Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Jun 6.
Published in final edited form as: J Immunol. 2009 Jul 27;183(4):2529–2536. doi: 10.4049/jimmunol.0801406

SCID Dogs: Similar Transplant Potential but Distinct Intra-Uterine Growth Defects and Premature Replicative Senescence Compared with SCID Mice1

Katheryn Meek *,2, Ari Jutkowitz , Lisa Allen , Jillian Glover *, Erin Convery *, Alisha Massa *, Tom Mullaney *, Bryden Stanley , Diana Rosenstein , Susan M Bailey , Cheri Johnson , George Georges §
PMCID: PMC4047667  NIHMSID: NIHMS581320  PMID: 19635917

Abstract

We have previously described DNA-dependent protein kinase (DNA-PKcs) mutations in horses and dogs that result in deficits in V(D)J recombination, DNA repair, and SCID. In this paper, we document substantial developmental growth defects in DNA-PKcs-deficient dogs that are not apparent in SCID mice. Fibroblast cell strains derived from either fetal or adult SCID dogs proliferate poorly in culture and undergo premature replicative senescence, somewhat reminiscent of cells derived from Ku-deficient mice. A limited number of animals have been immune reconstituted (by bone marrow transplantation) so that they can be maintained in a normal environment for long periods. Several of these animals have developed conditions associated with premature ageing at 2–3 years of age, roughly 20% of their expected lifespan. These conditions include intestinal malabsorption and primary neural cell neoplasia. These results suggest that DNA-PKcs deficiency is not tolerated equally in all species, perhaps providing insight into why DNA-PKcs deficiency has not been observed in humans. Finally, this study demonstrates the feasibility of maintaining SCID dogs for extended periods of time and documents their utility for bone marrow transplantation studies and as hosts for the propagation of xenografts. In sum, SCID dogs may present researchers with new possibilities for the development of animal models of human disease.


Autosomal recessive forms of SCID have been described in mice, horses, and humans. In mice, horses, and some children, it has been shown that SCID is the consequence of arrested B and T lymphocyte development that is explained by defective V(D)J recombination, the site specific recombination process that provides for assembly of unique Ag receptor genes in immature lymphocytes (1). In both SCID horses and SCID mice, the defective factor has been shown to be the catalytic subunit of the DNA-dependent protein kinase, catalytic subunit (DNA-PKcs3; Refs. 2, 3), a ubiquitously expressed DNA repair factor that is requisite for the more general process of nonhomologous DNA end joining (NHEJ). Components of this DNA repair pathway resolve the dsDNA breaks that occur adjacent to rearranging Ig and TCR gene segments during V(D)J recombination in developing lymphocytes (4, 5). Recently, SCID in Jack Russell terriers has been described (68). The molecular basis of this immunodeficiency is also faulty V(D)J recombination that can be explained by a point mutation within DNA-PKcs (6).

It is curious that all three forms of SCID in animals that result from VDJ recombination deficits are the result of DNA-PKcs mutations, whereas, until recently (see below), none of the thousands of cases of SCID in children are explained by DNA-PKcs deficiency. It has been shown that human cells do not tolerate Ku deficiency (the regulatory subunit of DNA-PK) as well as rodent cells (9, 10). This has led some to speculate that DNA-PKcs deficiency may result in embryonic lethality in humans. During revision of this manuscript, a hypomorphic DNA-PKcs mutation was reported in a human SCID patient (11). Interestingly, although this DNA-PKcs mutation impaired end joining (resulting in SCID-like coding joints), the mutant maintained full enzymatic activity and end binding; cells expressing the mutant displayed fairly modest radiosensitivity. The authors also posited that complete DNA-PK deficiency is likely incompatible with human life.

In this paper, we show that DNA-PKcs-deficient dogs display significant intrauterine growth retardation. This has not been reported in mice with mutations in DNA-PKcs. Additionally, unlike cells from SCID mice, primary cell strains derived from SCID dogs display proliferative defects. These data suggest that all species do not tolerate DNA-PKcs deficiency equally.

Finally, SCID mice have had an enormous impact on our understanding of lymphocyte development, V(D)J recombination, immunodeficiency, bone marrow transplantation, DNA repair, and genomic instability (12). SCID mice have also had a significant impact in research disciplines that use these animals as hosts for allogeneic and xenogeneic tissue grafts (1318). Here, we demonstrate that SCID dogs may be similarly useful.

Materials and Methods

Animals

SCID dogs used in this study were raised at the Michigan State University, College of Veterinary Medicine vivarium (East Lansing, MI) in accordance with the U.S. Department of Agriculture and National Institutes of Health guidelines for animal use and care. SCID puppies were produced by mating known SCID carriers (as assessed by PCR genotyping) or by mating bone marrow-transplanted SCID-affected animals. All dogs were examined at least twice daily. Heterozygous animals were maintained in the general canine animal facility in the College of Veterinary Medicine at Michigan State University (East Lansing, MI); litters were whelped in the same facility. Potential exposure of litters with SCID puppies to canine pathogens or opportunistic organisms by animal care workers or by contact with other dogs within the facility was minimized by the following precautions: whelping rooms were completely sanitized before parturition, workers wore disposable outer garments and gloves, SCID puppies used for bone marrow transplantation studies remained in the isolated whelping room until transplantation, and SCID puppies used in xenograft studies remained housed in the isolated whelping room throughout the course of the experiment. In previous studies (6, 7), it was reported that SCID puppies that obtain normal levels of maternal Ab are easily maintained under these housing conditions without ill effect until maternal Ab levels begin to decline at 8 –10 wk of age. Thus, every effort was made to ensure that all puppies nursed adequately within the first 24 h of birth to obtain maximal levels of maternal Ab.

