 GTATGGTGGTTTTGAGGATTGTT AAAATACTCCCTAATTCTACCTTTCAACTA
-1337 290 TTGTTGTGAAATTTAGATTGGGTAGG CCTAAAAAAAATAAACCTAACTACAT
-1278 290 TTGTTGTGAAATTTAGATTGGGTAGG CCTAAAAAAAATAAACCTAACTACAT
-1156 90 TTGTTGTGAAATTTAGATTGGGTAGG CCTAAAAAAAATAAACCTAACTACAT
-119 -1101 319 ATTTGAGGGTTTTATAATTTTTTTAGTGAT ACCCTAATCTCAATAAACTCAATCT
-1071 -1056 218 ATTTGAGGGTTTTATAATTTTTTTAGTGAT CCCTAATCTCAATAAACTCAATCTCTT
-1013 -975 323 ATTTGAGGGTTTTATAATTTTTTTAGTGAT CCTTACCCTAATCTCAATAAACTCAATC
-914 -855 199 GGTAGTTTTTATTTGTTGGAGTTTGTAT AAACCTCTACTCTACTTTCTTAATCT
-817 -775 167 ATTGAGTTTATTGAGATTAGGGTAAGG ACTTTAAACCCTCTAATCAAACAATCTT
-718 -667 116 ATTGTTTGATTAGAGGGTTTAAAGTT AAACTCCAATATCCCACATTAT
Sequencing primers
TGGTTTTGAGGATTGTTAA
AGATTGGGTAGGGTT
GGTTTTTTATTTTTAAGTGAGATG
GGGTTTTATAATTTTTTTAGTGAT
AAAATAAACCTAACTACATCC
CCTCAAACCCCAACT
ATTATACAAACTCCAACAAAT
ATTATTGTTTAATGATGTGTTTG
CCTCTAATCAAACAATCTTAAAA
AGAGGGTTTAAAGTTTTTTAAT

2.5 Measurement of PUFA synthesis

HepG2 cells were incubated for 48 hours with 10 μmoles/l [d5]-18:3n-3 and EE2 (7 nmoles/l), progesterone (50 nmoles/l) and testosterone (50 nmoles/l) or left untreated. Cells were scraped from plates 0.9% (w/v) NaCl (0.8ml). Total lipids were extracted with chloroform and methanol (16) and converted to fatty acid methyl esters (FAMES) by incubation with methanol containing 2% (v/v) sulphuric acid (17). The concentration of individual n-3 PUFA was determined by gas chromatography (18). Incorporation of deuterium label into n-3 PUFA was determined by gas chromatography-mass spectrometry (19). Briefly, ions corresponding to the d0 and d5 isotopologues of the four major n-3 fatty acids (18:3, 20:5, 22:5, and 22:6) were integrated. Ratios of the d5 to d0 were calculated and used as measures of net conversion over the 48 h incubation period. Total cell protein was extracted from a 10 μl aliquot of cells in 0.9% (w/v) NaCl by Pierce® BCA Protein Assay kit (Thermo Scientific).

2.6 Statistical analysis

Statistical analysis was carried out using SPSS (Version 21.0, IBM, Armonk, NY: IBM Corp.). Data from dose-response experiments was analysed by 1-way ANOVA with Dunnett’s post hoc test to compare the effect of each concentration of hormone to control. Experiments involving single concentrations of hormones were analysed by Student’s unpaired t test. Associations between data sets were tested using linear regression analysis. Statistical significance was assumed at probabilities less than 0.05. The sample size of ten replicates was sufficient to detect a 10% difference in the primary outcome measures, mRNA expression and synthesis of deuterated fatty acids, with a statistical power of 85% and probability of P < 0.05.

3. Results

Treatment of HepG2 cells with progesterone for 48 hours induced a linear (r= 0.67, P < 0.0001) dose-related increase in FADS2 mRNA expression which reached statistical significance compared to control at 25 nM (2.1-fold) and 50 nM (Figure 1). However, maximum mRNA levels of FADS1, ELOVL 5 and ELOVL 2 were induced at the lowest concentration of progesterone tested (10 nmole/l); 2.1-fold, 2.5-fold and 3.9-fold, respectively (Figure 1). There was no significant effect of treatment with EE2 or testosterone on the mRNA expression on any of the genes measured in HepG2 cells (Figure 1).

