Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Apr 1.
Published in final edited form as: Virology. 2014 Mar 21;0:280–290. doi: 10.1016/j.virol.2014.03.003

Differential segregation of nodaviral coat protein and RNA into progeny virions during mixed infection with FHV and NoV

Radhika Gopal 1, P Arno Venter 1,1, Anette Schneemann 1,*
PMCID: PMC4048152  NIHMSID: NIHMS576148  PMID: 24725955

Abstract

Nodaviruses are icosahedral viruses with a bipartite, positive-sense RNA genome. The two RNAs are packaged into a single virion by a poorly understood mechanism. We chose two distantly related nodaviruses, Flock House virus and Nodamura virus, to explore formation of viral reassortants as a means to further understand genome recognition and encapsidation. In mixed infections, the viruses were incompatible at the level of RNA replication and their coat proteins segregated into separate populations of progeny particles. RNA packaging, on the other hand, was indiscriminate as all four viral RNAs were detectable in each progeny population. Consistent with the trans-encapsidation phenotype, fluorescence in situ hybridization of viral RNA revealed that the genomes of the two viruses co-localized throughout the cytoplasm. Our results imply that nodaviral RNAs lack rigorously defined packaging signals and that coencapsidation of the viral RNAs does not require a pair of cognate RNA1 and RNA2.

Keywords: Flock House virus, Nodamura virus, mixed infection, viral assembly, RNA encapsidation, viral reassortant

INTRODUCTION

The nodaviruses are a family of non-enveloped, icosahedral viruses that have a bipartite, positive-sense RNA genome. They are divided into two genera, Alphanodavirus and Betanodavirus, whose members were originally isolated from insects and fish, respectively (Thiery et al., 2012). In the Alphanodavirus genus, Flock House virus (FHV) is the most thoroughly characterized virus, whereas Nodamura virus (NoV) represents the type species. NoV is distinct from other alphanodaviruses in its ability to infect some mammals, including suckling mice and hamsters (Garzon and Charpentier, 1991; Scherer and Hurlbut, 1967; Scherer et al., 1968). Studies of NoV have lagged behind those of FHV primarily due to lack of a cell culture system in which the virus can be efficiently propagated. Its life cycle can be studied, however, upon transfection of the viral RNAs into a variety of cell types, including vertebrate and invertebrate cells.

The nodaviral genome divides replication and packaging functions between two RNA segments. The larger segment, RNA1, encodes the RNA-dependent RNA polymerase (RdRp), which establishes replication complexes on the surface of mitochondria (Miller and Ahlquist, 2002; Miller et al., 2001). More specifically, RNA synthesis occurs in so-called spherules, which represent invaginations of the outer membrane of the organelle (Kopek et al., 2007). The smaller genome segment, RNA2, encodes capsid protein alpha, which co-packages one molecule of RNA1 and RNA2 into progeny particles that have T=3 icosahedral symmetry (Fisher and Johnson, 1993; Friesen and Rueckert, 1981; Krishna and Schneemann, 1999). A third, subgenomic RNA3 is synthesized from RNA1 and encodes protein B2, a suppressor of RNA silencing. RNA3 is not packaged into particles (Chao et al., 2005; Galiana-Arnoux et al., 2006; Li et al., 2002).

X-ray crystallography and cryo-electron microscopy of several alphanodaviruses has provided detailed insights into the structure of the protein capsid including important information on the arrangement of the packaged RNA (Fisher and Johnson, 1993; Tang et al., 2001; Tihova et al., 2004). A significant portion of the genome (13-35%) forms double-stranded (ds) regions that sit directly underneath the thirty edges of the icosahedral capsid, where they interact with positively charged amino acid side chains located primarily in the N and C termini of the coat protein. The remaining RNA takes an unknown pathway but is thought to drop down into the interior of the capsid and return back up to connect the dsRNA regions at the twofold contacts (Devkota et al., 2009; Tihova et al., 2004). Because the density representing RNA in these particles is icosahedrally averaged, information about the location of specific bases or sections of the genomic RNAs is not available. It is also not known whether the RNA that is visible in the structure represents RNA1, RNA2 or both.