Bone marrow transplantation and posttransplantation immunosuppression

SCID-affected puppies were infused with dog leukocyte Ag (DLA)-matched bone marrow (~0.5 × 109 nucleated cells/kg). Donor marrow was collected by aspiration from both humeri of anesthetized donor animals directly into sodium citrate and heparin. The marrow was filtered through an 18-μ filter and infused i.v. into recipient animals. All recipients were given 10 mg/kg mycophenolate mofetil, for 28 days, twice a day, starting on the day of transplant. Cyclosporine (supplemental Table I)4 was administered for 37 days, twice a day, starting 2 days before transplantation. In some cases, partial marrow ablation was accomplished by i.v. administration of cyclophosphamide (40 mg/kg) 1 day before transplantation (supplemental Table I).

Oligonucleotides

Oligonucleotides used in this study include the following. Oligonucleotides used for DNA-PKcs genotyping: 5′ canine mutation, GGCAAAAAACCCTGTTAATAAAAAA and 3′ canine mutation, ACCTGAATAAACCTCCTTCTG. Oligonucleotides used to analyze bone marrow chimerism: 5′ DNA-PKcs microsatellite, GTTAACACATGTCTGGTGCA; 3′ DNA-PKcs microsatellite, GTATTACCGTCTCAGGTAAC; 5′ MEF2A micro-satellite, CCCAAAAACAGATAGGCC; and 3′ MEF2A microsatellite, CCAACCAGGATTGAAAGG. Oligonucleotides used for DLA typing: 5′ DLA tetra repeat, GTTGAGTGGTTGCCTTTAGC; 3′ DLA tetra repeat, CAGGATCTTCATATGTCACC; and Telomere probe, TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG.

DNA-PKcs genotyping and DLA typing

Genomic DNA was prepared from peripheral blood leukocytes using DNAzol (Invitrogen). DNA-PKcs genotyping was done as described previously (6). Briefly, the point mutation within the canine SCID allele generates a de novo restriction endonuclease (MseI) site. To screen for the mutation, a 117 bp fragment spanning the mutation was amplified, restricted with MseI, and analyzed by gel electrophoresis. DLA typing to identify DLA-matched bone marrow donors was assessed by PCR analyses of a polymorphic tetra repeat linked to the canine MHC class I using DNA from parents and siblings of SCID-affected puppies.

Assessment of engraftment bone marrow chimerism analyses

Genomic DNA was prepared from peripheral blood mononuclear fractions that were prepared using lympholyte-Mammal (Cedarlane Laboratories) according to the manufacturer’s recommendations. In some cases, genomic DNA was prepared from tissues obtained at necropsy. PCR amplifications of microsatellites within the DNA-PKcs gene or MEF2A that are polymorphic between donor and recipient were done using one 32-P labeled primer with an unlabeled second primer. Amplified fragments were analyzed by denaturing acrylamide electrophoresis. Quantification of products deriving from donor and recipient was determined by phosphorimaging.

To assess immune reconstitution, transplanted dogs were immunized 12–29 wk after transplantation with a canary-pox based recombinant canine distemper vaccine (Merial). Two or 6 weeks later, the Michigan State University, Diagnostic Center for Population & Animal Health, measured Ab titers to canine distemper Ags.

Cell culture, proliferation assays, and SA-β-galactosidase staining

Fibroblast cell strains were derived from s.c. tissues harvested from an adult SCID dog and age matched unaffected animal at the time of euthanasia. Fetal fibroblasts were derived from two different litters harvested at day 42 of gestation. Fibroblasts were cultured in DMEM with 10% FCS. Cell growth assays were performed by plating 1000 cells/well in 60 mm dishes. Duplicate samples were harvested and counted on days 2, 4, and 7 (litter 2) or days 3, 5, and 7 (litter 1). To assess SA-β-galactosidase activity, cells were plated in 60-mm dishes and stained 24 h later as described previously (19). For cell cycle analysis, identically cultured normal and SCID primary fibroblasts were ethanol fixed, stained with propidium iodide, and analyzed by flow cytometry using a BD Vantage SE turbo sort instrument with DIVA electronics and software.

Telomere analyses

Telomere fluorescence in situ hybridization analyses were performed on primary fibroblasts derived from adult SCID and normal dogs as described previously (20). Telomere length was ascertained by Southern hybridization of DNA prepared from identically cultured normal and SCID primary fibroblasts restricted with RsaI and HinfI and hybridized to a 42 bp telomeric probe. The mean mobility of hybridizing sequences was determined for each sample.

Tumor xenografting

Human ovarian tumor cells ES2 (American Type Culture Collection) were introduced subcutaneously at two different sites (3 × 107 or 107) in two SCID puppies and one normal littermate control. Human fibrosarcoma tumor cells (HT1080 cell line) were introduced subcutaneously at one site (107) in five SCID puppies. Tumor growth was monitored by caliper measurements. Animals harboring the ES2 tumors were necropsied on day 21 and histopathologic studies performed. Animals harboring the HT1080 tumors were necropsied on day 35 and histopathologic studies performed.

Results

DNA-PKcs-deficient dogs

This form of canine SCID was initially recognized because of unexplained mortality in Jack Russell terrier puppies immunized with modified live vaccines (8). Through subsequent breedings, it became clear that SCID dogs are uniquely susceptible to common canine viral pathogens encountered in most animal facilities. Previous studies have documented that this form of SCID is the result of a point mutation in the DNA-PKcs gene that results in a premature stop codon. Thus, T and B cell development is blocked because of faulty V(D)J recombination (6, 7).

Our first goal was to establish a breeding colony of SCID dogs that could be maintained for extended periods of time in general research animal facilities. We first bred the defective DNA-PKcs allele into laboratory beagles. This strategy was used because litters from the original SCID carriers (Jack Russell terriers) were generally small, and because numerous additional health issues were observed (potentially explained by extensive inbreeding of the animals). Offspring from these first breedings that were heterozygous for the mutant DNA-PKcs allele were maintained as the initial breeding colony and were not intentionally (except for DNA-PKcs genotype) further inbred. SCID in puppies resulting from carrier breedings occurred at a rate consistent with autosomal recessive inheritance (Table I).

