Skip to main content
The American Journal of Tropical Medicine and Hygiene logoLink to The American Journal of Tropical Medicine and Hygiene
. 2014 Jun 4;90(6):1014–1020. doi: 10.4269/ajtmh.14-0068

Hepatitis B Virus and Hepatitis C Virus Infections in United States-Bound Refugees from Asia and Africa

Tonya Mixson-Hayden 1,*, Deborah Lee 1, Lilia Ganova-Raeva 1, Jan Drobeniuc 1, William M Stauffer 1, Eyasu Teshale 1, Saleem Kamili 1
PMCID: PMC4047722  PMID: 24732462

Abstract

The aim of this study was to determine the prevalence of active hepatitis B and C virus infections among refugees from various countries in Africa and Asia. Pre-admission serum samples collected during 2002–2007 from refugees originating from Bhutan (N = 755), Myanmar (N = 1076), Iraq (N = 1137), Laos (N = 593), Thailand (N = 622), and Somalia (N = 707) were tested for hepatitis B virus (HBV) DNA and hepatitis C virus (HCV) RNA. The HBV DNA (genotypes A, B, C, and G) was detected in 12.1% of samples negative for anti-HBs. Highest HBV prevalence was found among Hmong; lowest among Bhutanese. The HCV RNA (genotypes 1a, 1b, 1c, 3b, 6n, and 6m) was detected in 1.3% of the samples. Highest HCV prevalence was found among Hmong from Thailand; lowest among Iraqis. Screening specific refugee groups at high risk for viral hepatitis infections will identify infected individuals who could benefit from referral to care and treatment and prevent further transmissions.

Introduction

From 2009 to 2010, ∼74,000 refugees resettled in the United States, with the highest number of refugees from Iraq, Myanmar (formerly known as Burma), and Bhutan; the number of refugees decreased to just over 53,000 in 2011.1 Children < 17 years of age made up the highest proportion of refugees (∼34%), followed by those 25–34 years of age (∼20%).1 A medical examination is mandatory for all refugees before entering the United States to identify applicants with inadmissible medical conditions (http://www.cdc.gov/immigrantrefugeehealth/exams/medical-examination.html). The Centers for Disease Control and Prevention (CDC) has issued guidelines for medical screening of refugees during this examination. These guidelines state that immunizations, including those for hepatitis B, are not required before entry into the United States for refugees; however, proof of vaccination is required to apply for adjustment of legal status (e.g., permanent resident status) after the refugee has been in the United States for > 1 year (http://www.cdc.gov/immigrantrefugeehealth/guidelines/domestic/domestic-guidelines.html).

More than 85% of the world's population live in areas of intermediate (2–7.9%) or high (> 8%) endemicity for hepatitis B.2 Prevalence rates of chronic hepatitis B (CHB) vary among refugee populations; overall estimates of CHB in foreign-born individuals living in the United States range from 2.7% to 11%.3–6 Estimates of CHB from specific regions vary from 6-14% in immigrants from Africa, 3.7–10% from Asia, 4% in immigrants from the Caribbean, and 2% in immigrants from Europe.4,6,7 It is estimated that over 90% of new cases of CHB in the United States are among foreign-born persons.8 Because persons who are chronically infected serve as viral reservoirs and may transmit infection to susceptible individuals and to protect the personal health of infected individuals, they should receive additional testing and be considered for treatment, monitored for progression of disease, and receive prevention counseling. Accordingly, the CDC recommends that all adults, including refugees, who were born in regions of the world with > 2% prevalence of HBV infection be tested for hepatitis B surface antigen (HBsAg), antibodies to hepatitis B core antigen (anti-HBc), or antibodies to hepatitis B surface antigen (anti-HBs) (http://www.astho.org/Programs/Infectious-Disease/Refugee-Health/ARHC-Medical-Screening-Recommendations/). The U.S. Preventative Services Task Force has also recently issued a draft recommendation to screen for HBV infection in persons at high risk for infection (http://www.uspreventiveservicestaskforce.org/draftrec2.htm), which includes U.S. foreign-born persons from, Laos, Myanmar, Somalia, Sudan, and a number of other countries.

Routine screening for HCV infection is currently recommended by the CDC for persons born during 1945 through 1965 and those who have known risk factors for HCV infection9,10; however, no specific recommendations for immigrant and refugee testing for HCV infection are currently given. There are limited data available regarding the epidemiology of HCV infection among refugee populations. Small-scale studies in specific populations have found rates of infection ranging from 0.1% to 8%.7,11–13 Currently, recommended screening practices for refugees arriving in the United States correspond to CDC recommendations for the general U.S. population (http://refugeehealthta.org/chronic-hepatitis-infection/).