In contrast to many other non-enveloped, icosahedral, positive strand RNA viruses, nodaviral coat proteins do not form empty particles but need nucleic acid to establish stable quaternary interactions. Regardless of whether particles contain the viral genome or random cellular RNAs, as for example in virus-like particles, their sedimentation rate and density remain unchanged. This indicates that the amount of RNA packaged in each capsid is relatively constant. It is often referred to as a “headful” and probably represents a compromise between the limited capacity of the particle's internal volume and the requirement for a minimum nucleic acid scaffold during and after assembly.

Although FHV is a generally well-characterized nodavirus, several aspects of its life cycle remain poorly understood. One of them is the mechanism by which RNA1 and RNA2 are recognized and packaged into a single particle. The two RNAs lack notable regions of sequence identity or obvious secondary structures that could serve as common signals for packaging as has been observed for some other segmented positive strand RNA viruses (Choi et al., 2002). Instead, nodaviral RNA1 and RNA2 appear to have unique features that ensure their recognition and encapsidation.

Some information regarding the packaging mechanism has come from mutational analyses of the coat protein. These analyses showed that the N- and C-termini of alpha protein play a critical role in recognition of the viral RNAs. Deletion of N-terminal residues 2 to 31 results in inefficient packaging of RNA2, without affecting packaging of RNA1 (Marshall and Schneemann, 2001). In contrast, deletion of C-terminal residues 382 to 407 results in packaging of random cellular RNA (Schneemann and Marshall, 1998). An arginine-rich motif proximal to the N terminus was found to be important for specific packaging of RNA1 (Venter et al., 2009). Together, these results imply that, at least in case of these coat protein mutants, recognition of the two genomic segments occurs independently of each other and assembly is not initiated on a non-covalent complex of the two RNAs.

Additional hints about RNA packaging came from experiments in which FHV-infected cells were engineered to produce two types of coat protein: one from an mRNA that was generated in the nucleus, the other from a viral RNA2 replicating in the cytoplasm. Only coat protein translated from the RNA2 replicon packaged the FHV genome, while coat protein translated from nonreplicating RNA packaged cellular RNA (Venter and Schneemann, 2007). These results were interpreted to indicate that viral RNA replication, translation and packaging are coupled events and that they may occur in separate cellular microdomains or viral factories to prevent interference by other cellular components.

The need to evolve and maintain a mechanism that ensures co-packaging of multiple genome segments puts nodaviruses, as well as other viruses with segmented genomes, such as reoviruses, bunyaviruses and influenza viruses, at a disadvantage when compared to nonsegmented viruses. On the other hand, these viruses have the ability to form reassortants, which increases their genetic diversity and promotes rapid evolution in the face of environmental pressures. The formation of reassortants implies that the genome packaging mechanisms used by these viruses have a certain level of flexibility built into them to allow incorporation of segments whose sequence may differ significantly from the parental segment. Specificity must be maintained, however, with regard to the number of segments packaged and the proteins they encode.

We chose FHV and NoV to explore the formation of viral reassortants as a means to further understand nodaviral genome recognition and packaging. The two viruses, which were isolated from different insects in separate geographic locations at different times (Scherer and Hurlbut, 1967; Scotti et al., 1983), are genetically only distantly related to each other. FHV RNA1 (3.1 kb) shares 50% identity with NoV RNA1 (3.2 kb), while FHV RNA2 (1.4 kb) shares 56% identity with NoV RNA2 (1.3 kb). RdRp and coat protein are 40% and 47% identical, respectively. We found that the two viruses are incompatible at the level of RNA replication and that their capsid proteins segregate into separate particles. These particles, however, packaged not only their cognate RNAs but also those of the other virus. Consistent with the observed trans-encapsidation phenotype, fluorescence in situ hybridization of co-infected cells revealed that the RNAs of the two viruses largely co-localized in the cytoplasm. Overall, the results presented here combined with previous data suggest that nodaviral RNAs lack rigorously defined packaging signals and that co-encapsidation is likely based on molecular features that emerge subsequent to the initial interaction of coat protein subunits with the individual RNAs.