Table I.

Low birth weights in DNA-PKcs-deficient dogs: summary of birth weights of SCID dogs and unaffected littermates

No. of Puppies/No. of Litters Non-SCID SCID
SCID+/− by SCID+/− 71/14 53 (74.6%) 18 (25.4%)
SCID+/− by SCID+/− 29/5 14 (48.3%) 15 (51.7%)
Birth weight (g) 245.4 177.2a (72.2%)
 Litters ≤ 6 puppies 262.7 216.4b (82.4%)
 Litters > 6 puppies 209.1 133.1c (63.7%)
Neonatal mortality 7/67 10/33
Adult weight (kg) 10.5 (10 animals) 9.8 (10 animals)
a

p < 0.00000015.

b

p < 0.00056.

c

p < 0.00003.

DLA-matched bone marrow transplantation reverses the immunodeficiency of SCID dogs

To facilitate establishment of a breeding colony, bone marrow transplantation studies were initiated with the goal of reversing the immunodeficiency in dogs affected with SCID. Efforts to optimize bone marrow transplantation are detailed in the supplemental material. Briefly, bone marrow transplantation was performed on 15 different animals with three different protocols (supplemental Table I). We found that a protocol including no pretreatment marrow ablation and a combination of cyclosporine (15 mg/kg three times a day) and mycophenolate mofetil promote successful immune reconstitution. Immune challenge documented reconstitution in 10 of 15 animals. Although dogs are the model of choice for many bone marrow transplantation studies, most studies use mature animals. We attribute the fairly low success rate (10 of 15 animals) to difficulties in establishing efficient and effective protocols for transplantation in very young puppies. However, the success of these transplants provided animals that could be maintained in standard animal facilities, and the success of the third transplantation protocol supports the feasibility of using these animals as models for bone marrow transplantation studies. The successfully transplanted animals were used in subsequent breedings so that larger numbers of SCID dogs were available for study.

To document immune reconstitution in transplanted SCID dogs, one of the animals with sustained donor engraftment was euthanized 38 wk posttransplantation. Gross examination on necropsy revealed lymph nodes of normal size and number. The thymus was involuted as would be expected in a two-year old animal. Histopathologic examination of lymph nodes (Fig. 1A, middle panel) and spleen (not shown) revealed normal architecture and cellularity as compared with a lymph node from an unaffected carrier (Fig. 1A, right panel). Lymph node cellularity is dramatically increased compared with a lymph node from a nontransplanted SCID puppy (Fig. 1A, left panel). Further, the level of CD3 staining was morphologically similar as well as similar in intensity in the lymph node from the transplanted animal as compared with the lymph node from the normal animal (Fig. 1B).

FIGURE 1.

FIGURE 1

Immune reconstitution in SCID dogs by DLA-matched marrow transplantation. A, Histopathologic examination of a lymph node (LN) from an unaffected dog (right panel), a SCID dog 90 wk after DLA-matched bone marrow transplantation (middle panel), or an untreated SCID dog (left panel). B, Lymph node sections from an unaffected dog and a SCID dog 90 wk after DLA-matched bone marrow transplantation were stained with Abs to canine CD3 as described previously (8). C, Chimerism analysis of DNA prepared from various tissues obtained at necropsy (as indicated) 90 wk after DLA-matched bone marrow transplantation. The donor was heterozygous for the SCID allele; thus, the percentage of chimerism was established (shown below each lane) by phosphorimaging of amplification products from the two alleles, correcting for the different amplification efficiency as established by amplification of DNA from the heterozygous donor. D, Chimerism analysis of DNA prepared from PBMC taken at indicated times post-bone marrow transplantation. In this case, the marrow donor was homozygous for wild-type DNA-PKcs. Chimerism was analyzed by the PCR to detect presence of the MseI resistant (wild type) allele.

DNA was prepared from a variety of tissues and used to determine donor chimerism in various tissues. As can be seen (Fig. 1C), donor cells comprise a large fraction of all lymphocytic tissues, but only a small fraction (i.e., from blood contamination) of other tissues. This PCR assesses a microsatellite within the DNA-PKcs gene. The donor animal is heterozygous for the two DNA-PKcs alleles and has both fragments. The recipient is homozygous for the slower migrating fragment. Although histological examination of lymphoid organs has not been undertaken in the other transplanted animals, donor chimerism was measured in PBMC from all transplanted animals maintained in the breeding colony. Donor chimerism from one animal is shown in Fig. 1D and is representative for all successfully transplanted animals. These data demonstrate stable engraftment over many months and document the feasibility of reversing the immunodeficiency in SCID dogs. Dogs are currently the animal model of choice for research focusing on developing better strategies for bone marrow transplantation; SCID dogs may provide researchers with a new tool for this effort. However, for the purpose of this study, immune reconstitution of this small number of animals allowed more complete characterization of the sequelae of DNA-PKcs deficiency in this species.