Many individuals with chronic hepatitis B or C are unaware of their infection status, because they can remain asymptomatic for years. Individuals who become infected with HBV during early childhood, particularly when acquired perinatally, are at high risk of progression to chronicity.12 Chronic infections with HBV or HCV, or both, can lead to end-stage liver disease or hepatocellular carcinoma (HCC), which together account for approximately one million annual deaths worldwide.14 In the United States, HCC is the fastest growing cause of cancer-related death, with incidence tripling over the past 20 years.15,16 Deaths associated with HCV infection have now surpassed those associated with human immunodeficiency virus (HIV) in the United States, with deaths occurring primarily among middle-aged adults.17

Assessing the prevalence of active viral hepatitis infections in refugee populations is critical to formulate public health policies (e.g., generation of screening and treatment guidelines) and to plan strategies for primary and secondary prevention in at-risk populations. The aim of this study was to describe the epidemiologic and virologic characteristics of current HBV and HCV infections among refugees whose sera were available for testing and were properly catalogued and stored at CDC's Migrant Serum Bank.

Methods

Study population.

Residual serum samples collected from individuals undergoing prearrival screening examinations between 2002 and 2007 from Bhutan (N = 755), Myanmar (N = 1076), Iraq (N = 1137), Laos (N = 593), Thailand (N = 622), and Somalia (N = 707), shipped on dry ice and stored in CDC's Migrant Serum Bank at −70°C were tested for virological markers of HBV and HCV infections. Although all refugees 15 years of age and older had blood drawn, only refugee populations with sufficient left-over samples for the testing were included in the study. The refugees from Laos and Thailand were all of Hmong ethnicity and inhabited the same refugee camp in Thailand (WatThamKrab), and those from Somalia were Bantus who also resided in one refugee camp (Kakuma). Refugees from Iraq were urban, and sera were collected while they were in Jordan; Bhutanese refugees inhabited seven camps and those from Myanmar resided in six (Figure 1). These specimens were collected during medical screening examination before refugee arrival in the United States. De-identified data are collected and maintained by the Division of Global Migration and Quarantine, CDC, in the Migrant Serum Bank. Data were collected using standard forms and the protocol for data collection was approved by CDC's Ethics Review Board.

Figure 1.

Figure 1.

Map of the refugee camps and urban sites where the refugees in the study resided at the time of the pre-admission medical screening. Countries with pink shading are the home countries of the refugees, whereas those with green shading are those with refugee camps or refugees within urban areas.

Testing strategy.

Because of the availability of only restricted volumes of the sera and the need to conserve volume for polymerase chain reaction (PCR)-testing for HBV DNA and HCV RNA, serological testing for HBsAg, anti-HBc, and anti-HCV could not be performed. For screening for active HBV infections, serum samples were first tested for anti-HBs using VITROS ECi Immunodiagnostic System (Ortho-Clinical Diagnostics, Inc., Rochester, NY). Those negative for anti-HBs were then tested for HBV DNA. For screening for HCV infections, all samples were directly tested for HCV RNA.

The probe and primer sequences for PCR to amplify HBV DNA and HCV RNA are shown in Table 1. The dual-labeled Taqman HBV probe and HBV primers were designed from an alignment of S-gene sequences representative of all HBV genotypes. Total nucleic acids were extracted from 200 μL of serum with the MagNApure Total Nucleic Acid Isolation Kit I (Roche Applied Science, Rochester, NY) using the MagNApure LC instrument (Roche Applied Science, Indianapolis, IN) with a final elution volume of 50 μL. Taqman quantitative PCR (qPCR) for HBV DNA was performed using 5 μL of nucleic acid in total reaction volumes of 20 μL using Express Supermix (Life Technologies, Grand Island, NY). Primer and probe concentrations and reaction conditions are given in Table 1. Amplification, detection, and data analysis were performed using the LightCycler 480 system (Roche Applied Science). Standard curves were generated from 10-fold serial dilutions of the Acrometrix HBV DNA Panel (Life Technologies). All HBV-DNA-positive samples were re-amplified for sequencing using nested Sybr qPCR targeting the S gene as previously described18 using primers S1F and S1R in the primary reaction and SNF and SNR in the nested reaction (Table 1).

Table 1.

Probe and primer sequences used for quantitative real-time PCR assays for HBV DNA and HCV RNA detection and sequencing*

Primer ID Sequence
HBV384P 6FAM TGC GGC GTT TAT CAT MTT CCT CTT CAT-BHQ
HBV359F TGT CCT GGY TAT CGC TGG AT
HBV425R CCA ACA AGA AGA TGA GGC ATA GC
HCV259F AGY GTT GGG TYG CGA AAG
HCV312R CAC TCG CAA GCR CCC T
HCV278P 6FAM- CCT TGT GGT ACT GCC TGA -BHQ
F15 CGT TGA GGA ACT ACT GTC T
R03 GTG CAC GGT CTA CGA GAC CT
F13 GAA AGC GTC TAG CCA TGG CGT
R04 CCC TAT CAG GCA GTA CCA CAA
S1F CTAGGACCCCTGCTGGTGTT
S1R TCGAACCACTGAACAAATGGCACT
SNF GTTGACAAGAATCCTCACAATACC
SNR GGCTGAGGCCCACTCCCATA
*

PCR = polymerase chain reaction; HBV = hepatitis B virus; HCV = hepatitis C virus.