Fig. 1.

Fig. 1

The effect of treatment with sex hormones on the mRNA expression of genes involved in n-3 PUFA biosynthesis in HepG2 cells. Values are mean ± SD (n = 10 replicates per treatment). Statistical analysis was by 1-way ANOVA with Dunnett’s post hoc test. * P<0.01; **P<0.001; ***P<0.0001 compared to untreated cells. ANOVA probability for the effect of progesterone treatment was for FADS1 and 2 P<0.0001, ELOVL 5 P=0.008 and ELOVL 2 P = 0.09). There were no statistically significant effects of treatment with EE2 or testosterone on the mRNA expression of any of the genes measured.

In order to investigate whether the effect of sex hormones of FADS and ELOVL gene expression in HepG2 cells could be induced in primary human hepatocytes, these cells were treated with the highest concentration of progesterone or EE2 to which HepG2 cells were exposed. Because of the slow replication rate of primary hepatocytes, sufficient cells could not be generated to test the effect of testosterone. Treatment of primary human hepatocytes with progesterone induced a significant increase in FADS2 mRNA expression (2.4-fold) and non-significant (P < 0.1) trends towards higher mRNA expression of FADS1, ELOVL5 and ELOVL 2 (Figure 2). There was no significant effect of treatment with EE2 on the expression of any of the genes measured in primary hepatocytes (Figure 2).

Fig. 2.

Fig. 2

The effect of treatment with sex hormones on the mRNA expression of genes involved in n-3 PUFA biosynthesis in primary human hepatocytes. Values are mean ± SD (n = 10 replicates per treatment). Statistical analysis was by Student’s unpaired t-test. * P<0.01; **P<0.001; ***P<0.0001 compared to untreated cells. There was a statistically significant effect of progesterone treatment on FADS2 mRNA expression (P = 0.01) and a non-significant trend towards an effect of progesterone on FADS1 expression (P = 0.08). There were no statistically significant effects of treatment with progesterone on ELOVL 5 or 2 expression or of EE2 or testosterone on the expression of any of the genes measured.

We measured the methylation status of a region between -1661 and -18 bp upstream of the FADS2 transcription start site (Figure 3). The region was characterised by highly methylated CpG loci between -1661 and -1156 bp, loci with intermediate methylation at loci -718 and -669 and an essentially unmethylated region (average methylation < 5%) proximal to the transcription start site (Figure 4). Treatment of HepG2 cells with progesterone (50 nmoles/l) induced reduction in the methylation status of specific CpG dinucleotides located at -1661 (3%, P = 0.02) and -1665 (14%, P = 0.007) bp relative to the transcription start site (Figure 4).

Fig 3.

Fig 3

Nucleotide sequence of the 5′ region analysed by pyrosequencing. CpG dinucleotides as indicated by distance (bp) from the transcription start site. Putative transcription factor response elements are indicated by bars beneath the DNA sequence.

Fig. 4.

Fig. 4

The effect of treatment of HepG2 cells with progesterone on the methylation of specific CpG loci in the FADS2 promoter. Values are mean ± SD (n = 6 replicates per treatment). Statistical analysis was by Students unpaired t test. * P<0.05; **P<0.01 compared to untreated cells.

In order to determine whether the changes in gene expression were associated with altered activity of the PUFA synthesis pathway, HepG2 cells were incubated with [d5]-18:3n-3 in the presence or absence of sex hormones. Progesterone induced a significant decrease (38%) in the amount of labeled 18:3n-3 in cell total lipids, and significant increases in the amounts of labeled 20:5n-3 (5-fold), 22:5n-3 (7-fold) and 22:6n-3 (36-fold) (Figure 5). There was no significant effect of treatment with EE2 or testosterone on the incorporation of stable isotope label into any of the n-3 PUFA that were measured (Figure 5).

Fig. 5.