Intrauterine growth retardation in canine SCID embryos

Nineteen litters were included in this study. SCID in puppies resulting from carrier breedings occurred at a rate consistent with autosomal recessive inheritance (18 of 71 puppies, 25.4%; Table I). The rate of SCID in later breedings between carriers and bone marrow-transplanted homozygous SCID animals (15 of 29 puppies, 51.7%; Table I) was also consistent with autosomal recessive inheritance. Although neonatal-SCID puppies appear generally similar to their nonaffected littermates, SCID puppies are statistically smaller at birth (Table I). This is also associated with higher newborn mortality (10 of 33 SCID puppies vs 7 of 67 normal puppies). This was somewhat surprising because no birth weight differences had been noted in DNA-PKcs-deficient mice. The difference in birth weight as well as newborn mortality was exacerbated in large litters (greater than six puppies). Although there are fewer animals to compare (it was not feasible to maintain large numbers of normal and affected dogs to maturity), SCID-affected animals whose immunodeficiency was reversed by bone marrow transplantation appear similar in size to their unaffected littermates, suggesting that DNA-PKcs deficiency in dogs does not impart an absolute growth deficiency as has been observed in Ku-deficient mice (21). SCID puppies catch up with their normal siblings after birth, and adult immune-reconstituted SCID dogs in our breeding colony have similar birth weights as heterozygous carriers (the small difference is not statistically different, Table I). We conclude that although growth impaired, DNA-PKcs-deficient dogs eventually reach normal size. Perhaps it is not surprising that body weight differences are most apparent during fetal and early newborn development when growth rates are highest.

Except for their small size, canine SCID embryos have no developmental defects

To further investigate the intrauterine growth retardation, canine embryos were harvested by complete ovariohysterectomy from three pregnancies (SCID by SCID+/−, one at day 34 and two at day 42 of gestation). In all three litters, a significant size difference in SCID vs non-SCID embryos was observed (Fig. 2A). The exacerbation of intrauterine growth retardation in large litters (greater than six puppies) might suggest poor competition of SCID placentas with wild-type placentas. Although SCID placentas were also smaller than wild-type placentas, no gross or histopathologic abnormalities were observed in the placentas (not shown).

FIGURE 2.

FIGURE 2

Intrauterine growth retardation in SCID puppies. A, Canine fetuses were harvested at 42 days of gestation. B, Genotyping was performed as described in Materials and Methods. Fetuses 2, 3, and 4 are homozygous for the SCID mutation.

In mice, apoptosis of postmitotic neurons in developing embryos is a hallmark of Ku, XRCC4, and DNA ligase IV deficiency (2224). DNA-PKcs deficiency is not associated (2224) or is minimally associated with apoptosis in developing neurons (25, 26). It has been suggested that the severity of neuronal apoptosis directly correlates with the severity of signal end resolution during VDJ recombination (24). Because our previous studies showed that both SCID horses and SCID dogs display a much more significant signal end-joining deficit than do SCID mice, we considered that SCID dogs might also have defects in neuronal development. Thus, histopathologic analyses of embryonic brains from day 34 and 42 were performed. There was no evidence of increased apoptosis either by H&E staining or by TUNEL analyses (data not shown).

Canine SCID fibroblasts proliferate poorly and senesce prematurely

Mouse embryonic fibroblasts from Ku-deficient mice, which display both intrauterine and postnatal growth retardation, replicate poorly in culture. Canine fetal fibroblast cultures were derived from two different litters, both harvested at 42 days of gestation. Standard growth assays were performed on fetal cell strains from six SCID embryos and five normal embryos (heterozygous for the DNA-PKcs mutation). Embryonic SCID fibroblasts have consistently slower proliferation rates than embryonic fibroblasts derived from normal littermates (Fig. 3A). Fibroblast cell strains were also derived from one adult SCID dog and one unaffected, age-matched control. Similar to embryonic fibroblasts, adult SCID fibroblasts proliferate poorly compared with cells derived from the normal animal (not shown).

FIGURE 3.

FIGURE 3

Canine SCID fibroblasts replicate poorly and undergo premature replicative senescence. A, Fetal fibroblasts were derived from s.c. tissues of fetuses from two litters. Litter 1 included two normal and three SCID fetuses. Litter 2 contained three normal and three SCID fetuses. Cell growth curves were performed on each group of cell strains. Data is presented as average of fold increase in cell number for SCID and normal fibroblasts from each litter. Error bars represent SEM. B, Fetal fibroblasts were plated and stained with SA-β-galactosidase. Percentage of SA-β-galactosidase positive cells in fibroblast cell strains was derived from litter 1. Percentage is the average of two experiments performed after 4 and 5 wk of culturing the five cell strains. (FP1–5 denotes individual fetal puppies).

Because most normal cells do not express telomerase, the enzyme responsible for synthesizing telomeric DNA that cap chromosomal ends, most normal, untransformed cells have a well-defined replicative life span associated with the continued loss of telomeres, explaining why normal cells undergo replicative senescence after continuous culture. Cultured senescent cells express a pH-sensitive, β-galactosidase activity (SA-β galactosidase; Ref. 19), and this assay has become an accepted marker to assess cellular senescence. Fetal-derived cell strains that had been cultured for one month were stained for SA-β galactosidase (Fig. 3B). As can be seen, significantly higher numbers of SA-β galactosidase positive cells are present in the three SCID fetal cell strains as compared with cells derived from the normal littermates. Further, the number of SA-β galactosidase positive cells increased with increasing time in culture (not shown). Similar results were obtained with cells derived from the second litter studied and from the adult fibroblast cell strains. Although the difference between SA-β galactosidase positive cells may not completely explain the observed proliferative defect, we conclude that cultured fibroblasts derived from canine SCID dogs senesce more rapidly than cells derived from normal dogs. We suggest that intrauterine growth retardation may at least partially be the result of a defect in the proliferative capacity of embryonic SCID fibroblasts.

Cell cycle analysis was performed by flow cytometry of propidium iodine-stained cells. Two SCID primary fibroblast cultures (dividing slowly in culture) and one normal primary fibroblast culture (dividing more rapidly) were analyzed. Propidium iodine staining of all three cultures was similar and consistent with cell cycle distribution for primary cultures (high G1 content, data not shown). Although we could not ascertain whether canine SCID fibroblasts senesce at a particular stage in the cell cycle, it is known that cells in replicative senescence have a late G1, early S phase DNA content.