The qPCR primers and probe used for detection of HCV RNA were designed from a highly conserved region of the 5′UTR.19 Total nucleic acid extraction was performed as described previously. Quantitative reverse transcriptase real-time PCR for HCV RNA was performed using the Superscipt III Platinum 1 Step qRT-PCR kit (Life Technologies) with 10 μL of RNA in a total volume of 25 μL using the concentrations and conditions given in Table 1. Standard curves were generated from 10-fold serial dilutions of Acrometrix HCV RNA Panel (Life Technologies). All HCV-RNA-positive samples were re-amplified for sequencing by nested PCR targeting the 5′UTR with the Qiagen One-Step RT-PCR kit (Qiagen, Valencia, CA) according to the manufacturer's specifications using 24 μL RNA extract in a 50 μL reaction volume with primers F15 and R03 (Table 1). Second-round PCR was performed using Quant SybrGreen Master Mix (Quanta BioSciences, Gaithersburg, MD) according to the manufacturer's specifications using 2 μL primary product in a final volume of 20 μL with primers F13 and R04 (Table 1).

All sequences generated were assembled and multiple alignments made using Laser Gene software (DNA Star, Madison, WI). Neighbor-joining trees were constructed in MEGA 5.20

Statistical Analyses.

Differences in the mean ages of the refugees based on sex or country of origin was investigated with analysis of variance, whereas associations of HBV and HCV infections with gender, age group, and country of birth was evaluated with χ2 analysis implemented in Minitab16.21 Kruskal-Wallis one-way analysis of variance was used to determine if differences in HBV and HCV viral loads in study participants from the various countries were significant. A P value of ≤0.05 was considered statistically significant.

Results

Of the 4,890 sera tested, 15.4% (N = 755) were from refugees from Bhutan, 22.0% (N = 1076) from Myanmar, 23.3% (N = 1137) from Iraq, 12.1% (N = 593) from Hmong born in Laos, 12.7% (N = 622) from Hmong born in Thailand, and from Somali, 14.5% (N = 707). The number of sera from males was 2,409 (49.3%). The mean age of the refugees was 34.8 years (range 15–95 years) and differences among the study subpopulations were not significant except for the Hmong from Laos (mean 48.7 years [range 29–94]) and the Hmong from Thailand (mean 21.1 years [range 16–28] [P < 0.001, Tables 2, and 3]). No significant associations were observed between country of origin and gender.

Table 2.

Summary characteristics of test population HBV and HCV test data

Study population No. (M:F) Age range (mean [±SD]) HBV markers HCV RNA
Anti-HBs HBV DNA*
Positive (%) Negative Positive/total number % (95% CI) Median viral titer Positive/total number % (95% CI) Median viral titer
Bhutan 755 (384:371) 16–92 (35.9 [±16.7]) 139 (18.4) 616 11/755 1.46 (0.06, 2.3) 8.26E + 02 5/755 0.66 (0.08, 1.2) 2.21E + 07
Myanmar 1076 (522:554) 15–94 (33.3 [±15.0]) 558 (51.9) 518 98/1137 9.11 (7.4, 10.8) 1.32E + 04 4/1076 0.37 (0, 0.9) 3.65E + 05
Iraq 1137 (605:532) 16–95 (37.9 [±15.6]) 271 (23.8) 866 28/1137 2.46 (1.6, 3.4) 6.62E + 02 0/1137 0 0
Hmong (Laos) 593 (304:289) 29–94 (48.7 [±15.2]) 389 (65.6) 204 75/593 12.65 (10, 15.3) 5.58E + 03 3/593 0.51 (0, 1.8) 1.10E + 06
Hmong (Thai) 622 (314:308) 16–28 (21.1 [±3.7]) 360 (57.9) 262 80/622 12.86 (10.2, 15.4) 6.48E + 03 45/622 7.23 (5.2, 9.3) 4.80E + 03
Somalia 707 (352:355) 16–75 (31.0 [±11.7]) 410 (58.0) 297 39/707 5.52 (3.8, 7.1) 2.24E + 03 6/707 0.85 (0.17, 1.5) 2.95E + 03
*

= Only anti-HBs negative samples were tested for HBV DNA.

HBV = hepatitis B virus; HCV = hepatitis C virus; HB = hepatitis B,

Table 3.