Fig. 5

The effect of treatment with sex hormones on n-3 PUFA biosynthesis in HepG2 cells. Values are mean ± SD (n = 5 replicates per treatment). Statistical analysis was by 1-way ANOVA with Dunnett’s post hoc test. * P<0.01; **P<0.001; ***P<0.0001 compared to untreated cells. There was a statistically significant effect of progesterone treatment on FADS2 mRNA expression (P = 0.01) and a non-significant trend towards an effect of progesterone on FADS1 expression (P = 0.08). There were no statistically significant effects of treatment with progesterone on ELOVL 5 or 2 expression or of EE2 or testosterone on the expression of any of the genes measured.

4. Discussion

Although there is compelling evidence from studies of humans and of rodents that males and females differ in n-3 PUFA status, in particular 22:6n-3, and in capacity for conversion of 18:3n-3 to 22:6n-3, there remains uncertainty in nature of the endocrine regulation of the PUFA biosynthesis. While some studies have implicated estrogen as an agonist (9, 13), there is also evidence for positive regulation by progesterone (6). In contrast, testosterone appears to antagonise conversion of 18:3n-3 to its longer chain metabolites (13). The findings of this study provide evidence that progesterone is an endocrine agonist for n-3 PUFA biosynthesis and that such effects are mediated at the level of transcription.

Treatment of HepG2 cells with physiological concentrations of progesterone induced an increase in the mRNA expression of FADS2 and 1, and ELOVL 5 and 2, while there was no significant effect of treatment with EE2, and testosterone on the level of these transcripts. Treatment of primary hepatocytes with progesterone induced a significant increase in FADS2 mRNA expression, while there were only non-significant trends towards higher expression of FADS1 and ELOVL 2 and 5. Together these findings suggest that while progesterone acts as an agonist for PUFA biosynthesis in both the cancer cell line and in primary hepatocytes, FADS1 and ELOVL 2 and 5 appear to be less responsive to progesterone in primary hepatocytes than in HepG2 hepatocarcinoma cells. This may reflect adaptation of HepG2 cells to in vitro culture or the transformed nature of the cells. One implication is that the findings of studies in which HepG2 cells are used as a model of PUFA biosynthesis should be treated with caution. However, as in HepG2 cells, in primary hepatocytes estrogen treatment did not alter the mRNA expression of FADS 2 and 1 or ELOVL 2 and 5..

It has been suggested that higher 22:6n-3 status and greater capacity for 22:6n-3 biosynthesis in females than in males reflects a metabolic adaptation that facilitates supply of 22:6n-3 from the mother to the developing offspring. The concentration of 22:6n-3 in plasma phospholipids increases during pregnancy in women and in liver and plasma of pregnant rats. This increase in 22:6n-3 status has been associated with greater FADS 2 and 1 mRNA expression in the liver of pregnant rats. Furthermore, both estrogen and progesterone have been shown to be positively associated with hepatic FADS2 mRNA expression in pregnant rats, but negatively associated with the concentrations of other metabolites of 18:3n-3 (6). The findings of the present study support a potential role for progesterone in the pregnancy-associated increase in FADS2 mRNA expression and in 22:6n-3 concentration. Whether or not estrogen also contributes to this change 22:6n-3 in pregnancy cannot be deduced from these in vitro findings.

