Skip to main content
Human Molecular Genetics logoLink to Human Molecular Genetics
. 2014 Jan 31;23(12):3307–3315. doi: 10.1093/hmg/ddu044

IFT27, encoding a small GTPase component of IFT particles, is mutated in a consanguineous family with Bardet–Biedl syndrome

Mohammed A Aldahmesh 1,†, Yuanyuan Li 3,†, Amal Alhashem 5,9,‡, Shams Anazi 1,‡, Hisham Alkuraya 6, Mais Hashem 1, Ali A Awaji 7, Sameera Sogaty 11, Abdullah Alkharashi 8, Saeed Alzahrani 12, Selwa A Al Hazzaa 2,10, Yong Xiong 4, Shanshan Kong 3, Zhaoxia Sun 3,*, Fowzan S Alkuraya 1,9,*
PMCID: PMC4047285  PMID: 24488770

Abstract

Bardet–Biedl syndrome (BBS) is an autosomal recessive ciliopathy with multisystem involvement. So far, 18 BBS genes have been identified and the majority of them are essential for the function of BBSome, a protein complex involved in transporting membrane proteins into and from cilia. Yet defects in the identified genes cannot account for all the BBS cases. The genetic heterogeneity of this disease poses significant challenge to the identification of additional BBS genes. In this study, we coupled human genetics with functional validation in zebrafish and identified IFT27 as a novel BBS gene (BBS19). This is the first time an intraflagellar transport (IFT) gene is implicated in the pathogenesis of BBS, highlighting the genetic complexity of this disease.

INTRODUCTION

The cilium is a microtubule-based, membrane-bound organelle that protrudes from most post-mitotic eukaryotic cells. In the past decade, accumulating evidence supports the crucial role of this miniature organelle as a signaling antenna for the vertebrate cell, and ciliary defects have been linked to an increasing list of human diseases collectively referred to as ciliopathies (1,2).

Bardet–Biedl syndrome (BBS) is one of the better-studied ciliopathies (3,4). It is a rare autosomal recessive disorder characterized by multisystem involvement, including the eye (a specific pattern of retinal degeneration known as retinitis pigmentosa), the limb (polydactyly) and the kidney (polycystic kidneys), all of which can be explained by ciliary defects (2,5). Other major manifestations include obesity, intellectual disability and hypogenitalism, although their link to impaired cilium is less clear (5). BBS is genetically heterogeneous. So far, 18 genes have been identified (3,6–23).

Despite the identification of 18 BBS genes, evidence supports the existence of unidentified BBS genes (24). We previously searched for novel BBS disease genes in 29 families but found that they all harbor mutations in known genes (25,26). In this study, we extend our analysis to nine new families. In one of these families, all the known BBS genes were excluded. We further performed whole-exome sequencing (WES) coupled with functional validation in zebrafish to search for the novel BBS gene in this family. Unexpectedly, we identified an intraflagellar transport (IFT) gene, IFT27, as a novel BBS gene (BBS19). IFT gene encodes components of IFT particles that are essential for cilia biogenesis and maintenance (27–29). Although IFT genes are intimately associated with ciliary functions, our work is the first to link an IFT gene to BBS.

RESULTS

Autozygome-guided mutation analysis defines causal BBS mutations

Nine previously undescribed multiplex families met the clinical definition of BBS and were enrolled in this study. The consanguineous nature of all nine families made it possible to use autozygosity as a signpost of the likely disease gene because it is highly likely that the causal mutation will reside in an ancestral allele that has been rendered autozygous along with its surrounding ancestral haplotype (30). Therefore, we used the shared autozygome for each family to guide the mutation analysis of the BBS genes as described earlier (25,26). This approach allowed us to identify the causal mutation in eight of the nine families and, consistent with our previous work, genetic heterogeneity was evident. Table 1 summarizes the clinical and molecular findings in these cases.

Table 1.