Parameters associated with infection with HBV or HCV

Association tested χ2 df P value
Sex and country of origin 5.25 5 0.39
Age and country of origin 1335.5 30 < 0.001
Age and Hmong Thai/Hmong Lao 996.3 6 < 0.001
Age and Hmong Thai/other refugees 789.98 24 < 0.001
Anti-HBs detection rate and country of origin 656.2 5 < 0.001
Detectable HBV DNA and country of origin 290.69 5 < 0.001
Gender and detectable HBV DNA 3.22 1 0.07
Age (≥ 30 years) and detectable HBV DNA 0.282 1 0.595
HCV RNA positivity and country of origin 201.15 5 < 0.001
HCV RNA positivity and country of origin (Hmong Thai excluded) 6.49 4 0.166
Gender and HCV RNA 0.0002 1 0.987
Age (≥ 30 years) and detectable HCV RNA 40.7 1 < 0.001
Country HBV prevalence and country HCV prevalence 65.2 5 < 0.001
*

HBV = hepatitis B virus; HCV = hepatitis C virus; df = degrees of freedom.

Prevalence of markers of HBV Infection.

Of the total specimens tested, 2,127 (43.5%) were positive for anti-HBs. Greater than 50% of Myanmar refugees, Hmong from Laos, Hmong from Thailand, and refugees from Somali tested positive for anti-HBs. Country of origin was significantly associated with differences in anti-HBs status (P < 0.001, Table 3); fewer refugees from Bhutan and Iraq were anti-HBs negative compared with other refugees. Of the anti-HBs negative samples, HBV DNA was detected in 331 (12.1%). The HBV-DNA-detection rates varied depending upon the country of origin: Bhutan, 1.8%; Myanmar, 18.9%; Iraq, 3.2%; the Hmong, 33.3%; and Somali, 14.6%. There was a significant association between HBV-DNA-positivity and country of origin (with the Hmong from Laos and Thailand considered as one group) (P < 0.001); a higher proportion of Hmong and Burmese refugees were positive for HBV DNA. There was no association between HBV-DNA-positivity and gender or age. The median HBV viral load was 3.71e3 (range 18–7e11) IU/mL, with significant differences in mean viral load among the six countries (P = 0.015), and the highest observed among Myanmar refugees (1.32e4 IU/mL). The genotype distribution was as follows: A, 2.7%; B, 49.5%, C, 41.4%; and G, 0.3% (Figure 2). Twenty specimens could not be genotyped because of poor sequence data. Genotype A was found in all populations, except refugees from Myanmar. Genotype G was found in a single sample from a Myanmar refugee.

Figure 2.

Figure 2.

Genotype distribution and phylogenetic relatedness among hepatitis B virus (HBV) strains infecting U.S.-bound refugees.

Figure 3.

Figure 3.

Genotype distribution and phylogenetic relationships among hepatitis C virus (HCV) strains infecting U.S.-bound refugees.

Prevalence of HCV Infection.

Of the total specimens tested, 63 (1.1%) were positive for HCV RNA (Table 2). Detection rates varied: the Hmong, 4%; Somali, 0.9%; Bhutan, 0.7%; and Myanmar, 0.4%. There was a statistically significant association between HCV-RNA-positivity and country of origin (with the Hmong considered as one group) (P < 0.001); Hmong from Thailand had greater numbers of HCV-positive samples than refugees from other countries. No association is found if the Hmong from Thailand are excluded (P = 0.166). Positivity also was associated with age, being significantly higher among persons < 30 years of age (P < 0.001), but not with gender (Table 3). The median viral load was 1.07e4 (range 28–4.7e7) IU/mL, with significant differences in mean viral load among the six countries (P = 0.019), and the highest observed for the Bhutan refugees (2.21e7 IU/ml) (Table 3). The genotype distribution was as follows: 1a, 61.9%; 1b, 3.2%; 1c, 3.2%; 3b, 1.6%; 6n, 4.8%; and 6m, 4.8% (Figure 3); 13 (20.5%) specimens could not be genotyped. Genotypes 6n and 6m were identified in sera from refugees from Bhutan and Myanmar, respectively. Four samples were HBV-DNA- and HCV-RNA-positive, one from a Myanmar refugee and three from Hmong born in Thailand.

Discussion

Refugees applying for admission to the United States must undergo a medical examination overseas to identify individuals with inadmissible health-related conditions. These pre-departure examinations do not include routine screening for HBV and HCV virus infections. Following arrival in the United States it is recommended that all refugees receive a post-arrival medical examination for the purpose of further medical screening and to facilitate integration into the United States medical system. The CDC has issued guidelines for this examination. These guidelines include routine testing of refugees for hepatitis B for refugees who are from, or who have lived in, countries with rates of hepatitis B that are equal to or exceed 2%. Because of a lack of data, the CDC currently only recommends routine screening for hepatitis C in accordance with existing United States guidelines (e.g., for those with identified risk factors and in those born between 1945 and 1965).9 It is further recommended that any individual who screens positive for hepatitis B or C during the post-arrival medical screen will be counseled and evaluated for treatment (http://www.cdc.gov/immigrantrefugeehealth/guidelines/domestic/immunizations-guidelines.html); however, there are no mechanisms in place to ensure that those who screen positive receive adequate medical treatment or follow up.