FADS2 transcription is regulated epigenetically by DNA methylation of its promoter (18, 20–22). We show for the first time the pattern of DNA methylation in a region of the human FADS2 gene that is located between the transcription start site and -1661 bp upstream (Figure 3). This region was characterised by a relatively highly methylated domain located distal to the transcription start site, a region of transition in the level of methylation between -718 to -669 bp and a region proximal to the transcription start site in which methylation was below the detection limit for analysis by pyrosequencing of 5% (23) which we assumed to be essentially unmethylated (Figure 4). A number of putative transcription factor binding sites were identified throughout the region that was analysed (Figure 3). However, no sequence was identified that corresponded to the progesterone receptor response element, although a putative estrogen receptor response element was identified between 1325 and 1345 bp relative to the transcription start site (Figure 3). Treatment of HepG2 cells with progesterone induced reduction in methylation of CpG loci at -1661 and -1665 bp relative to the FADS2 transcription start site. Reduction in the methylation of individual CpG loci has been shown to increase FADS2 transcription in rat liver and aortae (18, 21). However, it is unclear from the present findings whether changes in DNA methylation of 3% or 14% are sufficient to account for the magnitude of the increase in FADS2 mRNA expression. The CpG dinucleotides located at -1661 and -1655 bp lie within a putative cAMP response element binding protein binding site (CREB) (Figure 3). Progesterone has been shown to increase transcription by up-regulation of the cAMP signaling pathway (24, 25) and CREB-1 has been shown to increase the level of transcription of steroy-CoA desaturase-1 (26). Therefore it is possible that the action of progesterone on FADS2 transcription may be mediated via CREB activity. If so, then occupancy of the CREB response element may facilitate demethylation of the CpG dinucleotides at -1661 and -1655 bp by blocking the action of DNA methyltransferases (27). However, the elucidation of the mechanism by which progesterone treatment induced altered methylation of the FADS2 promoter was beyond the scope of this study.

Progesterone treatment induced a significant increase in the synthesis of 20:5n-3, 22:5n-3 and 22:6n-3 from [d5]-18:3n-3. These findings confirm that induced changes in the mRNA expression of genes that encode the four major enzymes involved in conversion of 18:3n-3 to longer chain metabolites affect the capacity of cells for n-3 PUFA biosynthesis. The decrease in the [d5]-18:3n-3 concentration in HepG2 cells treated with progesterone probably reflected the increase in conversion to longer chain n-3 PUFA. There was no effect of treatment with EE2 or testosterone on the synthesis of 20:5n-3, 22:5n-3 and 22:6n-3 which is consistent with the absence of an effect of these hormones on gene transcription.

The findings of this study show a specific positive effect of progesterone on the mRNA expression of genes involved in PUFA biosynthesis and on conversion of 18:3n-3 to longer chain m-3 PUFA in human hepatocarcinoma cells or primary hepatocytes at physiological concentration in vitro. Previous studies have shown that estrogen, but not progesterone or testosterone, can increase plasma n-3 PUFA status (13, 14), in particular DHA, in women who took a combined estrogen and progesterone contraceptive pill had greater capacity for conversion of 18:3n-3 to 22:6n-3 than those who did not (9). Similarly, combined treatment of post-menopausal women with estrogen and progesterone increased their blood 20:4n-6 and 22:6n-3 status (14). Furthermore, blood progesterone concentration has been associated positively with hepatic Fads2 mRNA expression in rats (6) and estrogen treatment of ovariectomised rats increased brain 22:6n-3 concentration (28). While the current findings show a specific effect of progesterone on n-3 PUFA metabolism and the expression of associated genes, they do not resolve the debate about the relative roles of estrogen and progesterone in regulating PUFA metabolism. The main difference in the design of the current study from those reported previously is that the effects of sex hormones on PUFA metabolism were tested in vitro. While the use of a liver cancer cell line may be a limitation, we also tested the effects of hormones in primary human hepatocytes and found similar changes in gene expression. One advantage of this approach is that the hormone exposure was controlled which cannot be achieved in vivo. Furthermore, the design of the present study allowed n-3 PUFA metabolism to be measured directly, rather than using proxy measures such as plasma n-3 PUFA status. This may be important as estrogens can modify phospholipid metabolism (29, 30) in a manner that may mask any direct effects on PUFA biosynthesis. Furthermore, cross-talk by estrogen and progesterone signally pathways (31, 32) may also produce ambiguous findings with respect to the specificity of the effect of sex hormones on n-3 PUFA metabolism.

Together the findings of this study show that progesterone up-regulates n-3 PUFA biosynthesis and the mRNA expression of genes involved in this pathway, possible via changes in the epigenetic regulation of FADS2, in human liver cells in vitro. Further studies, including the use of hormone receptor knockout models, are needed to clarify the relative role of progesterone and estrogen in regulating PUFA biosynthesis in vivo.