Summary of the clinical and molecular findings in the study cohort

Patient ID Gender Obesity ID Renal RP Polydactyly Deafness Anosmia Atopy BBS facies CHD Fatty liver Hypogenitalism Gene Mutation Reference
BBS_DG1a F Y Y CKD Y N N N Y N ? ? amenorrhea BBS10 (NM_024685.3) c.1736A>G (p.K579R) (22)
BBS_DG1b M Y Y N Y Y Y N Y Y hypoplastic LV ? Y BBS10 (NM_024685.3) c.1736A>G (p.K579R) (22)
BBS_DG2a M Y Y CKD Y Y N N N Y N N Y BBS12 (NM_152618.2) c.2041_2049del (Leu682_Leu684del) This study
BBS_DG2b M Y Y CKD Y Y N N N Y N N Y BBS12 (NM_152618.2) c.2041_2049del (Leu682_Leu684del) This study
BBS_DG3a M Y Y N Y Y N N N Y N N N BBS12 (NM_152618.2) c.787dupT (p.Tyr263LeufsX4) This study
BBS_DG3b F Y Y N Y N N N N Y N N N BBS12 (NM_152618.2) c.787dupT (p.Tyr263LeufsX4) This study
BBS_DG3c F Y Y N Y Y N N N Y N N N BBS12 (NM_152618.2) c.787dupT (p.Tyr263LeufsX4) This study
BBS_DG3d M Y Y N Y N N N N Y N N N BBS12 (NM_152618.2) c.787dupT (p.Tyr263LeufsX4) This study
BBS_DG4a M Y Y N Y Y Y N N Y ? N Y BBS1 (NM_024649.4) c.951+58C4T; r.951_ 952ins951+1_951+58 p.(G318Vfs*62) (26)
BBS_DG4b F Y Y ? Y Y N N N Y ? N N BBS1 (NM_024649.4) c.951+58C4T; r.951_952ins951+1_951+58 p.(G318Vfs*62) (26)
BBS_DG5a F Y Y hydronephrosis Y Y N N N Y N Y N BBS5 (NM_152384.2) c.966dup (p.Ala323Cysfs*57) This study
BBS_DG5b F Y Y renal hypoplasia Y Y N Y N Y N ? N BBS5 (NM_152384.2) c.966dup (p.Ala323Cysfs*57) This study
BBS_DG5c F Y Y N Y Y N N Y Y N Y N BBS5 (NM_152384.2) c.966dup (p.Ala323Cysfs*57) This study
BBS_DG5d F Y Y hydronephrosis Y N N N Y Y N Y N BBS5 (NM_152384.2) c.966dup (p.Ala323Cysfs*57) This study
BBS_DG6a F Y Y CKD Y Y N N Y Y N N N BBS7 (NM_176824.2) c.602-2A>T (26)
BBS_DG6b F Y Y N Y Y N N N Y N N N BBS7 (NM_176824.2) c.602-2A>T (26)
BBS_DG7a F Y Y renal hypoplasia Y Y N Y Y Y N Y N IFT27 (NM_006860.4) c.296G>A:p.(Cys99Tyr) This study
BBS_DG7b M Y Y N Y Y Y Y Y Y ? Y Y IFT27 (NM_006860.4) c.296G>A:p.(Cys99Tyr) This study
BBS_DG8a F Y Y N Y Y N N Y Y VSD N N MKKS (NM_018848.3) c.1646T>C (p.Leu549Pro) This study
BBS_DG8b M Y Y CKD Y Y N N Y Y ASD N Y MKKS (NM_018848.3) c.1646T>C (p.Leu549Pro) This study
BBS_DG8c M Y Y CKD Y Y N N Y Y PDA N Y MKKS (NM_018848.3) c.1646T>C (p.Leu549Pro) This study
BBS_DG9a M Y Y N Y Y N N N Y N N Y MKKS (NM_018848.3)  c.116C>T (p.P39L) (26)
BBS_DG9b M Y Y N Y Y N N N Y N N Y MKKS (NM_018848.3 c.116C>T (p.P39L) (26)

CHD, congenital heart disease; CKD, chronic kidney disease; LV, left ventricle; VSD, ventricular septal defect; ASD, atrial septal defect; PDA, patent ductus arteriosus; N, no; Y, yes; ?, no data.

Identification of a BBS family with a novel BBS gene

Family BBS DG_7 is a consanguineous Saudi family that consists of healthy first cousin parents and two children with BBS as well as three healthy children (Fig. 1). The older of the two affected siblings is a 15-year-old boy with morbid obesity, mild intellectual disability, polydactyly of all extremities, borderline renal failure and retinitis pigmentosa. In addition, he has typical facies, fatty liver, hyposmia, atopy and hypogenitalism. His 14-year-old sister is very similar in that she has morbid obesity (s/p sleeve gastrectomy), polydactyly of three limbs, end-stage renal failure requiring dialysis and retinitis pigmentosa (Fig. 1). She also has typical facies, fatty liver, hyposmia and severe atopy. Thus, the diagnosis of classical BBS is confirmed on clinical grounds. The shared autozygome of the two siblings overlapped with two known BBS loci: BBS7 and BBS12. However, sequencing at the genomic and RNA level revealed no variants, suggesting that a novel BBS gene may be involved in the pathogenesis of their disease. Supplementary Material, Table S1 lists the cDNA primers used to exclude splicing mutations in BBS7 and BBS12 that may have been missed at the genomic level.

Figure 1.

Figure 1.

Identification of a BBS family that maps to a novel locus. Pedigree of the family showing the consanguineous nature and the presence of two affected children (upper panel). The genotypes for the IFT27 mutation are shown for each member. Representative images of polydactyly (lower left panel) and the fundus changes (lower right panel) (fundus picture of the right eye showing attenuated retinal vessels, pale optic disc, macular atrophy and diffuse RPE changes) are shown. The family did not consent to show facial photos.

Whole-exome sequencing identifies a novel mutation in IFT27

In order to identify the causal mutation in Family BBS DG_7, WES was pursued in the index. Close examination of all known BBS genes identified no pathogenic changes. We then filtered the total 71 670 variants to identify homozygous coding/splicing variants (excluding synonymous changes) that are present within the shared autozygome of the two siblings, but absent in the Exome Variant Server and in 357 Saudi in-house exomes as described earlier (31,32). This approach eliminated all but one variant in IFT27 [NM_006860.4; c.296G>A:p.(Cys99Tyr)] (Fig. 2). The affected residue is highly conserved, and the variant is predicted to be pathogenic by in silico analysis (PolyPhen 1.0, SIFT 0.0) (Fig. 2). In addition, we carried out homology modeling of the human IFT27 structure using the crystal structure of the homologous Chlamydomonas reinhardtii IFT27 as a template (33). The result showed that amino acid C99 of human IFT27 appears to be located in the core of the molecule and can potentially engage in stabilizing interactions to highly conserved Leu residues nearby (Fig. 3A). The C99Y mutation would result in a much larger side chain (Cys to Tyr) that may cause steric clashes with the conserved leucine side chains (Fig. 3B), potentially causing destabilization of the protein structure.

Figure 2.

Figure 2.

WES identifies IFT27 as a novel BBS locus. Upper panel shows the workflow of iterative filtering of WES variants. Note that the only variant that remains after filtering is the variant in IFT27, and its sequence chromatogram is shown along with the normal control for comparison. The middle panel shows a carton of the protein structure. The lower panel shows multi-species alignment to highlight the strong conservation of the affected residue.

Figure 3.

Figure 3.