RESULTS

Demonstration of mixed nodaviral infection in BHK21 cells

We initially planned to study the outcome of mixed nodaviral infections in cultured Drosophila S2 cells, which have been used extensively to investigate the FHV life cycle. Because S2 cells cannot be infected with NoV, we employed liposome-mediated transfection of viral RNAs. Specifically, S2 cells were transfected with a mixture containing equal amounts of FHV and NoV genomic RNAs extracted from purified virus particles and infection was monitored by confocal immunofluorescence microscopy with antibodies against the coat proteins of the two viruses. Surprisingly, the vast majority of transfected cells contained only one type of coat protein, that of FHV or NoV, whereas few contained both (data not shown). The inefficiency with which the transfection procedure gave rise to co-infected cells precluded use of the S2 cell line as a suitable system of investigation. We therefore turned our attention to mammalian BHK21 cells, which also support FHV and NoV replication upon transfection of the viral RNAs as long as the cells are cultured at ≤33°C (Ball et al., 1992). When BHK21 cells were transfected with equal amounts of FHV and NoV RNAs, the average transfection efficiency in five independent experiments was 30±8%. This was based on examining a total of 444 cells processed for immunofluorescence microscopy and scoring as positive those that contained at least one type of nodaviral coat protein. The majority, 79±6%, of these positive cells contained both FHV and NoV coat proteins, whereas 6±1% contained only FHV protein and 15±2% only NoV protein (Fig. 1).

FIG. 1. Sub-cellular distribution of FHV and NoV coat proteins in transfected BHK21 cells.

FIG. 1

Open in a new tab

BHK21 cells were transfected with (A) FHV viral RNA, (B) NoV viral RNA and (C) FHV and NoV viral RNA. The cells were fixed, permeabilized and stained at 12 h post transfection. Mouse anti-FHV and rabbit anti-NoV antibodies were used to detect FHV and NoV coat proteins, respectively. MitoTracker red was used to visualize mitochondria and DAPI was used as a nuclear stain. Z-series projections of several optical sections are shown. Panel D shows a zoom-in view of the boxed area in panel C. Yellow pixels in (C) and (D) represent subcellular regions where coat proteins from the two viruses co-localize.

Monitoring the transfection efficiency of BHK21 cells by confocal immunofluorescence microscopy revealed the subcellular localization of the viral coat proteins. As previously observed (Petrillo et al., 2013), cells transfected with FHV RNA contained coat protein throughout the cytoplasm and distributed in a somewhat reticular pattern (Fig. 1A). This pattern was mirrored by coat protein in cells transfected with NoV RNAs (Fig. 1B). In cells cotransfected with the genomes of both viruses, the signal for the two coat proteins largely overlapped (Fig. 1C and D), indicating that NoV and FHV did not appear to segregate into separate cellular microenvironments where each type of coat protein accumulated for subsequent assembly and RNA packaging.

The involvement of mitochondria in nodaviral infections is well established (Garzon et al., 1990; Miller et al., 2001). In contrast to NoV, however, it had not yet been confirmed that these organelles also serve as a site of RNA replication when FHV infects mammalian cells instead of insect cells. We therefore performed additional confocal immunofluorescence analyses as well as electron microscopic analyses on BHK21 cells transfected with FHV RNA. Using antibodies against the polymerase combined with mitotracker staining, we reproduced earlier results that RdRp is located on mitochondria in these cells (Fig. 2A) and that the organelles exhibit the expected clustering around the nucleus that has been previously noted in insect cells (Miller et al., 2001; Petrillo et al., 2013). More importantly, electron microscopy of thin sections prepared from BHK21 cells transfected with FHV RNA1, the RdRp message, revealed extensive architectural reorganization of the organelles and the presence of numerous replication spherules in the outer membrane (Fig. 2B and C). We thus concluded that BHK21 cells reproduced the characteristic cell biological features of FHV replication in insect cells and all subsequent analyses were performed in this mammalian cell line.

FIG. 2. Immunofluorescence and EM analysis of mitochondria in transfected BHK21 cells.