Acknowledgments

The work reported in this article was supported by a grant from the Nutricia Research Foundation. GC/MS analysis was supported in part by NIH grant R01 AT007003 from the National Center for Complementary and Alternative Medicine (NCCAM) and the Office of Dietary Supplements (ODS). Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the NCCAM, ODS, or the National Institutes of Health.

Footnotes

6. Author contributions

GCB and KAL designed the study. CMS, SPH, R C-H, PL and JTB carried out the experiments and analysed the data. GCB wrote the first draft of the manuscript with subsequent input form all authors. The authors declare no conflict of interest.

References

  • 1.Sprecher H, Chen Q. Polyunsaturated fatty acid biosynthesis: a microsomal-peroxisomal process. Prostaglandins LeukotEssentFatty Acids. 1999;60(5–6):317–21. doi: 10.1016/s0952-3278(99)80006-4. [DOI] [PubMed] [Google Scholar]
  • 2.Lohner S, Fekete K, Marosvolgyi T, Decsi T. Gender differences in the long-chain polyunsaturated fatty acid status: systematic review of 51 publications. Ann Nutr Metab. 2013;62(2):98–112. doi: 10.1159/000345599. Epub 2013/01/19. [DOI] [PubMed] [Google Scholar]
  • 3.Decsi T, Kennedy K. Sex-specific differences in essential fatty acid metabolism. Am J Clin Nutr. 2011;94(6 Suppl):1914S–9S. doi: 10.3945/ajcn.110.000893. Epub 2011/11/18. [DOI] [PubMed] [Google Scholar]
  • 4.Welch AA, Shakya-Shrestha S, Lentjes MA, Wareham NJ, Khaw KT. Dietary intake and status of n-3 polyunsaturated fatty acids in a population of fish-eating and non-fish-eating meat-eaters, vegetarians, and vegans and the precursor-product ratio of alpha-linolenic acid to long-chain n-3 polyunsaturated fatty acids: results from the EPIC-Norfolk cohort. Am J Clin Nutr. 2010;92(5):1040–51. doi: 10.3945/ajcn.2010.29457. [DOI] [PubMed] [Google Scholar]
  • 5.Burdge GC, Calder PC. Dietary alpha-linolenic acid and health-related outcomes: a metabolic perspective. Nutrition Research Reviews. 2006;19(1):26–52. doi: 10.1079/NRR2005113. [DOI] [PubMed] [Google Scholar]
  • 6.Childs CE, Hoile SP, Burdge GC, Calder PC. Changes in rat n-3 and n-6 fatty acid composition during pregnancy are associated with progesterone concentrations and hepatic FADS2 expression. Prostaglandins, leukotrienes, and essential fatty acids. 2012;86(4–5):141–7. doi: 10.1016/j.plefa.2012.03.007. Epub 2012/04/13. [DOI] [PubMed] [Google Scholar]
  • 7.McNamara RK, Able J, Jandacek R, Rider T, Tso P. Gender differences in rat erythrocyte and brain docosahexaenoic acid composition: role of ovarian hormones and dietary omega-3 fatty acid composition. Psychoneuroendocrinology. 2009;34(4):532–9. doi: 10.1016/j.psyneuen.2008.10.013. Epub 2008/12/03. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Kitson AP, Smith TL, Marks KA, Stark KD. Tissue-specific sex differences in docosahexaenoic acid and Delta6-desaturase in rats fed a standard chow diet. Applied physiology, nutrition, and metabolism = Physiologie appliquee, nutrition et metabolisme. 2012;37(6):1200–11. doi: 10.1139/h2012-103. Epub 2012/10/12. [DOI] [PubMed] [Google Scholar]
  • 9.Burdge GC, Wootton SA. Conversion of alpha-linolenic acid to eicosapentaenoic, docosapentaenoic and docosahexaenoic acids in young women. BrJ Nutr. 2002;88(4):411–20. doi: 10.1079/BJN2002689. [DOI] [PubMed] [Google Scholar]