3D rendering of homology modeled IFT27 structure. C99 is located in the core of the molecule and can potentially engage in stabilizing interactions to highly conserved Leu residues nearby (A). The C99Y mutation would result in a much larger side chain (Cys to Tyr) that may cause steric clashes with the conserved leucine side chains (B), potentially causing destabilization of the protein structure.

IFT27 C99Y is a loss-of-function allele

To provide conclusive evidence that C99Y is a pathogenic allele, we exploited a zebrafish model that we have previously published (34). The zebrafish Ift27 protein is highly conserved with its human counterpart with 54% identical residues. Importantly, the C99 residue in human (C100 in zebrafish) is also conserved (Fig. 2). We therefore constructed an expression vector of the zebrafish ift27 C100Y. Zebrafish embryos co-injected with the established morpholino oligo against ift27 and control eGFP mRNA display typical ciliopathy phenotypes. Specifically, 58.3% morphants (knockdown animal generated by morpholino injection) showed laterality defects, 52.3% with ventral body curvature and 36.1% with cystic kidneys (Fig. 4). Consistent with the previous study, co-injection of ift27-eGFP mRNA rescued the morphants significantly, with 18.9% of the injected embryos showing laterality defects, 15.5% with curvature and 13.3% with cystic kidney (Fig. 5). In contrast, co-injection of ift27C100Y-eGFP mRNA failed to rescue any of the phenotypes. Combined, these results demonstrate that this is an allele with severely reduced activity, if not a complete loss-of-function allele.

Figure 4.

Figure 4.

Phenotypes of ift27 morphants. (A–C) Laterality as shown by heart position at 1 dpf. Embryos are shown in ventral views. L: left sided; M: middle; R: right sides. (D) An embryo injected with a control morpholino against ift27 with mismatched bases (C MO) at 3 dpf. (E) An ift27 morphant (ift27 MO) at 3 dpf. (F and G) Enlarged view of boxed regions in D and E, respectively. Red arrow points to a kidney cyst.

Figure 5.

Figure 5.

C100Y is a loss-of-function allele. (A–C) Group pictures of 4 dpf embryos co-injected with ift27 MO and GFP mRNA (A, GFP), ift27 MO and ift27 GFP mRNA (B, ift27 GFP) and ift27 MO and ift27 C100Y GFP mRNA (C, C100Y GFP); (D–F) Graphs showing the efficacy of ift27 GFP or ift27 C100Y GFP in rescuing laterality defects (D, combined percentage of middle and right-sided heart), body curvature (E) and kidney cysts (F) observed in ift27 morphants from three independent experiments. Error bars show standard deviation. *P < 0.05; **P < 0.01.

We monitored the expression of the wild-type and C100Y Ift27 by inspecting eGFP signals in injected embryos and noticed that embryos injected with ift27C100Y-eGFP mRNA show reduced GFP signal (Fig. 6A). To validate this result, we injected two independent batches of mRNA encoding the wild-type and the mutant Ift27 into wild-type embryos, extracted protein and performed western analysis. Results show that the level of the mutant protein is significantly reduced compared with the wild-type (Fig. 6B), suggesting that the C100Y substitution reduces the stability of Ift27, consistent with prediction from 3D modeling.

Figure 6.

Figure 6.

C100Y substitution affects the stability of Ift27. (A) GFP signal in 7.5-h post-fertilization embryos injected with ift27 GFP (WT) or ift27 C100Y GFP (C100Y) mRNA. (B) Western blot showing the level of Ift27-GFP (WT) or Ift27 C100Y GFP (C100Y) in whole embryo lysates. Embryos were injected with two independent batches of mRNAs. Tubulin was used as a loading control.

It was shown previously that in multiple zebrafish BBS models, the morphogenesis of the Kupffer's vesicle (KV), a ciliated organ essential for the establishment of left–right asymmetry, and the retrograde transport of melanosomes are defective (35,36). To investigate whether ift27 is involved in these processes, we first inspected KV morphology in ift27 morphants and found no significant difference (Fig. 7A and B). We further examined the retrograde transport of melanosomes by subjecting morphants to epinephrine treatment. Interestingly, the melanosome aggregation response is significantly delayed in ift27 morphants (Fig. 7C and D), suggesting that Ift27 may play a role in vesicle transport outside of cilia.

Figure 7.

Figure 7.

ift27 is dispensable for KV morphogenesis but is involved in the retrograde transport of melanosomes in response to epinephrine. (A) Morphology of KV. (B). Statistical analysis of KV diameter in control morphants (n = 10) and ift27 morphants (n = 12). (C). Embryos with and without epinephrine treatment showing the morphology of melanocytes. (D) Statistical analysis of response time in seconds to epinephrine treatment in control (n = 10) and ift27 morphants (n = 13). Scale bar in A: 20 μm. CMO: embryos injected with a control morpholino with mismatched bases; MO, ift27 morphant; epi, epinephrine treatment; **P = 0.0014.

DISCUSSION

Seminal biochemical characterization of proteins encoded by BBS genes revealed that seven BBS proteins (encoded by BBS1, 2, 4, 5, 7, 8 and 9) form the core of a protein complex, named as BBSome, essential for trafficking membrane proteins, such as the G-protein-coupled receptor Somastatin receptor 3, into and from cilia (4,37–39). In addition, Arl6, encoded by BBS3, is required for targeting BBSomes to the cilium (37), and BBIP1, encoded by BBS18, is a component of BBSome and is required for BBSome assembly (20,40). Combined, these results suggest that defective BBSome could be the underlying and unifying mechanism for BBS.