Testing for anti-HBc and HBsAg could not be performed as a result of paucity of sample volumes, instead all samples were tested for anti-HBs to exclude seropositive samples for HBV DNA testing. Seropositivity for anti-HBs ranged from 18% to 65% in these groups of refugees, which suggests these individuals are already immune to HBV infection, likely from past HBV infections rather than prior hepatitis B vaccination; universal vaccination has recently been implemented only in Somalia and Myanmar.22,23 Among those who were seronegative for anti-HBs, 12% were seropositive for HBV DNA. We did not conduct serological tests to differentiate acute from chronic hepatitis B, but on the basis of the available epidemiology, the majority of HBV-DNA-positive refugees could be considered chronically infected with HBV. One recent meta-analysis found that pooled estimates of chronic HBV seroprevalence were higher in refugees than in immigrants, with a 42% higher odds of chronic infection as compared with immigrants after controlling for region of origin and study period.24 Since the adoption of universal vaccination against HBV, the rates of incident HBV infection in the United States have declined by more than 80%, to 1.5 per 100,000 individuals in 200925; however, the number of persons with chronic HBV infection in the United States is still substantial. The major contributing factor to the continuing endemicity of chronic hepatitis B is importation by already HBV-infected foreign-born individuals8; the refugees studied here and found positive for HBV DNA contribute to that endemicity.

Refugees from Myanmar and the Hmong were identified to have disproportionately high rates of HBV infection, reflecting the high endemicity of chronic hepatitis B in East Asia caused by frequent perinatal transmission.26 A high prevalence of HBV infection also can reflect practices adopted before migration that have placed persons at risk of HBV infection, such as tattooing, ear piercing, folk remedies, or scarification.27–29 Tattooing was a widespread custom in many ethnic groups in Myanmar until the mid-20th century, though the practice is regaining popularity among the youth. Similarly, a study among Hmong living in the San Joaquin Valley found almost 17% prevalence of CHB, and high-risk behavior including multiple sex partners, tattooing, and injecting drugs are common within the community.30 These refugee groups could benefit from early screening for HBV infections, identification, and treatment upon their arrival, which can prevent further progression of disease to end-stage liver disease and HCC, and diminish the risk of transmitting HBV to their contacts.

The HBV genotypes B and C were the most common in our study populations, reflecting their high frequency in Asia.31 More than 90% of CHB in Asia is caused by infections with genotypes B and C.32 It has been suggested that genotype C may be the most virulent of the HBV genotypes.33 Genotype C is associated with a delay in HBeAg seroconversion, ensuring perinatal transmission and progression to chronicity.33 Individuals with genotype C have a higher risk of liver inflammation, cirrhosis, and liver cancer at a younger age than other genotypes,34–36 though in one Taiwanese study, genotype B is associated with HCC in younger individuals.37 The implications of the high prevalence of genotypes B and C in these populations may add to the burden of CHB within the United States. The finding of a sample carrying HBV belonging to genotype G is quite surprising, as it is considered uncommon in Asia; nonetheless, this genotype has recently also been reported from Thailand.38

A relatively lower proportion (1%) of refugees tested in this study were HCV RNA positive. This proportion was particularly high among the Hmong born in Thailand (7%); however, Hmong born in Laos had a significantly lower prevalence of HCV RNA (0.51%, P < 0.001). The Hmong refugees born in Thailand were on average 20–30 years younger than those born in Laos, so risk factors for acquiring HCV infection may be different between these two Hmong groups. It has been reported that injection drug use has increased among the Hmong,39 thereby potentially contributing to the higher rate of HCV-RNA-positivity observed for the Thai Hmong. Currently, no specific policy exists for hepatitis C screening of immigrants or refugees, although CDC has recently included in its recommendations one-time screening for hepatitis C of all individuals born between 1945 and 1965.10 Hepatitis C testing recommendations could be extended to include testing of at-risk refugee groups such as Hmong from Thailand.

The most common HCV genotype was 1a, which reflects its worldwide distribution.40 Sera from three refugees, from Bhutan and Myanmar, carried HCV strains belonging to genotype 6 (subgenotyes 6m and 6n). Genotype 6 is relatively common in Southeast Asia, and the 6m and 6n subgenotypes particularly circulate in Thailand and Myanmar.41

There are several limitations to our study. First, as a result of the limited amount of sera available, our testing algorithm was non-traditional. Rather, we tested only samples that were negative for anti-HBs for HBV DNA and all samples for HCV RNA using the nucleic acids from the same extraction to maximize our ability to determine the number of infected individuals in these groups. This study was aimed at determining the prevalence of active HBV and HCV infections in these refugee populations using de-identified left-over samples in the archives of the CDC Migrant Serum bank, therefore the results were not shared with the participants and/or used for clinical management of any infected individuals. Second, this study was based on convenience samples available in a repository at the CDC; therefore, our findings may not be generalizable to other refugee groups or immigrants entering the United States. For example, the refugees from Bhutan and Myanmar resided in multiple refugee camps before their pre-admission medical screening; thus, the prevalence estimates are likely representative of the specific refugee group rather than a common source of infection within a particular refugee camp. We could not expand the screening for HBV and HCV infections to other refugee populations due to a lack of availability of their sera samples in CDC repository. Finally, there is the possibility that we may have underestimated the number of refugees with active HBV infections, because individuals could potentially be anti-HBs positive and HBV DNA positive, or could be DNA negative, but still transmit because of positive HBsAg. Nevertheless, our data provide valuable insight into the burden of HBV and HCV infections in these selected refugee populations.