  • 10.Burdge GC, Jones AE, Wootton SA. Eicosapentaenoic and docosapentaenoic acids are the principal products of alpha-linolenic acid metabolism in young men*. BrJNutr. 2002;88(4):355–63. doi: 10.1079/BJN2002662. [DOI] [PubMed] [Google Scholar]
  • 11.Pawlosky R, Hibbeln J, Lin Y, Salem N., Jr n-3 fatty acid metabolism in women. BrJNutr. 2003;90(5):993–4. doi: 10.1079/bjn2003985. [DOI] [PubMed] [Google Scholar]
  • 12.Burdge GC, Slater-Jefferies JL, Grant RA, Chung WS, West AL, Lillycrop KA, et al. Sex, but not maternal protein or folic acid intake, determines the fatty acid composition of hepatic phospholipids, but not of triacylglycerol, in adult rats. Prostaglandins LeukotEssentFatty Acids. 2008;78(1):73–9. doi: 10.1016/j.plefa.2007.10.028. [DOI] [PubMed] [Google Scholar]
  • 13.Giltay EJ, Gooren LJ, Toorians AW, Katan MB, Zock PL. Docosahexaenoic acid concentrations are higher in women than in men because of estrogenic effects. AmJClinNutr. 2004;80(5):1167–74. doi: 10.1093/ajcn/80.5.1167. [DOI] [PubMed] [Google Scholar]
  • 14.Giltay EJ, Duschek EJ, Katan MB, Zock PL, Neele SJ, Netelenbos JC. Raloxifene and hormone replacement therapy increase arachidonic acid and docosahexaenoic acid levels in postmenopausal women. JEndocrinol. 2004;182(3):399–408. doi: 10.1677/joe.0.1820399. [DOI] [PubMed] [Google Scholar]
  • 15.Coldham NG, Dave M, Sivapathasundaram S, McDonnell DP, Connor C, Sauer MJ. Evaluation of a recombinant yeast cell estrogen screening assay. Environmental health perspectives. 1997;105(7):734–42. doi: 10.1289/ehp.97105734. Epub 1997/07/01. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Folch J, Lees M, Sloane-Stanley GH. A simple method for the isolation and purification of total lipides from animal tissues. Journal of Biological Chemistry. 1957;226(1):497–509. [PubMed] [Google Scholar]
  • 17.Burdge GC, Wright P, Jones AE, Wootton SA. A method for separation of phosphatidylcholine, triacylglycerol, non-esterified fatty acids and cholesterol esters from plasma by solid-phase extraction. BrJ Nutr. 2000;84(5):781–7. [PubMed] [Google Scholar]
  • 18.Hoile SP, Irvine NA, Kelsall CJ, Sibbons C, Feunteun A, Collister A, et al. Maternal fat intake in rats alters 20:4n-6 and 22:6n-3 status and the epigenetic regulation of Fads2 in offspring liver. The Journal of nutritional biochemistry. 2012 doi: 10.1016/j.jnutbio.2012.09.005. Epub 2012/10/31. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Van Pelt CK, Brenna JT. Acetonitrile chemical ionization tandem mass spectrometry to locate double bonds in polyunsaturated fatty acid methyl esters. Analytical chemistry. 1999;71(10):1981–9. doi: 10.1021/ac981387f. Epub 1999/06/11. [DOI] [PubMed] [Google Scholar]
  • 20.Devlin AM, Singh R, Wade RE, Innis SM, Bottiglieri T, Lentz SR. Hypermethylation of Fads2 and altered hepatic fatty acid and phospholipid metabolism in mice with hyperhomocysteinemia. J Biol Chem. 2007;282(51):37082–90. doi: 10.1074/jbc.M704256200. [DOI] [PubMed] [Google Scholar]
  • 21.Kelsall CJ, Hoile SP, Irvine NA, Masoodi M, Torrens C, Lillycrop KA, et al. Vascular dysfunction induced in offspring by maternal dietary fat involves altered arterial polyunsaturated Fatty Acid biosynthesis. PLoS One. 2012;7(4):e34492. doi: 10.1371/journal.pone.0034492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Niculescu MD, Lupu DS, Craciunescu CN. Perinatal manipulation of alpha-linolenic acid intake induces epigenetic changes in maternal and offspring livers. FASEB J. 2013;27(1):350–8. doi: 10.1096/fj.12-210724. Epub 2012/09/22. [DOI] [PubMed] [Google Scholar]