Unexpectedly, in this study, we identified IFT27 as a novel BBS gene. IFT27 encodes a component of the IFT-B complex required for anterograde transport of ciliary proteins. Although IFT proteins are among the first and best studied groups of proteins involved in ciliary functions, so far human mutations in IFT genes have been limited in their phenotypic consequences to skeletal ciliopathies (41–48). There are documented interactions between IFT complexes and BBSomes. In Caenorhabditis elegans, BBS proteins bridges IFT-A and B complexes (49,50). Perhaps most relevant, in Chlamydomonas, the BBSome is a cargo of IFT (39). Interestingly, IFT27 protein shows several unique features as compared with other IFT proteins. It is a small GTPase that bears strong resemblance to Rab8 and Rab11 (33) and forms a subcomplex with IFT25 (51). Unlike most IFT proteins, both IFT25 and IFT27 are not conserved in C. elegans and Drosophila Melanogaster (52,53), suggesting a more specialized role in IFT. Moreover, IFT25, the binding partner of IFT27, while dispensable for ciliogenesis, is required for proper Hedgehog signaling (52), resembling multiple BBS proteins (54). Combined with these results, our finding that IFT27 is involved in BBS raises the interesting possibility that this small GTPase may link the BBSome cargo to the IFT machinery.

Although the genetic heterogeneity of BBS has not been fully appreciated, previous work suggests that any novel BBS gene will likely explain only a small percentage of patients (25). This is supported by the last few described BBS genes (BBS15, 17 and 18) that were all based on single families or sometimes single patients (10,14,20). Similarly, we show that only one of nine families in this study can be explained by mutations in IFT27. If we combine this cohort with our previously cohort of 29 families (25), the contribution of IFT27 is <3% in Saudi BBS families. Although the contribution of IFT27 mutations to the BBS mutation pool in outbred populations is unknown, we suspect it will be similarly small and in line with some of the recently described BBS genes that to date have not been identified beyond the original families/cases in which they were identified. Nonetheless, the identification of rare novel BBS genes is significant as it provides useful insights into cilia biology and ciliopathies in general, and the molecular pathogenesis of BBS in particular.

In summary, we identify IFT27 as a novel BBS disease gene using positional mapping, WES and functional confirmation in the zebrafish model. This is the first time an IFT protein is implicated in the pathogenesis of BBS.

MATERIALS AND METHODS

Human subjects

Patients were diagnosed with BBS accordingly to established criteria that take into account the number of major and minor clinical manifestations (5). All patients and relevant family members were recruited using an IRB-approved protocol with informed consent. Venous blood was collected in EDTA tubes and, when required, in PAXGene for DNA and RNA extraction, respectively.

Autozygome determination and candidate gene analysis

Determination of the entire set of autozygous intervals per individual (autozygome) was essentially as described earlier (30). Briefly, genome-wide genotyping on the Axiom platform was performed following the manufacturer's instructions. This was followed by determination of runs of homozygosity as surrogates of autozygosity using the software autoSNPa (55). The list of 18 known BBS disease genes was examined across the coordinates of the shared autozygome of affected individuals to determine which gene to amplify and sequence (56). PCR primers and conditions are available upon request.

Whole-exome sequencing

Standard whole-exome sequencing was performed using TruSeq Exome Enrichment kit (Illumina) followed by preparation of an Illumina sequencing library, with enrichment for the desired target using the Illumina Exome Enrichment protocol. The captured libraries were sequenced using IlluminaHiSeq 2000 Sequencer. The reads were mapped against UCSC hg19 by BWA. The SNPs and Indels were detected by SAMTOOLS.

In silico modeling

Homology modeling of human IFT27 was carried out using both the program Modeller and the automated modeling server I-TASSER, which has been ranked as the best server in the recent Critical Assessment of Techniques for Protein Structure Prediction modeling contests (57–59). Modeling by Modeller is carried out in the following steps. Prior to the modeling, the sequence of human IFT27 was aligned with that of Chlamydomonas reinhardtii IFT27, whose crystal structure has been determined (PDBID: 2YC2) (33). Subsequently, the aligned sequences were input into Modeller for homology modeling using the Chlamydomonas IFT27 crystal structure as the template using the built-in functionality of Modeller. Confidence in the homology modeling is imparted by (i) the high degree of sequence homology between human and Chlamydomonas IFT27 molecules (∼37% identity and ∼54% similarity), and (ii) the similarity of the resulting models produced by Modeller and I-TASSER. The resulting model is reliable especially for regions around residue C99, which is surrounded by highly conserved Leu residues in IFT27 proteins.

Zebrafish husbandry

Zebrafish was maintained according to standard protocols (60). Eggs were obtained through natural spawning.

Knockdown, phenotype analysis and rescue experiments in zebrafish

A previously published morpholino oligo (5′ GGAGGTAATAGTGTGTGTCTACGTG 3′) against the translational initiation site of ift27 (34) was used to knockdown the expression of ift27. A morpholino with five mispaired bases (5′ GGAcGTAATAcTGTcTGTgTACcTG 3′, lower cases and underlined) was used as a control morpholino. The ift27 C100Y GFP construct was obtained by site-directed mutagenesis based on the ift27 GFP plasmid (34). ift27 GFP or ift27 C100Y GFP mRNA was synthesized in vitro using the mMESSAGE mMACHINE kit (Ambion, AM1340).

For the rescue assay, 150 pg of ift27 GFP mRNA or ift27 C100Y GFP mRNA was co-injected with 2 ng of ift27 morpholino into one-cell-stage embryos. Embryos were observed for laterality defects based on heart position on 1 dpf (day post-fertilization), for body curvature on 2 dpf, and for pronephric cysts on 3–4 dpf.

To inspect the morphology of the KV, live embryos at around the 14-somite stage were mounted in 3% methylcellulose, imaged using differential interference contrast microscopy, and the diameter was measured in Photoshop. The efficacy of morpholino was confirmed by inspecting the same batch of injected embryos for the body curvature phenotype at 1 dpf.