In conclusion, our findings show a higher prevalence of HBV and HCV infections in various refugee populations and the difficulty in developing generic medical screening guidelines for such populations. Refugee populations vary over time and risk of infectious diseases varies as these populations change. Hepatitis B testing has been considered standard of care for refugees for many years, with the assumption that all populations are originating in intermediate or highly endemic areas. Similarly, although the rate of HCV infections in refugees generally falls below the rates found in the United States population, there are specific populations with higher rates that would justify more enhanced screening (e.g., Hmong born in Thailand). Even when ethnically similar, different populations may have distinctly different rates, as shown by the variance found in the Hmong originating in Thailand from those originating in Laos. This study shows that generic screening guidelines issued for this diverse population is a sub-optimal approach. Refugee populations admitted into the United States vary over time. These populations are generally identified in advance of migration to the United States. An ideal system would anticipate health conditions in refugees who are planned to arrive by testing before movement to the United States and would base recommendations on data specific to each population (i.e., population-specific recommendations). In summary, it is essential to determine the risk of serious infection in specific refugee populations rather than treating all refugee populations identically so that appropriate guidelines can be issued. Early identification of infections such as HBV and HCV infection is essential to facilitate treatment of those found infected, which will confer medical benefits to the individual, and curtail the continuing spread of HBV and HCV infections in the United States.

ACKNOWLEDGMENTS

We thank the panel physicians who provided the sera to CDC's Migrant Sera Bank. We thank C. Virginia Lee for producing the map of refugee camps. We acknowledge Zoya Dimitrova for her assistance in statistical analysis of the data. We are grateful to Mar Than, Natasha Khudhakov, and Tracy Green-Montfort for serologic testing of the specimens.

Disclaimer: The findings and conclusions in this report are those of the authors and do not necessarily represent the official position of the U.S. CDC.

Footnotes

Authors' addresses: Tonya Mixson-Hayden, Deborah Less, Lilia Ganova-Raeva, Jan Drobeniuc, Eyasu Teshale, and Saleem Kamili, Centers for Disease Control and Prevention, Division of Viral Hepatitis, Atlanta, GA, E-mails: zdy0@cdc.gov, dpl2@cdc.gov, lkg7@cdc.gov, jqd6@cdc.gov, eht4@cdc.gov, and sek6@cdc.gov. William M. Stauffer, Division of Infectious Diseases and International Medicine, University of Minnesota, Minneapolis, MN, E-mail: stauf005@umn.edu.