FIG. 2

Open in a new tab

(A) BHK21 cells were transfected with FHV viral RNA and processed for immunostaining 24 hours later. FHV RdRp was labeled with mouse monoclonal antibodies and mitochondria with MitoTracker red. DAPI was used to visualize nuclei (blue). The cell in the upper left corner of the image is untransfected. Z-series projections of several optical sections are shown. (B) Electron micrograph of two representative mitochondria in an uninfected BHK21 cell. (C) Electron micrograph of a representative mitochondrion in a BHK21 cell transfected with FHV RNA1 and processed for imaging 24 hours later. Note the unusual shape of the organelle, the compressed matrix and enlarged intermembrane space. The intermembrane space is filled with membrane-bound vesicles, called spherules, which represent sites of viral RNA synthesis.

NoV and FHV are incompatible at the level of RNA replication

Previous attempts to generate reassortant nodaviruses by transfecting Drosophila cells with FHV RNA1 and NoV RNA2, or vice versa, failed and it was postulated that this reflected inability of the viral polymerases to replicate RNA2 of the heterologous virus (Gallagher, 1987). A subsequent analysis that employed yeast as a host to study nodavirus RNA replication further supported this hypothesis by demonstrating that FHV RdRp did not replicate an NoV RNA2-derivative and that replication of an FHV RNA2-derivative by NoV RdRp occurred with 104-fold reduced efficiency relative to an NoV RNA2-derivative (Price et al., 2005). To confirm these results with full-length, wildtype (wt) RNA2 in BHK21 cells, we transfected cells with the four different combinations of FHV and NoV RNA1 and RNA2 and analyzed total cellular RNA on an ethidium bromide-stained agarose gel 24 hours later. As shown in figure 3, progeny RNA2 was only detected when RNA2 transcripts were mixed with RNA1 from the same virus (lanes 4 and 6), whereas it was absent when RNA1 from the heterologous virus was employed (lanes 5 and 7). Nodaviral RNA3, a subgenomic RNA derived from RNA1, was detected in all four cases, as expected. These results confirmed previous hypotheses that the polymerases of the two viruses do not recognize each others’ RNA2 as a template for replication. Absence of cross-replication of RNA2 eliminated potential confounding effects on our subsequent genome packaging analyses.

FIG. 3. Electrophoretic analysis of total RNA from BHK21 cells transfected with various combinations of FHV and NoV RNAs 1 and 2.

FIG. 3

Open in a new tab

BHK21 cells were transfected with RNA1 and 2 transcripts of FHV and NoV in four different combinations. As controls, cells were transfected with FHV or NoV RNA extracted from purified virus particles. Total cellular RNA was prepared 24 h post transfection and analyzed on a non-denaturing 1% agarose gel. Lane 1, RNA from untransfected cells (UT); Lanes 2 and 3, RNA from cells transfected with FHV (F) or NoV (N) viral RNA, respectively; Lane 4, RNA from cells transfected with FHV RNA1 and 2 transcripts (FR1 FR2); Lane 5, RNA from cells transfected with FHV RNA1 and NoV RNA2 transcripts (FR1 NR2); Lane 6, RNA from cells transfected with NoV RNA1 and 2 transcripts (NR1 NR2) and Lane 7, RNA from cells transfected with NoV RNA1 and FHV RNA2 transcripts (NR1 FR2).

Characterization of progeny virus particles synthesized in BHK21 cells co-infected with FHV and NoV

BHK21 cells were transfected with a mixture containing equal amounts of FHV and NoV viral RNAs and 48 hours later viral progeny was purified by sucrose gradient sedimentation. The particles formed a single band on the gradient at a position indistinguishable from that of FHV or NoV particles produced separately in parallel (data not shown). Electron micrographs of negatively stained samples revealed that particles from co-infected cells had the typical hexagonal shape and dimensions (30-35 nm) observed for nodaviruses (Fig. 4) and that they were essentially indistinguishable from purified FHV or NoV virions. A slightly larger fraction, however, appeared to take up some stain during preparation for electron microscopy.

FIG. 4. Electron micrographs of negatively stained virus particles gradient-purified from transfected BHK21 cells.