The melanosome transport assay was performed using a previously published protocol (35) with minor modifications. Specifically, 2 dpf embryos were subjected to 3.75 mm epinephrine in embryo medium and inspected under a dissecting scope. The responding time of each embryo was recorded.

Protein extraction and western blotting

Embryos were deyolked in PBS containing a protease inhibitor cocktail (Roche, REF11836170001) and homogenized in Tris lysis buffer (50 mm Tris–HCl pH 8.0, 150 mm NaCl, 0.5% NP40, 0.1 mm DTT) containing the protease inhibitor cocktail. Proteins were denatured in SDS sample buffer at 100°C for 7 min and cleared by centrifugation at 12 000 g for 3 min. For western blotting, mouse anti-GFP IgG (Roche) and mouse anti-tubulin (Molecular Probes, A11126) were used at 1:1000 as primary antibodies. Horseradish peroxidase-conjugated secondary antibodies (Jackson Immuno-Research) were used at 1:2000. Membranes were subjected to enhanced chemiluminescence detection using the Western Lighting plus ECL kit (Perkin-Elmer Life Sciences).

Statistical analysis

P-values were obtained through Student's t-test using Microsoft Excel.

SUPPLEMENTARY MATERIAL

Supplementary Material is available at HMG online.

FUNDING

This work was supported by Dubai-Harvard Foundation for Medical Research Collaborative Research Grant (to F.S.A.), R01 DK092808 from National Institute of Health and a research grant RSG-10-247-01-DDC from American Cancer Society (to Z.S.) and the animal core of the Center for Polycystic Kidney Disease research at Yale (DK090744).

Supplementary Material

Supplementary Data

ACKNOWLEDGEMENTS

We thank N. Semanchik for maintenance of our fish facility, Shiaulou Yuan for his advice on KV analysis and the Genotyping and Sequencing Core Facilities at KFSHRC for their technical help.

Conflict of Interest statement. None declared.