References

  • 1.Martin DC, Yankay JE. Refugees and Asylees: 2011. Washington, DC: U.S. Department of Homeland Security; 2012. [Google Scholar]
  • 2.CDC . Health Information for International Travel 2010. Atlanta, GA: U.S. Department of Health and Human Services, Public Health Services; 2009. [Google Scholar]
  • 3.Levy V, Yuan J, Ruiz J, Morrow S, Reardon J, Facer M, Molitor F, Allen B, Ajufo BG, Bell-Sanford G, McFarland W, Raymond HF, Kellogg T, Page K. Hepatitis B sero-prevalence and risk behaviors among immigrant men in a population-based household survey in low-income neighborhoods of northern California. J Immigr Minor Health. 2010;12:828–833. doi: 10.1007/s10903-009-9239-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Kowdley K, Wang C, Welch S, Roberts H, Brosgart C. Prevalence of chronic hepatitis B among foreign-born persons living in the United States by country of origin. Hepatology. 2012;56:422–433. doi: 10.1002/hep.24804. [DOI] [PubMed] [Google Scholar]
  • 5.Rein D, Lesesne S, O'Fallon A, Weinbaum C. Prevalence of hepatitis B surface antigen among refugees entering the United States between 2006 and 2008. Hepatology. 2010;51:431–434. doi: 10.1002/hep.23353. [DOI] [PubMed] [Google Scholar]
  • 6.Barnett ED, Weld LH, McCarthy AE, So H, Walker PF, Stauffer W, Cetron M. Spectrum of illness in international migrants seen at GeoSentinel clinics in 1997–2009, part 1: US-bound migrants evaluated by comprehensive protocol-based health assessment. Clin Infect Dis. 2013;56:913–924. doi: 10.1093/cid/cis1015. [DOI] [PubMed] [Google Scholar]
  • 7.McCarthy AE, Weld LH, Barnett ED, So H, Coyle C, Greenaway C, Stauffer W, Leder K, Lopez-Velez R, Gautret P, Castelli F, Jenks N, Walker PF, Loutan L, Cetron M. Spectrum of illness in international migrants seen at GeoSentinel clinics in 1997–2009, part 2: migrants resettled internationally and evaluated for specific health concerns. Clin Infect Dis. 2013;56:925–933. doi: 10.1093/cid/cis1016. [DOI] [PubMed] [Google Scholar]
  • 8.Mitchell T, Armstrong G, Hu D, Wasley A, Painter J. The increasing burden of imported chronic hepatitis B - United States, 1974–2008. PLoS One. 2011;6:e27717. doi: 10.1371/journal.pone.0027717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Smith B, Morgan R, Beckett G, Falck-Ytter Y, Holtzman D, Ward J. Hepatitis C virus testing of persons born during 1945–1965: recommendations from the Centers for Disease Control and Prevention. Ann Intern Med. 2012;157:817–822. doi: 10.7326/0003-4819-157-9-201211060-00529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Smith B, Morgan R, Beckett G, Falck-Ytter Y, Holtzman D, Teo G, Jewett A, Baack B, Rein D, Patel N, Alter M, Yartel A, Ward J. Recommendations for the identification of chronic hepatitis C virus infection among persons born during 1945–1965. MMWR Recomm Rep. 2012;61:1–32. [PubMed] [Google Scholar]
  • 11.Tafuri S, Prato R, Martinelli D, Melpignago L, De Palma M, Quarto M, Germinario C. Prevalence of Hepatitis B, C, HIV and syphilis markers among refugees in Bari, Italy. BMC Infect Dis. 2010;10:213. doi: 10.1186/1471-2334-10-213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Quimet M, Munuz M, Narasiah L, Rambure V, Correa J. Current pathologies among asylum seekers in Montreal: prevalence and associated risk factors. Can J Public Health. 2008;99:499–504. doi: 10.1007/BF03403785. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Chironna M, Germinario C, Lopalco P, Carrozzini F, Barbuti S, Quarto M. Prevalence rates of viral hepatitis infections in refugee Kurds from Iraq and Turkey. Infection. 2003;31:70–74. doi: 10.1007/s15010-002-3100-3. [DOI] [PubMed] [Google Scholar]
  • 14.WHO . Prevention and Control of Viral Hepatitis Infection: Framework for Global Action. Geneva: World Health Organization; 2012. [Google Scholar]
  • 15.Han YF, Zhao J, Ma LY, Yin JH, Chang WJ, Zhang HW, Cao GW. Factors predicting occurrence and prognosis of hepatitis-B-virus-related hepatocellular carcinoma. World J Gastroenterol. 2011;17:4258–4270. doi: 10.3748/wjg.v17.i38.4258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.El-Serag H. Hepatocellular carcinoma. N Engl J Med. 2011;365:1118–1127. doi: 10.1056/NEJMra1001683. [DOI] [PubMed] [Google Scholar]
  • 17.Ly K, Xing J, Klevens M, Jiles R, Ward J, Holmberg S. The increasing burden of mortality from viral hepatitis in the United States between 1999 and 2007. Ann Intern Med. 2012;156:271–278. doi: 10.7326/0003-4819-156-4-201202210-00004. [DOI] [PubMed] [Google Scholar]
  • 18.Forbi J, Vaughan G, Purdy M, Campo D, Xia G, Ganova-Raeva L, Ramachandran S, Thai H, Khudyakov Y. Epidemic history and evolutionary dynamics of hepatitis B virus infection in two remote communities in rural Nigeria. PLoS One. 2010;5:e1615. doi: 10.1371/journal.pone.0011615. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Engle R, Russell R, Purcell R, Buhk J. Development of a TaqMan assay for the six major genotypes of Hepatitis C virus: comparison with commercial assays. J Med Virol. 2008;80:72–79. doi: 10.1002/jmv.21043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011;28:2731–2739. doi: 10.1093/molbev/msr121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.MiniTab I . Minitab Statistical Software, Release 16 for Windows. State College, PA: 2009. [Google Scholar]