  • 23.Tsiatis AC, Norris-Kirby A, Rich RG, Hafez MJ, Gocke CD, Eshleman JR, et al. Comparison of Sanger sequencing, pyrosequencing, and melting curve analysis for the detection of KRAS mutations: diagnostic and clinical implications. The Journal of molecular diagnostics: JMD. 2010;12(4):425–32. doi: 10.2353/jmoldx.2010.090188. Epub 2010/05/01. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Matsuoka A, Kizuka F, Lee L, Tamura I, Taniguchi K, Asada H, et al. Progesterone increases manganese superoxide dismutase expression via a cAMP-dependent signaling mediated by noncanonical Wnt5a pathway in human endometrial stromal cells. The Journal of clinical endocrinology and metabolism. 2010;95(11):E291–9. doi: 10.1210/jc.2010-0619. Epub 2010/08/06. [DOI] [PubMed] [Google Scholar]
  • 25.Lu CC, Tsai SC. The cyclic AMP-dependent protein kinase A pathway is involved in progesterone effects on calcitonin secretion from TT cells. Life Sci. 2007;81(19–20):1411–20. doi: 10.1016/j.lfs.2007.08.046. Epub 2007/10/30. [DOI] [PubMed] [Google Scholar]
  • 26.Antony N, Weir JR, McDougall AR, Mantamadiotis T, Meikle PJ, Cole TJ, et al. cAMP response element binding protein1 is essential for activation of steroyl co-enzyme a desaturase 1 (Scd1) in mouse lung type II epithelial cells. PLoS One. 2013;8(4):e59763. doi: 10.1371/journal.pone.0059763. Epub 2013/05/03. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Lee ST, Xiao Y, Muench MO, Xiao J, Fomin ME, Wiencke JK, et al. A global DNA methylation and gene expression analysis of early human B-cell development reveals a demethylation signature and transcription factor network. Nucleic Acids Res. 2012;40(22):11339–51. doi: 10.1093/nar/gks957. Epub 2012/10/18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Fabelo N, Martin V, Gonzalez C, Alonso A, Diaz M. Effects of oestradiol on brain lipid class and Fatty Acid composition: comparison between pregnant and ovariectomised oestradiol-treated rats. Journal of neuroendocrinology. 2012;24(2):292–309. doi: 10.1111/j.1365-2826.2011.02242.x. Epub 2011/10/20. [DOI] [PubMed] [Google Scholar]
  • 29.Oscarsson J, Eden S. Sex differences in fatty acid composition of rat liver phosphatidylcholine are regulated by the plasma pattern of growth hormone. BiochimBiophysActa. 1988;959(3):280–7. doi: 10.1016/0005-2760(88)90201-9. [DOI] [PubMed] [Google Scholar]
  • 30.Ottosson UB, Lagrelius A, Rosing U, von SB. Relative fatty acid composition of lecithin during postmenopausal replacement therapy--a comparison between ethinyl estradiol and estradiol valerate. GynecolObstetInvest. 1984;18(6):296–302. doi: 10.1159/000299096. [DOI] [PubMed] [Google Scholar]
  • 31.Ballare C, Uhrig M, Bechtold T, Sancho E, Di Domenico M, Migliaccio A, et al. Two domains of the progesterone receptor interact with the estrogen receptor and are required for progesterone activation of the c-Src/Erk pathway in mammalian cells. Mol Cell Biol. 2003;23(6):1994–2008. doi: 10.1128/MCB.23.6.1994-2008.2003. Epub 2003/03/04. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Vicent GP, Ballare C, Zaurin R, Saragueta P, Beato M. Chromatin remodeling and control of cell proliferation by progestins via cross talk of progesterone receptor with the estrogen receptors and kinase signaling pathways. Annals of the New York Academy of Sciences. 2006;1089:59–72. doi: 10.1196/annals.1386.025. Epub 2007/01/31. [DOI] [PubMed] [Google Scholar]

RESOURCES