REFERENCES

  • 1.Goetz S.C., Ocbina P.J., Anderson K.V. The primary cilium as a Hedgehog signal transduction machine. Methods Cell. Biol. 2009;94:199–222. doi: 10.1016/S0091-679X(08)94010-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Hildebrandt F., Benzing T., Katsanis N. Ciliopathies. N. Engl. J. Med. 2011;364:1533–1543. doi: 10.1056/NEJMra1010172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ansley S.J., Badano J.L., Blacque O.E., Hill J., Hoskins B.E., Leitch C.C., Kim J.C., Ross A.J., Eichers E.R., Teslovich T.M., et al. Basal body dysfunction is a likely cause of pleiotropic Bardet-Biedl syndrome. Nature. 2003;425:628–633. doi: 10.1038/nature02030. [DOI] [PubMed] [Google Scholar]
  • 4.Nachury M.V., Loktev A.V., Zhang Q., Westlake C.J., Peranen J., Merdes A., Slusarski D.C., Scheller R.H., Bazan J.F., Sheffield V.C., et al. A core complex of BBS proteins cooperates with the GTPase Rab8 to promote ciliary membrane biogenesis. Cell. 2007;129:1201–1213. doi: 10.1016/j.cell.2007.03.053. [DOI] [PubMed] [Google Scholar]
  • 5.Forsythe E., Beales P.L. Bardet-Biedl syndrome. Eur. J. Hum. Genet. 2013;21:8–13. doi: 10.1038/ejhg.2012.115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Badano J.L., Ansley S.J., Leitch C.C., Lewis R.A., Lupski J.R., Katsanis N. Identification of a novel Bardet-Biedl syndrome protein, BBS7, that shares structural features with BBS1 and BBS2. Am. J. Hum. Genet. 2003;72:650–658. doi: 10.1086/368204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Chiang A.P., Beck J.S., Yen H.J., Tayeh M.K., Scheetz T.E., Swiderski R.E., Nishimura D.Y., Braun T.A., Kim K.Y., Huang J., et al. Homozygosity mapping with SNP arrays identifies TRIM32, an E3 ubiquitin ligase, as a Bardet-Biedl syndrome gene (BBS11) Proc. Natl. Acad. Sci. USA. 2006;103:6287–6292. doi: 10.1073/pnas.0600158103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Chiang A.P., Nishimura D., Searby C., Elbedour K., Carmi R., Ferguson A.L., Secrist J., Braun T., Casavant T., Stone E.M., et al. Comparative genomic analysis identifies an ADP-ribosylation factor-like gene as the cause of Bardet-Biedl syndrome (BBS3) Am. J. Hum. Genet. 2004;75:475–484. doi: 10.1086/423903. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Katsanis N., Beales P.L., Woods M.O., Lewis R.A., Green J.S., Parfrey P.S., Ansley S.J., Davidson W.S., Lupski J.R. Mutations in MKKS cause obesity, retinal dystrophy and renal malformations associated with Bardet-Biedl syndrome. Nat. Genet. 2000;26:67–70. doi: 10.1038/79201. [DOI] [PubMed] [Google Scholar]
  • 10.Kim S.K., Shindo A., Park T.J., Oh E.C., Ghosh S., Gray R.S., Lewis R.A., Johnson C.A., Attie-Bittach T., Katsanis N., et al. Planar cell polarity acts through septins to control collective cell movement and ciliogenesis. Science. 2010;329:1337–1340. doi: 10.1126/science.1191184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Laurier V., Stoetzel C., Muller J., Thibault C., Corbani S., Jalkh N., Salem N., Chouery E., Poch O., Licaire S., et al. Pitfalls of homozygosity mapping: an extended consanguineous Bardet-Biedl syndrome family with two mutant genes (BBS2, BBS10), three mutations, but no triallelism. Eur. J. Hum. Genet. 2006;14:1195–1203. doi: 10.1038/sj.ejhg.5201688. [DOI] [PubMed] [Google Scholar]
  • 12.Leitch C.C., Zaghloul N.A., Davis E.E., Stoetzel C., Diaz-Font A., Rix S., Alfadhel M., Lewis R.A., Eyaid W., Banin E., et al. Hypomorphic mutations in syndromic encephalocele genes are associated with Bardet-Biedl syndrome. Nat. Genet. 2008;40:443–448. doi: 10.1038/ng.97. [DOI] [PubMed] [Google Scholar]
  • 13.Li J.B., Gerdes J.M., Haycraft C.J., Fan Y., Teslovich T.M., May-Simera H., Li H., Blacque O.E., Li L., Leitch C.C., et al. Comparative genomics identifies a flagellar and basal body proteome that includes the BBS5 human disease gene. Cell. 2004;117:541–552. doi: 10.1016/s0092-8674(04)00450-7. [DOI] [PubMed] [Google Scholar]
  • 14.Marion V., Stutzmann F., Gerard M., De Melo C., Schaefer E., Claussmann A., Helle S., Delague V., Souied E., Barrey C., et al. Exome sequencing identifies mutations in LZTFL1, a BBSome and smoothened trafficking regulator, in a family with Bardet--Biedl syndrome with situs inversus and insertional polydactyly. J. Med. Genet. 2012;49:317–321. doi: 10.1136/jmedgenet-2012-100737. [DOI] [PubMed] [Google Scholar]
  • 15.Mykytyn K., Braun T., Carmi R., Haider N.B., Searby C.C., Shastri M., Beck G., Wright A.F., Iannaccone A., Elbedour K., et al. Identification of the gene that, when mutated, causes the human obesity syndrome BBS4. Nat. Genet. 2001;28:188–191. doi: 10.1038/88925. [DOI] [PubMed] [Google Scholar]
  • 16.Mykytyn K., Nishimura D.Y., Searby C.C., Shastri M., Yen H.J., Beck J.S., Braun T., Streb L.M., Cornier A.S., Cox G.F., et al. Identification of the gene (BBS1) most commonly involved in Bardet-Biedl syndrome, a complex human obesity syndrome. Nat. Genet. 2002;31:435–438. doi: 10.1038/ng935. [DOI] [PubMed] [Google Scholar]
  • 17.Nishimura D.Y., Searby C.C., Carmi R., Elbedour K., Van Maldergem L., Fulton A.B., Lam B.L., Powell B.R., Swiderski R.E., Bugge K.E., et al. Positional cloning of a novel gene on chromosome 16q causing Bardet-Biedl syndrome (BBS2) Hum. Mol. Genet. 2001;10:865–874. doi: 10.1093/hmg/10.8.865. [DOI] [PubMed] [Google Scholar]