FIG. 4

Open in a new tab

BHK21 cells were transfected with NoV viral RNA (left panel), FHV viral RNA (middle panel) or FHV and NoV viral RNA (right panel). After 48h, progeny virus particles were purified by sucrose gradient centrifugation and prepared for electron microscopy by staining with uranyl acetate. (Scale bar, 100 nm)

We next evaluated the protein and RNA composition of particles isolated from co-infected cells (hereafter referred to as F+N particles). Immunoblot analysis with anti-FHV and anti-NoV antibodies revealed the presence of both FHV and NoV coat proteins (Fig 5A), while RNA extraction and electrophoretic analysis showed the presence of two major bands closely migrating with FHV and NoV genomic RNAs on a 1% agarose gel (fig. 5B). To determine the identity of these RNAs, RT-PCR analysis was performed using primers specific for FHV and NoV RNA1 and RNA2. The results showed that all four nodaviral RNAs were present in the population of particles purified from co-infected cells (fig. 5C).

FIG. 5. Protein and RNA contents of virus particles isolated from BHK21 cells co-transfected with FHV and NoV viral RNAs.

FIG. 5

Open in a new tab

BHK21 cells were transfected with FHV viral RNA (F), NoV viral RNA (N) or both (F+N) and progeny particles were gradient-purified 48h later. (A) Immunoblot analysis of progeny particles probed with rabbit anti-FHV or anti-NoV antibodies. Alpha represents the precursor capsid protein, whereas beta represents the major product of an autocatalytic cleavage, which occurs in most protein subunits after assembly. (B) RNA was extracted from F, N and F+N progeny virus particles and electrophoresed through a non-denaturing agarose gel. RNA size markers are indicated to the left. Note that on non-denaturing agarose gels RNA1 and RNA2 do not migrate exactly according to their size. (C) RT-PCR analysis of RNA extracted from F+N progeny particles. Specific primers were used to probe for the presence of NoV and FHV RNAs1 and RNA2. As a positive control for NoV-specific primers, viral RNA extracted from native NoV particles was used and as a negative control, viral RNA from native FHV particles. Similarly, as a positive control for FHV-specific primers, viral RNA extracted from native FHV particles was used and as a negative control, viral RNA from native NoV particles.

An important question was whether the two coat proteins formed mosaic particles, i.e capsids that contained a mixture of subunits from both viruses. The primary sequence of the FHV and NoV coat proteins is highly divergent and antibodies against one type of coat protein do not cross-react with the other in immunoblot analysis (Kaesberg, 1990). Moreover, the high resolution crystal structures of the two viruses show that subunit-subunit contacts in each particle rely on interactions between distinct sets of amino acid side chains, making the formation of mosaic capsids unlikely (Fisher and Johnson, 1993; Zlotnick et al., 1997). We investigated this experimentally by subjecting F+N particles to immunoprecipitation with FHV antiserum and then tested for the presence of NoV coat protein in the pellet using antibodies against NoV. As shown in figure 6, NoV coat protein was not detectable. Given that sensitivity of the immunoblot analysis was sufficiently high to allow detection of 2-3 NoV coat protein subunits per FHV particle, this assay essentially confirmed the absence of mosaic capsids. Thus, co-infected BHK21 cells produced two populations of particles assembled from either FHV or NoV coat protein.

FIG. 6. Immunoprecipitation of F+N progeny particles followed by immunoblot analysis to probe for the presence of mosaic particles.

FIG. 6

Open in a new tab

F+N progeny particles gradient-purified from BHK21 cells were immunoprecipitated using mouse anti-FHV antiserum and Protein-G beads. The total input protein (T), supernatant (S) and pellet (P) fractions were then analyzed by immunoblot with rabbit anti-FHV (left panel) and rabbit anti-NoV (right panel) antibodies to probe for the presence of the respective coat proteins. Native FHV and NoV particles isolated from infected insect cells were used as positive controls (C) in immunoblots.

FHV and NoV trans-encapsidate each others’ RNAs

We next investigated what viral RNAs were packaged in the two types of particles. To this end, F+N particles were subjected to immunoprecipitation with either FHV or NoV antiserum and RNA was extracted from the purified particle populations. Analysis by gel electrophoresis showed that both types of particles contained two major RNA species co-migrating with nodaviral RNA1 and RNA2 (Fig. 7A). A minor band located between RNA1 and RNA2 was also detected and may have represented a defective interfering RNA, which is often observed at that position (Venter et al., 2009). This band was not detected in each experiment. Subsequent RT-PCR of the extracted RNA with primers specific for the four genome segments revealed that all were present in both types of particles (Fig. 7B). Thus, the FHV and NoV coat proteins had packaged their own RNAs as well as the RNAs of the heterologous virus. We could not pursue a more quantitative approach to evaluate the RNA contents of particles produced in dually infected cells because, as indicated above, the particle population as a whole contained a background of progeny produced in cells that had received only one viral genome during transfection. The presence of this background made meaningful numerical measurements impossible.