Canine SCID fibroblasts have only modest defects in telomere maintenance

It is well appreciated that DNA-PK deficiency results in telomere uncapping in both human and mouse systems (9, 2729). Telomere status in cultured canine SCID and normal fibroblasts was assessed by Southern hybridization. Hybridization of DNA (restricted with frequent cutting endonucleases) with a telomeric-specific probe revealed telomeric sequences with slightly faster mobility in DNA derived from SCID cells compared with normal controls suggestive of modest telomeric shortening (Fig. 4). Consistent with these observations, evaluation of metaphase spreads from a dog with SCID using telomere fluorescence in situ hybridization revealed the presence of spontaneous chromosomal rearrangements, specifically telomere fusions, reflective of loss of structure/end-capping function (not shown). Human cells that lack DNA-PKcs display dramatic telomeric shortening (29). Although the differences observed here are modest in comparison, these data are consistent with DNA-PK’s well-accepted role in telomeric maintenance. However, other explanations for the observed premature cellular senescence must be considered. In fact, recent publications provide evidence that DNA-PK may contribute to other prosurvival pathways (30, 31).

FIGURE 4.

FIGURE 4

Defective telomere maintenance in SCID fibroblasts. DNA from both SCID and normal fetal and adult fibroblasts restricted with RsaI and HinFI was subjected to Southern hybridization using a probe specific for telomeric repeats. Average telomeric length in each sample was determined by measuring the mean mobility of hybridizing sequences.

Young adult SCID dogs develop conditions associated with premature ageing

To date, 10 animals have been successfully immune reconstituted. Currently, these animals range in age from 26 to 46 mo. The average life span of dogs of this type (Beagle × Jack Russell terrier) is ~15 years. Three of the four oldest animals developed conditions not directly associated with SCID that required euthanasia. Two animals developed chronic malabsorption/wasting syndromes consistent with observations of aged SCID mice (32). In one case, the malabsorption syndrome was exacerbated by exocrine pancreatic insufficiency that was only partially responsive to replacement treatment. Histopathologic analyses (Fig. 5A) revealed a virtual lack of pancreatic acinar cells (strongly eosinophilic staining) while maintaining normal islets (the predominate cell type in the atrophied pancreas). This finding is particularly intriguing given emerging work from Kim and colleagues who have reported particular sensitivity of pancreatic acinar cells to apoptosis when DNA-PK is inhibited (3336).

FIGURE 5.

FIGURE 5

Incidental observations in SCID dogs consistent with a premature ageing phenotype. A, H&E staining of a normal (left) and atrophic (right) pancreas from a SCID dog. B, H&E staining of spinal cord tumor consistent with primary meningiosarcoma.

Finally, one of the 10 animals developed a primary tumor of the spinal chord. The tumor was poorly differentiated and remarkably anaplastic (Fig. 5B), vimentin positive, s-100 negative, and glial fibrillary acidic protein negative. This staining pattern is most consistent with a meningiosarcoma; however, in dogs a significant fraction of poorly differentiated neuroectodermal tumors do not express glial fibrillary acidic protein. Although dogs have a high incidence of many neoplasms, primary neuronal cell tumors are not common, especially in young animals. In mice, the nonhomologous end-joining pathway has been shown to be particularly important for developing neurons and in adult animals for suppression of primary medulloblastomas (37). Thus, occurrence of a primary spinal cord neoplasm in this DNA-PKcs-deficient animal is consistent with a role for the NHEJ pathway in suppression neuronal tumorigenesis. Because of the small numbers of animals studied, these findings must be considered incidental. These findings are consistent with previous reports (32) and with current hypotheses put forth that propose NHEJ factors as suppressors of ageing (38, 39).

Tumor xenografts grow rapidly in SCID dogs

SCID mice have significantly impacted research disciplines that use these animals as hosts for xenogeneic tissue grafts (1017). To determine whether SCID dogs can serve as hosts for tumor xenografts, human ovarian tumor cells (ES-2 cells) were introduced subcutaneously at two different sites (3 × 107 or 107) in two SCID puppies and one normal littermate control. As expected, no tumor cell growth could be detected in the normal puppy. In contrast, easily palpable tumor nodules developed within 10 days in both SCID dogs at both injection sites. These tumor nodules increased in size dramatically over 21 days (Fig. 6A). Gross necropsy revealed local tumor infiltration at both injection sites in both animals. Furthermore, both animals had numerous, multifocal pulmonary nodules in all lung lobes that were readily apparent on gross examination (Fig. 6B) and that were consistent with pulmonary metastasis on histopathologic analysis (Fig. 6C).

FIGURE 6.

FIGURE 6

Human tumor xenografts proliferate rapidly in SCID dogs. A, Growth of human tumor ovarian cell line, ES-2 injected s.c. at two sites in two SCID dogs and one normal dog. Tumors were measured and tumor volume in each dog was summed. B, Massive pulmonary metastasis of ES-2 cells is apparent at necropsy. C, Histopathologic examination of ES-2 pulmonary metastasis.

As in SCID dogs, the ES human ovarian carcinoma cell line is an extremely aggressive tumor when grown in nude mice. Tumors in mice generally develop within 3 weeks. We next tested a less aggressive human tumor xenograft, the fibrosarcoma HT1080. When grown in mice, HT1080 tumors generally develop within 6 weeks. Six SCID puppies were injected subcutaneously with 107 tumor cells. Over the course of the experiment (6 wk) five of six puppies developed readily palpable tumors (supplemental Fig. 1) that were histologically consistent with a locally invasive fibro-sarcoma. As in nude mice, no evidence of metastatic disease was apparent on gross necropsy in dogs harboring HT1080 tumors. These data demonstrate that SCID dogs can serve as hosts for human tumor xenografts.