  • 18.Nishimura D.Y., Swiderski R.E., Searby C.C., Berg E.M., Ferguson A.L., Hennekam R., Merin S., Weleber R.G., Biesecker L.G., Stone E.M., et al. Comparative genomics and gene expression analysis identifies BBS9, a new Bardet-Biedl syndrome gene. Am. J. Hum. Genet. 2005;77:1021–1033. doi: 10.1086/498323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Schaefer E., Zaloszyc A., Lauer J., Durand M., Stutzmann F., Perdomo-Trujillo Y., Redin C., Bennouna Greene V., Toutain A., Perrin L., et al. Mutations in SDCCAG8/NPHP10 cause Bardet-Biedl syndrome and are associated with penetrant renal disease and absent polydactyly. Mol. Syndromol. 2011;1:273–281. doi: 10.1159/000331268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Scheidecker S., Etard C., Pierce N.W., Geoffroy V., Schaefer E., Muller J., Chennen K., Flori E., Pelletier V., Poch O., et al. Exome sequencing of Bardet-Biedl syndrome patient identifies a null mutation in the BBSome subunit BBIP1 (BBS18) J. Med. Genet. 2014;51:132–136. doi: 10.1136/jmedgenet-2013-101785. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Slavotinek A.M., Stone E.M., Mykytyn K., Heckenlively J.R., Green J.S., Heon E., Musarella M.A., Parfrey P.S., Sheffield V.C., Biesecker L.G. Mutations in MKKS cause Bardet-Biedl syndrome. Nat. Genet. 2000;26:15–16. doi: 10.1038/79116. [DOI] [PubMed] [Google Scholar]
  • 22.Stoetzel C., Laurier V., Davis E.E., Muller J., Rix S., Badano J.L., Leitch C.C., Salem N., Chouery E., Corbani S., et al. BBS10 encodes a vertebrate-specific chaperonin-like protein and is a major BBS locus. Nat. Genet. 2006;38:521–524. doi: 10.1038/ng1771. [DOI] [PubMed] [Google Scholar]
  • 23.Stoetzel C., Muller J., Laurier V., Davis E.E., Zaghloul N.A., Vicaire S., Jacquelin C., Plewniak F., Leitch C.C., Sarda P., et al. Identification of a novel BBS gene (BBS12) highlights the major role of a vertebrate-specific branch of chaperonin-related proteins in Bardet-Biedl syndrome. Am. J. Hum. Genet. 2007;80:1–11. doi: 10.1086/510256. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Redin C., Le Gras S., Mhamdi O., Geoffroy V., Stoetzel C., Vincent M.C., Chiurazzi P., Lacombe D., Ouertani I., Petit F., et al. Targeted high-throughput sequencing for diagnosis of genetically heterogeneous diseases: efficient mutation detection in Bardet-Biedl and Alstrom syndromes. J. Med. Genet. 2012;49:502–512. doi: 10.1136/jmedgenet-2012-100875. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Abu-Safieh L., Al-Anazi S., Al-Abdi L., Hashem M., Alkuraya H., Alamr M., Sirelkhatim M.O., Al-Hassnan Z., Alkuraya B., Mohamed J.Y., et al. In search of triallelism in Bardet-Biedl syndrome. Eur. J. Hum. Genet. 2012;20:420–427. doi: 10.1038/ejhg.2011.205. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Abu Safieh L., Aldahmesh M.A., Shamseldin H., Hashem M., Shaheen R., Alkuraya H., Al Hazzaa S.A.F., Al-Rajhi A., Alkuraya F.S. Clinical and molecular characterisation of Bardet-Biedl syndrome in consanguineous populations: the power of homozygosity mapping. J. Med. Genet. 2010;47:236–241. doi: 10.1136/jmg.2009.070755. [DOI] [PubMed] [Google Scholar]
  • 27.Kozminski K.G., Johnson K.A., Forscher P., Rosenbaum J.L. A motility in the eukaryotic flagellum unrelated to flagellar beating. Proc. Natl. Acad. Sci. USA. 1993;90:5519–5523. doi: 10.1073/pnas.90.12.5519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Marshall W.F., Rosenbaum J.L. Intraflagellar transport balances continuous turnover of outer doublet microtubules: implications for flagellar length control. J. Cell. Biol. 2001;155:405–414. doi: 10.1083/jcb.200106141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Rosenbaum J., Witman G. Intraflagellar transport. Nat. Rev. Mol. Cell Biol. 2002;3:813–825. doi: 10.1038/nrm952. [DOI] [PubMed] [Google Scholar]
  • 30.Alkuraya F.S. Autozygome decoded. Genet. Med. 2010;12:765–771. doi: 10.1097/GIM.0b013e3181fbfcc4. [DOI] [PubMed] [Google Scholar]
  • 31.Alkuraya F.S. The application of next-generation sequencing in the autozygosity mapping of human recessive diseases. Hum. Genet. 2013;132:1197–1211. doi: 10.1007/s00439-013-1344-x. [DOI] [PubMed] [Google Scholar]
  • 32.Alkuraya F.S. Discovery of Rare Homozygous Mutations from Studies of Consanguineous Pedigrees. Current Protocols Human Genetics; 2012. Chapter 6, Unit6.12. [DOI] [PubMed] [Google Scholar]
  • 33.Bhogaraju S., Taschner M., Morawetz M., Basquin C., Lorentzen E. Crystal structure of the intraflagellar transport complex 25/27. EMBO. J. 2011;30:1907–1918. doi: 10.1038/emboj.2011.110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Li J., Sun Z. Qilin is essential for cilia assembly and normal kidney development in zebrafish. PLoS. One. 2011;6:e27365. doi: 10.1371/journal.pone.0027365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Tayeh M.K., Yen H.J., Beck J.S., Searby C.C., Westfall T.A., Griesbach H., Sheffield V.C., Slusarski D.C. Genetic interaction between Bardet-Biedl syndrome genes and implications for limb patterning. Hum. Mol. Genet. 2008;17:1956–1967. doi: 10.1093/hmg/ddn093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Yen H.J., Tayeh M.K., Mullins R.F., Stone E.M., Sheffield V.C., Slusarski D.C. Bardet-Biedl syndrome genes are important in retrograde intracellular trafficking and Kupffer's vesicle cilia function. Hum. Mol. Genet. 2006;15:667–677. doi: 10.1093/hmg/ddi468. [DOI] [PubMed] [Google Scholar]
  • 37.Jin H., White S.R., Shida T., Schulz S., Aguiar M., Gygi S.P., Bazan J.F., Nachury M.V. The conserved Bardet-Biedl syndrome proteins assemble a coat that traffics membrane proteins to cilia. Cell. 2010;141:1208–1219. doi: 10.1016/j.cell.2010.05.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Lechtreck K.F., Brown J.M., Sampaio J.L., Craft J.M., Shevchenko A., Evans J.E., Witman G.B. Cycling of the signaling protein phospholipase D through cilia requires the BBSome only for the export phase. J. Cell. Biol. 2013;201:249–261. doi: 10.1083/jcb.201207139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Lechtreck K.F., Johnson E.C., Sakai T., Cochran D., Ballif B.A., Rush J., Pazour G.J., Ikebe M., Witman G.B. The Chlamydomonas reinhardtii BBSome is an IFT cargo required for export of specific signaling proteins from flagella. J. Cell. Biol. 2009;187:1117–1132. doi: 10.1083/jcb.200909183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Loktev A.V., Zhang Q., Beck J.S., Searby C.C., Scheetz T.E., Bazan J.F., Slusarski D.C., Sheffield V.C., Jackson P.K., Nachury M.V. A BBSome subunit links ciliogenesis, microtubule stability, and acetylation. Dev. Cell. 2008;15:854–865. doi: 10.1016/j.devcel.2008.11.001. [DOI] [PubMed] [Google Scholar]