FIG. 7. Electrophoretic and RT-PCR analysis of RNA extracted from subpopulations of F+N particles.

FIG. 7

Open in a new tab

Purified F+N progeny particles were subjected to immunoprecipitation with either mouse anti-FHV or rabbit anti-NoV antibodies to isolate particle subpopulations assembled from either FHV coat protein or NoV coat protein. (A) RNA was extracted from these subpopulations by phenol-chloroform and electrophoresed through a non-denaturing agarose gel. M: RNA size marker: FHV: control RNA from native FHV particles; NoV: control RNA from native NoV particles; α-FHV: RNA from particle subpopulation obtained with anti-FHV antibodies; α-NoV: RNA from particle subpopulation obtained with anti-NoV antibodies. (B) The extracted RNA was analyzed by RT-PCR with specific primers to determine the identity of viral RNAs packaged in the two subpopulations. Lanes 1-4, positive and negative controls for FHV RNA1 and 2; Lanes 5-8, positive and negative controls for NoV RNA1 and 2; Lanes 9-12, RNA from a-FHV subpopulation amplified using primers specific for FHV RNA1 (Lane 9), FHV RNA2 (Lane 10), NoV RNA1 (Lane 11) and NoV RNA2 (Lane 12); Lanes 13-16, RNA from α-NoV subpopulation amplified using primers specific for FHV RNA1 (Lane 13), FHV RNA2 (Lane 14), NoV RNA1 (Lane 15) and NoV RNA2 (Lane 16).

To provide independent confirmation that FHV particles had packaged the NoV genomic segments, Drosophila S2 cells were infected with F+N particles using a theoretical multiplicity of infection (moi) of 100. The theoretical moi was based on the number of particles in the sample, as determined by UV spectroscopy, using a particle:pfu ratio of 300. This value represents the known ratio for FHV but the true moi was likely to be considerably lower as NoV particles cannot infect S2 cells. Infected cells were processed 12 hours later for fluorescence in situ hybridization (FISH) with probes for detection of (+)-sense progeny RNA1 and RNA2 of FHV and NoV. Probes for detection of RNA1 were designed such that they did not bind to the region that gives rise to the subgenomic RNA3 in order to allow unequivocal identification of RNA1. In addition, RNA that might have been encapsidated at the time of analysis was made accessible to the probes by a protease treatment included in the standard protocol for FISH analysis. As shown in figure 8, a large number of cells was positive for the presence of FHV RNAs. More importantly, numerous cells in the population were positive for the presence of NoV RNA1 and a slightly smaller number were positive for the presence of both NoV RNA1 and RNA2. This result was further corroborated by immunofluorescene analysis, which confirmed the presence of NoV coat protein in a fraction of (F+N)-infected cells (not shown). Taken together, these data implied that FHV particles in the inoculum contained NoV RNAs, which had been delivered in a biologically active form to a type of cell that NoV particles do not normally infect. The reciprocal experiment could not be performed given the lack of a cell line that can be infected by NoV but not FHV.

FIG. 8. Fluorescence in situ hybridization (FISH) of FHV and NoV RNAs in Drosophila S2 cells infected with F+N particles.

FIG. 8

Open in a new tab

F+N particles from co-transfected BHK cells were used to infect Drosophila S2 cells at a theoretical moi of 100. Cells were processed for FISH at 12 hours post infection with probes specific for positive-sense viral RNAs. (A) Detection of FHV RNAs with probes against RNA1 (FITC, green) and RNA2 (Cy3, red). Yellow indicates co-localization of the two RNAs. (B) Detection of NoV RNAs with probes against RNA1 (Cy3, red) and RNA2 (FITC, green). Yellow indicates co-localization of both RNAs in the same cell. Shown are four separate fields of view to illustrate the distribution of NoV RNAs in the population of cells. Images represent single optical sections. Scale bar = 10 μm.