Discussion

It is quite curious that although spontaneous DNA-PKcs mutations have been observed in three different nonprimate species, no DNA-PKcs mutations have been observed in humans until recently. As noted above, during revision of this manuscript, van der Burg et al. described a hypomorphic DNA-PKcs mutation in a SCID patient (11). This mutant retained full enzymatic and end-binding activity and imparts a relatively modest effect on radio-sensitivity. Thus, we speculate that DNA-PKcs deficiency may result in embryonic lethality in humans.

A long-standing question in this field is why primate cells express such high levels of DNA-PK. Primate cells express ~50 times more DNA-PK activity than rodent cells (40). The other NHEJ factors are not so highly expressed in human cells. The high levels of DNA-PK in human cells are somewhat paradoxical in that this does not impart any increased ability to repair DNA damage. Previously, we have shown that although canine cells express much less DNA-PK than human cells, dog cells express significantly more than mouse cells (7). Further, unlike SCID mice, SCID puppies display significant intrauterine growth retardation and are 30% smaller at birth than their normal littermates. Cells derived from SCID dogs have proliferation defects and undergo premature senescence compared with cells derived from unaffected animals (similar to mouse embryonic fibroblasts from Ku-deficient mice). These findings document that DNA-PKcs deficiency is not tolerated equally in all species. We suggest that, on an organism level, expressing more DNA-PK may be a reflection of a more stringent requirement for DNA-PK in a particular species, perhaps providing an explanation for the lack of DNA-PK-deficient people.

Although currently there is no clear explanation for the high expression levels of DNA-PK in primate cells, there are several strong candidates. First, it is well appreciated that telomere biology varies considerably between different mammalian species. Mice deficient in either Ku or DNA-PKcs (although viable) have been shown to have defects in telomere maintenance (27). Moreover, elegant studies from Hendrickson and colleagues demonstrate that even haplodeficiency of either Ku or DNA-PKcs result in marked telomere shortening and genomic instability in human cell lines (28, 29). Thus, one explanation for a more stringent requirement in human cells is that telomere maintenance relies more heavily on DNA-PK than in nonprimates. Another potential explanation for the high levels of DNA-PK in human cells might be found in DNA-PK’s ability to affect other repair pathways. It is well appreciated that DNA-PK deficiency results in an increased use of the other major dsDNA break-repair pathway, homologous recombination. We have shown recently that the phosphorylation status of DNA-PK can strongly affect (both positively and negatively) the ability of a cell to use the homologous recombination pathway (41). Moreover, in a given cell type, we have found that the ability of DNA-PK to inhibit homologous recombination is directly correlated to the abundance of DNA-PK (K. Meek, unpublished observations; Ref. 42). Thus, another explanation for high levels of DNA-PK might be a particularly stringent requirement to effectively regulate homologous recombination in human cells. In sum, it seems likely that high expression levels of DNA-PK in human cells is functionally linked to a more stringent requirement for DNA-PK for organismal viability. Understanding the mechanistic basis for this observation is the focus of ongoing research.

These studies also document the feasibility of maintaining a SCID dog colony. Although DNA-PK deficiency in dogs results in a phenotype consistent with premature ageing, these animals are still viable, relatively healthy, and have suitable life spans for use in biomedical research. SCID dogs may provide researchers a new tool to address outstanding questions in the field of bone marrow transplantation. We have established that SCID dogs can serve as hosts for human tumor xenografts and further experimentation is underway to determine whether these animals can also support normal skin xenografts as well as vascularized organ xenografts. There are obviously limitations to the use of any research animal. Although the small size and short lifespan of mice might be ideal for certain research applications, it could potentially be limiting for other applications. Though the added expense and longer maturity time of dog models would preclude the use of SCID dogs in many research applications, the development of this alternative model of SCID may still have important advantages for certain applications. It is our goal to make these animals widely available to develop relevant models of human disease.

Supplementary Material

meek supplemental data

Acknowledgments

We thank the staff of the Michigan State University vivarium and the University Containment facility, as well as the “Sponsor a Dog” program for their work in providing excellent animal care for the dogs used in this study. We especially thank the vivarium staff for their efforts in finding adoptive homes for the many unaffected puppies (not used in the study) produced from breedings of SCID carriers.

Footnotes

1

This work was supported by Public Health Service Grant RR016537 (K.M.).

3

Abbreviations used in this paper: DNA-PKcs, DNA-dependent protein kinase, catalytic subunit; DLA, dog leukocyte Ag; NHEJ, nonhomologous DNA end joining.

4

The online version of this article contains supplemental material.

Disclosures

The authors have no financial conflict of interest.