  • 41.Arts H.H., Bongers E.M., Mans D.A., van Beersum S.E., Oud M.M., Bolat E., Spruijt L., Cornelissen E.A., Schuurs-Hoeijmakers J.H., de Leeuw N., et al. C14ORF179 encoding IFT43 is mutated in Sensenbrenner syndrome. J. Med. Genet. 2011;48:390–395. doi: 10.1136/jmg.2011.088864. [DOI] [PubMed] [Google Scholar]
  • 42.Halbritter J., Bizet A.A., Schmidts M., Porath J.D., Braun D.A., Gee H.Y., McInerney-Leo A.M., Krug P., Filhol E., Davis E.E., et al. Defects in the IFT-B component IFT172 cause Jeune and Mainzer-Saldino syndromes in humans. Am. J. Hum. Genet. 2013;93:915–925. doi: 10.1016/j.ajhg.2013.09.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Walczak-Sztulpa J., Eggenschwiler J., Osborn D., Brown D.A., Emma F., Klingenberg C., Hennekam R.C., Torre G., Garshasbi M., Tzschach A., et al. Cranioectodermal dysplasia, sensenbrenner syndrome, is a ciliopathy caused by mutations in the IFT122 gene. Am. J. Hum. Genet. 2010;86:949–956. doi: 10.1016/j.ajhg.2010.04.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Gilissen C., Arts H.H., Hoischen A., Spruijt L., Mans D.A., Arts P., van Lier B., Steehouwer M., van Reeuwijk J., Kant S.G., et al. Exome sequencing identifies WDR35 variants involved in Sensenbrenner syndrome. Am. J. Hum. Genet. 2010;87:418–423. doi: 10.1016/j.ajhg.2010.08.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Bredrup C., Saunier S., Oud M.M., Fiskerstrand T., Hoischen A., Brackman D., Leh S.M., Midtbo M., Filhol E., Bole-Feysot C., et al. Ciliopathies with skeletal anomalies and renal insufficiency due to mutations in the IFT-A gene WDR19. Am. J. Hum. Genet. 2011;89:634–643. doi: 10.1016/j.ajhg.2011.10.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Davis E.E., Zhang Q., Liu Q., Diplas B.H., Davey L.M., Hartley J., Stoetzel C., Szymanska K., Ramaswami G., Logan C.V., et al. TTC21B contributes both causal and modifying alleles across the ciliopathy spectrum. Nat. Genet. 2011;43:189–196. doi: 10.1038/ng.756. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Perrault I., Saunier S., Hanein S., Filhol E., Bizet A.A., Collins F., Salih M.A., Gerber S., Delphin N., Bigot K., et al. Mainzer-Saldino syndrome is a ciliopathy caused by IFT140 mutations. Am. J. Hum. Genet. 2012;90:864–870. doi: 10.1016/j.ajhg.2012.03.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Dagoneau N., Goulet M., Genevieve D., Sznajer Y., Martinovic J., Smithson S., Huber C., Baujat G., Flori E., Tecco L., et al. DYNC2H1 mutations cause asphyxiating thoracic dystrophy and short rib-polydactyly syndrome, type III. Am. J. Hum. Genet. 2009;84:706–711. doi: 10.1016/j.ajhg.2009.04.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Wei Q., Zhang Y., Li Y., Zhang Q., Ling K., Hu J. The BBSome controls IFT assembly and turnaround in cilia. Nat. Cell. Biol. 2012;14:950–957. doi: 10.1038/ncb2560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Ou G., Blacque O.E., Snow J.J., Leroux M.R., Scholey J.M. Functional coordination of intraflagellar transport motors. Nature. 2005;436:583–587. doi: 10.1038/nature03818. [DOI] [PubMed] [Google Scholar]
  • 51.Wang Z., Fan Z.C., Williamson S.M., Qin H. Intraflagellar transport (IFT) protein IFT25 is a phosphoprotein component of IFT complex B and physically interacts with IFT27 in chlamydomonas. PLoS. One. 2009;4:e5384. doi: 10.1371/journal.pone.0005384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Keady B.T., Samtani R., Tobita K., Tsuchya M., San Agustin J.T., Follit J.A., Jonassen J.A., Subramanian R., Lo C.W., Pazour G.J. IFT25 links the signal-dependent movement of Hedgehog components to intraflagellar transport. Dev. Cell. 2012;22:940–951. doi: 10.1016/j.devcel.2012.04.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Lechtreck K.F., Luro S., Awata J., Witman G.B. HA-tagging of putative flagellar proteins in Chlamydomonas reinhardtii identifies a novel protein of intraflagellar transport complex B. Cell Motil. Cytoskeleton. 2009;66:469–482. doi: 10.1002/cm.20369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Zhang Q., Seo S., Bugge K., Stone E.M., Sheffield V.C. BBS proteins interact genetically with the IFT pathway to influence SHH-related phenotypes. Hum. Mol. Genet. 2012;21:1945–1953. doi: 10.1093/hmg/dds004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Carr I.M., Flintoff K.J., Taylor G.R., Markham A.F., Bonthron D.T. Interactive visual analysis of SNP data for rapid autozygosity mapping in consanguineous families. Hum. Mutat. 2006;27:1041–1046. doi: 10.1002/humu.20383. [DOI] [PubMed] [Google Scholar]
  • 56.Alkuraya F.S. Homozygosity mapping: one more tool in the clinical geneticist's toolbox. Genet. Med. 2010;12:236–239. doi: 10.1097/GIM.0b013e3181ceb95d. [DOI] [PubMed] [Google Scholar]
  • 57.Sali A., Blundell T.L. Comparative protein modelling by satisfaction of spatial restraints. J. Mol. Biol. 1993;234:779–815. doi: 10.1006/jmbi.1993.1626. [DOI] [PubMed] [Google Scholar]
  • 58.Zhang Y. I-TASSER server for protein 3D structure prediction. BMC Bioinformatics. 2008;9:40. doi: 10.1186/1471-2105-9-40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Battey J.N., Kopp J., Bordoli L., Read R.J., Clarke N.D., Schwede T. Automated server predictions in CASP7. Proteins. 2007;69(Suppl 8):68–82. doi: 10.1002/prot.21761. [DOI] [PubMed] [Google Scholar]
  • 60.Westerfield M. The Zebrafish Book: A Guide for the Laboratory use of Zebrafish (Danio Rerio) University of Oregon Press; 2000. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Data

Articles from Human Molecular Genetics are provided here courtesy of Oxford University Press

RESOURCES