  • 22.WHO . WHO Country Cooperation Strategy 2008–2001 Myanmar. India. Geneva: World Health Organization; 2008. [Google Scholar]
  • 23.WHO . Geneva: World Health Organization; 2013. Children in Somalia to receive new vaccination against deadly diseases. [Google Scholar]
  • 24.Rossi C, Shrier I, Marshall L, Cnossen S, Schwartzman K, Klein M, Schwarzer G, Greenaway C. Seroprevalence of chronic hepatitis B virus infection and prior immunity in immigrants and refugees: a systematic review and meta-analysis. PLoS One. 2012;7:e44611. doi: 10.1371/journal.pone.0044611. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.CDC . Atlanta, GA: Centers for Disease Control and Prevention; 2008. Hepatitis B FAQs for health professionals. [Google Scholar]
  • 26.Shiraki K. Perinatal transmission of hepatitis B virus and its prevention. J Gastroenterol Hepatol. 2000;15:E11–E15. doi: 10.1046/j.1440-1746.2000.02098.x. [DOI] [PubMed] [Google Scholar]
  • 27.Ackerman L. Health problems of refugees. J Am Board Fam Pract. 1997;10:337–348. [PubMed] [Google Scholar]
  • 28.Walker P, Jaranson J. Refugee and immigrant health care. Med Clin North Am. 1999;83:1103–1120. [PubMed] [Google Scholar]
  • 29.Polednak A. Racial and Ethnic Differences in Disease. New York: Oxford University Press, Inc; 1989. [Google Scholar]
  • 30.Sheikh M, Mouanoutoua M, Walvick M, Khang L, Singh J, Stoltz S, Mills P. Prevalence of hepatitis B virus (HBV) infection among immigrants in the San Joaquin Valley. J Community Health. 2011;36:42–46. doi: 10.1007/s10900-010-9283-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Mahtab M-A, Rahman S, Khan M, Karim F. Hepatitis B genotypes: an overview. Hepatobiliary Pancreat Dis Int. 2008;7:457–464. [PubMed] [Google Scholar]
  • 32.Huang Y, Lok AS. Viral factors and outcomes of chronic HBV infection. Am J Gastroenterol. 2011;106:93–95. doi: 10.1038/ajg.2010.404. [DOI] [PubMed] [Google Scholar]
  • 33.Araujo NM, Waizbort R, Kay A. Hepatitis B virus infection from an evolutionary point of view: how viral, host, and environmental factors shape genotypes and subgenotypes. Infect Genet Evol. 2011;11:1199–1207. doi: 10.1016/j.meegid.2011.04.017. [DOI] [PubMed] [Google Scholar]
  • 34.Chan HL, Hui AY, Wong ML, Tse AM, Hung LC, Wong VW, Sung JJ. Genotype C hepatitis B virus infection is associated with an increased risk of hepatocellular carcinoma. Gut. 2004;53:1494–1498. doi: 10.1136/gut.2003.033324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Chen CH, Eng HL, Lee CM, Kuo FY, Lu SN, Huang CM, Tung HD, Chen CL, Changchien CS. Correlations between hepatitis B virus genotype and cirrhotic or non-cirrhotic hepatoma. Hepatogastroenterology. 2004;51:552–555. [PubMed] [Google Scholar]
  • 36.Kao JH, Chen PJ, Lai MY, Chen DS. Genotypes and clinical phenotypes of hepatitis B virus in patients with chronic hepatitis B virus infection. J Clin Microbiol. 2002;40:1207–1209. doi: 10.1128/JCM.40.4.1207-1209.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Ni YH, Chang MH, Wang KJ, Hsu HY, Chen HL, Kao JH, Yeh SH, Jeng YM, Tsai KS, Chen DS. Clinical relevance of hepatitis B virus genotype in children with chronic infection and hepatocellular carcinoma. Gastroenterology. 2004;127:1733–1738. doi: 10.1053/j.gastro.2004.09.048. [DOI] [PubMed] [Google Scholar]
  • 38.Louisirirotchanakul S, Olinger C, Arunkaewchaemsri P, Poovorawan Y, Kanoksinsombat C, Thongme C, Sa-nguanmoo P, Krasae S, Theamboonlert A, Oota S, Fongsatitkul L, Puapairoj C, Promwong C, Weber B. The distribution of hepatitis B genotypes in Thailand. J Med Virol. 2012;84:1541–1547. doi: 10.1002/jmv.23363. [DOI] [PubMed] [Google Scholar]
  • 39.Beyrer C, Celentano D, Suprasert S, Sittitrai W, Nelson K, Kongsub B, Go V, Phanupak P. Widely varying HIV prevalence and risk behaviors among the ethnic minority peoples of northern Thailand. AIDS Care. 1997;9:427–439. doi: 10.1080/09540129750124975. [DOI] [PubMed] [Google Scholar]
  • 40.Simmonds P. Genetic diversity and evolution of hepatitis C virus - 15 years on. J Gen Virol. 2004;85:3173–3188. doi: 10.1099/vir.0.80401-0. [DOI] [PubMed] [Google Scholar]
  • 41.Akkarathamrongsin S, Praianantathavorn K, Hacharoen N, Theamboonlers A, Tangkijvanich P, Tanaka Y, Mizokami M, Poovorawan Y. Geographic distribution of Hepatitis C virus genotype 6 subtypes in Thailand. J Med Virol. 2010;82:257–262. doi: 10.1002/jmv.21680. [DOI] [PubMed] [Google Scholar]

Articles from The American Journal of Tropical Medicine and Hygiene are provided here courtesy of The American Society of Tropical Medicine and Hygiene

RESOURCES