References

  • 1.Fischer A, Le Deist F, Hacein-Bey-Abina S, Andre-Schmutz I, de Basile SG, de Villartay JP, Cavazzana-Calvo M. Severe combined immunodeficiency: a model disease for molecular immunology and therapy. Immunol Rev. 2005;203:98–109. doi: 10.1111/j.0105-2896.2005.00223.x. [DOI] [PubMed] [Google Scholar]
  • 2.Shin EK, Perryman LE, Meek K. A kinase-negative mutation of DNA-PK(CS) in equine SCID results in defective coding and signal joint formation. J Immunol. 1997;158:3565–3569. [PubMed] [Google Scholar]
  • 3.Blunt T, Gell D, Fox M, Taccioli GE, Lehmann AR, Jackson SP, Jeggo PA. Identification of a nonsense mutation in the carboxyl-terminal region of DNA-dependent protein kinase catalytic subunit in the scid mouse. Proc Natl Acad Sci USA. 1996;93:10285–10290. doi: 10.1073/pnas.93.19.10285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Taccioli GE, Rathbun G, Oltz E, Stamato T, Jeggo PA, Alt FW. Impairment of V(D)J recombination in double-strand break repair mutants. Science. 1993;260:207–210. doi: 10.1126/science.8469973. [DOI] [PubMed] [Google Scholar]
  • 5.Pergola F, Zdzienicka MZ, Lieber MR. V(D)J recombination in mammalian cell mutants defective in DNA double-strand break repair. Mol Cell Biol. 1993;13:3464–3471. doi: 10.1128/mcb.13.6.3464-3471.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ding Q, Bramble L, Yuzbasiyan-Gurkan V, Bell T, Meek K. DNA-PKcs mutations in dogs and horses: allele frequency and association with neoplasia. Gene. 2002;283:263–269. doi: 10.1016/s0378-1119(01)00880-0. [DOI] [PubMed] [Google Scholar]
  • 7.Meek K, Kienker L, Dallas C, Wang W, Dark MJ, Venta PJ, Huie ML, Hirschhorn R, Bell T. SCID in Jack Russell terriers: a new animal model of DNA-PKcs deficiency. J Immunol. 2001;167:2142–2150. doi: 10.4049/jimmunol.167.4.2142. [DOI] [PubMed] [Google Scholar]
  • 8.Bell TG, Butler KL, Sill HB, Stickle JE, Ramos-Vara JA, Dark MJ. Autosomal recessive severe combined immunodeficiency of Jack Russell terriers. J Vet Diagn Invest. 2002;14:194–204. doi: 10.1177/104063870201400302. [DOI] [PubMed] [Google Scholar]
  • 9.Fattah KR, Ruis BL, Hendrickson EA. Mutations to Ku reveal differences in human somatic cell lines. DNA Repair (Amst) 2008;7:762–774. doi: 10.1016/j.dnarep.2008.02.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Ghosh G, Li G, Myung K, Hendrickson EA. The lethality of Ku86 (XRCC5) loss-of-function mutations in human cells is independent of p53 (TP53) Radiat Res. 2007;167:66–79. doi: 10.1667/RR0692.1. [DOI] [PubMed] [Google Scholar]
  • 11.van der Burg M, Ijspeert H, Verkaik NS, Turul T, Wiegant WW, Morotomi-Yano K, Mari PO, Tezcan I, Chen DJ, Zdzienicka MZ, van Dongen JJ, van Gent DC. A DNA-PKcs mutation in a radiosensitive T-B-SCID patient inhibits Artemis activation and nonhomologous end-joining. J Clin Invest. 2009;119:91–98. doi: 10.1172/JCI37141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Bosma MJ, Carroll AM. The SCID mouse mutant: definition, characterization, and potential uses. Annu Rev Immunol. 1991;9:323–350. doi: 10.1146/annurev.iy.09.040191.001543. [DOI] [PubMed] [Google Scholar]
  • 13.Aubard Y. Ovarian tissue xenografting. Eur J Obstet Gynecol Reprod Biol. 2003;108:14–18. doi: 10.1016/s0301-2115(02)00424-4. [DOI] [PubMed] [Google Scholar]
  • 14.Croy BA, Linder KE, Yager JA. Primer for non-immunologists on immune-deficient mice and their applications in research. Comp Med. 2001;51:300–313. [PubMed] [Google Scholar]
  • 15.Przyborski SA. Differentiation of human embryonic stem cells after transplantation in immune-deficient mice. Stem Cells. 2005;23:1242–1250. doi: 10.1634/stemcells.2005-0014. [DOI] [PubMed] [Google Scholar]
  • 16.Kneteman NM, Mercer DF. Mice with chimeric human livers: who says supermodels have to be tall? Hepatology. 2005;41:703–706. doi: 10.1002/hep.20681. [DOI] [PubMed] [Google Scholar]
  • 17.Meyerrose TE, Herrbrich P, Hess DA, Nolta JA. Immune-deficient mouse models for analysis of human stem cells. Biotechniques. 2003;35:1262–1272. doi: 10.2144/03356ss06. [DOI] [PubMed] [Google Scholar]
  • 18.Davis PH, Stanley SL., Jr Breaking the species barrier: use of SCID mouse-human chimeras for the study of human infectious diseases. Cell Microbiol. 2003;5:849–860. doi: 10.1046/j.1462-5822.2003.00321.x. [DOI] [PubMed] [Google Scholar]
  • 19.Dimri GP, Lee X, Basile G, Acosta M, Scott G, Roskelley C, Medrano EE, Linskens M, Rubelj I, Pereira-Smith O, et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci USA. 1995;92:9363–9367. doi: 10.1073/pnas.92.20.9363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Bailey SM, Brenneman MA, Halbrook J, Nickoloff JA, Ullrich RL, Goodwin EH. The kinase activity of DNA-PK is required to protect mammalian telomeres. DNA Repair (Amst) 2004;3:225–233. doi: 10.1016/j.dnarep.2003.10.013. [DOI] [PubMed] [Google Scholar]
  • 21.Gu Y, Seidl KJ, Rathbun GA, Zhu C, Manis JP, van der Stoep N, Davidson L, Cheng HL, Sekiguchi JM, Frank K, et al. Growth retardation and leaky SCID phenotype of Ku70-deficient mice. Immunity. 1997;7:653–665. doi: 10.1016/s1074-7613(00)80386-6. [DOI] [PubMed] [Google Scholar]
  • 22.Frank KM, Sekiguchi JM, Seidl KJ, Swat W, Rathbun GA, Cheng HL, Davidson L, Kangaloo L, Alt FW. Late embryonic lethality and impaired V(D)J recombination in mice lacking DNA ligase IV. Nature. 1998;396:173–177. doi: 10.1038/24172. [DOI] [PubMed] [Google Scholar]
  • 23.Gao Y, Sun Y, Frank KM, Dikkes P, Fujiwara Y, Seidl KJ, Sekiguchi JM, Rathbun GA, Swat W, Wang J, et al. A critical role for DNA end-joining proteins in both lymphogenesis and neurogenesis. Cell. 1998;95:891–902. doi: 10.1016/s0092-8674(00)81714-6. [DOI] [PubMed] [Google Scholar]
  • 24.Gu Y, Sekiguchi J, Gao Y, Dikkes P, Frank K, Ferguson D, Hasty P, Chun J, Alt FW. Defective embryonic neurogenesis in Ku-deficient but not DNA-dependent protein kinase catalytic subunit-deficient mice. Proc Natl Acad Sci USA. 2000;97:2668–2673. doi: 10.1073/pnas.97.6.2668. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Chechlacz M, Vemuri MC, Naegele JR. Role of DNA-dependent protein kinase in neuronal survival. J Neurochem. 2001;78:141–154. doi: 10.1046/j.1471-4159.2001.00380.x. [DOI] [PubMed] [Google Scholar]
  • 26.Vemuri MC, Schiller E, Naegele JR. Elevated DNA double strand breaks and apoptosis in the CNS of scid mutant mice. Cell Death Differ. 2001;8:245–255. doi: 10.1038/sj.cdd.4400806. [DOI] [PubMed] [Google Scholar]
  • 27.Bailey SM, Meyne J, Chen DJ, Kurimasa A, Li GC, Lehnert BE, Goodwin EH. DNA double-strand break repair proteins are required to cap the ends of mammalian chromosomes. Proc Natl Acad Sci USA. 1999;96:14899–14904. doi: 10.1073/pnas.96.26.14899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Myung K, Ghosh G, Fattah FJ, Li G, Kim H, Dutia A, Pak E, Smith S, Hendrickson EA. Regulation of telomere length and suppression of genomic instability in human somatic cells by Ku86. Mol Cell Biol. 2004;24:5050–5059. doi: 10.1128/MCB.24.11.5050-5059.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Ruis BL, Fattah KR, Hendrickson EA. The catalytic subunit of DNA-dependent protein kinase regulates proliferation, telomere length, and genomic stability in human somatic cells. Mol Cell Biol. 2008;28:6182–6195. doi: 10.1128/MCB.00355-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Bozulic L, Hemmings BA. PIKKing on PKB: regulation of PKB activity by phosphorylation. Curr Opin Cell Biol. 2009;21:256–261. doi: 10.1016/j.ceb.2009.02.002. [DOI] [PubMed] [Google Scholar]
  • 31.Stracker TH, Williams BR, Deriano L, Theunissen JW, Adelman CA, Roth DB, Petrini JH. Artemis and nonhomologous end joining-independent influence of DNA-dependent protein kinase catalytic subunit on chromosome stability. Mol Cell Biol. 2009;29:503–514. doi: 10.1128/MCB.01354-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Espejel S, Martin M, Klatt P, Martin-Caballero J, Flores JM, Blasco MA. Shorter telomeres, accelerated ageing and increased lymphoma in DNA-PKcs-deficient mice. EMBO Rep. 2004;5:503–509. doi: 10.1038/sj.embor.7400127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Kim H. DNA repair Ku proteins in gastric cancer cells and pancreatic acinar cells. Amino Acids. 2008;34:195–202. doi: 10.1007/s00726-006-0411-1. [DOI] [PubMed] [Google Scholar]
  • 34.Song JY, Lim JW, Kim H, Kim KH. Role of NF-κB and DNA repair protein Ku on apoptosis in pancreatic acinar cells. Ann NY Acad Sci. 2003;1010:259–263. doi: 10.1196/annals.1299.044. [DOI] [PubMed] [Google Scholar]
  • 35.Song JY, Lim JW, Kim H, Morio T, Kim KH. Oxidative stress induces nuclear loss of DNA repair proteins Ku70 and Ku80 and apoptosis in pancreatic acinar AR42J cells. J Biol Chem. 2003;278:36676–36687. doi: 10.1074/jbc.M303692200. [DOI] [PubMed] [Google Scholar]
  • 36.Yu JH, Kim KH, Kim H. Nuclear loss of DNA repair Ku proteins and c-myc expression in apoptosis of cerulein-stimulated pancreatic acinar cells. Inflammopharmacology. 2007;15:282–287. doi: 10.1007/s10787-007-1588-y. [DOI] [PubMed] [Google Scholar]
  • 37.Yan CT, Kaushal D, Murphy M, Zhang Y, Datta A, Chen C, Monroe B, Mostoslavsky G, Coakley K, Gao Y, et al. XRCC4 suppresses medulloblastomas with recurrent translocations in p53-deficient mice. Proc Natl Acad Sci USA. 2006;103:7378–7383. doi: 10.1073/pnas.0601938103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Hasty P. Is NHEJ a tumor suppressor or an aging suppressor? Cell Cycle. 2008;7:1139–1145. doi: 10.4161/cc.7.9.5807. [DOI] [PubMed] [Google Scholar]
  • 39.Li H, Mitchell JR, Hasty P. DNA double-strand breaks: a potential causative factor for mammalian aging? Mech Ageing Dev. 2008;129:416–424. doi: 10.1016/j.mad.2008.02.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Finnie NJ, Gottlieb TM, Blunt T, Jeggo PA, Jackson SP. DNA-dependent protein kinase activity is absent in xrs-6 cells: implications for site-specific recombination and DNA double-strand break repair. Proc Natl Acad Sci USA. 1995;92:320–324. doi: 10.1073/pnas.92.1.320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Cui X, Yu Y, Gupta S, Cho YM, Lees-Miller SP, Meek K. Autophosphorylation of DNA-dependent protein kinase regulates DNA end processing and may also alter double-strand break repair pathway choice. Mol Cell Biol. 2005;25:10842–10852. doi: 10.1128/MCB.25.24.10842-10852.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Meek K, Dang V, Lees-Miller SP. DNA-PK: the means to justify the ends? Adv Immunol. 2008;99:33–58. doi: 10.1016/S0065-2776(08)00602-0. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

meek supplemental data

RESOURCES