RNAs 1 and 2 are trans-encapsidated independently of each other

Nodaviral coat proteins select one copy of each genomic segment for packaging into the same particle. One of the mechanisms that could explain co-packaging of the two RNAs proposes formation of a non-covalent complex by base pairing involving specific regions of the two RNAs. Based on the results described above, it was not clear whether packaging of NoV RNAs into FHV capsids required the presence of both NoV RNA1 and RNA2 and vice versa. To test this, FHV RNA1 and RNA2 were mixed with NoV RNA1 and transfected into BHK21 cells. After 48 hours, progeny particles were purified, RNA extracted and analyzed by RT-PCR with primers specific for FHV RNA1 and NoV RNA1. As shown in figure 9A, NoV RNA1 was present in FHV particles, indicating that it could be packaged independently of NoV RNA2. Analogous results were obtained for the opposite experiment, showing that FHV RNA1 could be packaged into NoV particles independently of FHV RNA2 (Fig. 9B).

FIG. 9. RT-PCR analysis of RNA extracted from particles generated in the presence of three replicating nodaviral RNAs.

FIG. 9

Open in a new tab

BHK21 cells were transfected with a mixture containing both FHV RNAs plus NoV RNA1 or vice versa and progeny particles were gradient-purified 48 hours later. Packaged RNA was extracted, amplified with FHV or NoV RNA1-specific primers and products analyzed on a 1% agarose gel stained with ethidium bromide (A) Cells were transfected with both FHV RNAs and NoV RNA1. + and - represent positive and negative control reactions for primers indicated below the gel. F(1+2)/N1 indicates that RNA from purifildjparacles was used for RT-PCR. (B) Cells were transfected with both NoV RNAs and FHV RNA1. + and - represent positive and negative control reactions for primers indicated below the gel. N(1+2)/F1 indicates that RNA from purified particles was used for RT-PCR.

To further understand the trans-encapsidation phenomenon, we examined the cellular distribution of (+)-sense viral RNAs in co-transfected BHK21 cells by FISH at 15 hours post transfection. As seen in figure 10, RNA1 and RNA2 from both viruses were found distributed throughout the cytoplasm in a reticular pattern that was somewhat reminiscent of the pattern observed for the coat proteins (see Fig. 1). Superimposition of fluorescence signals representing FHV and NoV RNA1 (Fig. 10A) or RNA2 (Fig. 10B) showed that there was a high degree of co-localization between the RNAs of the two viruses. These results indicated that both viruses adhere to a similar, if not identical, program by which they distribute their macromolecules in the cell, thereby establishing the conditions for RNA trans-encapsidation and formation of hybrid viruses.

FIG. 10. Cellular distribution ofFHV and NoV RNAs in co-transfected BHK21 cells.

FIG. 10

Open in a new tab

BHK-21 cells co-transfected with FHV and NoV RNAs 1 and 2 were fixed 15 hours later and processed for fluorescence in situ hybridization using probes specific for positive strand viral RNAs. (A) Probes against RNA1 (FITC (green) for FHV RNA1 and Cy3 (red) for NoV RNA1) did not hybridize to the region that gives rise to the subgenomic RNA3. (B) Probes against RNA2 were labeled with FITC (green) for NoV RNA2 and Cy3 (red) for FHV RNA2. Merged images show an overlay of FHV and NoV RNA1 (A) and RNA2 (B) with regions in yellow representing co-localization. Boxed regions were magnified approximately 7-fold. Z-series projections of several optical sections are shown.

DISCUSSION

We studied the outcome of nodaviral co-infections using two distantly related members of the Alphanodavirus genus to further explore the mechanism underlying selection and co-packaging of the bipartite genome. A key prerequisite of our experiments was that the coat proteins of the two viruses did not form mosaic particles, as this would have made RNA packaging results uninterpretable relative to the mechanisms used by the individual viruses. As shown, mosaic capsids were indeed undetectable and this was consistent with our knowledge of the high resolution structures of the two viruses. While the tertiary fold of the FHV and NoV capsid proteins and the architecture of the virus particles are highly conserved (Fisher and Johnson, 1993; Zlotnick et al., 1997), there are considerable differences in the details. In particular, given the significant divergence of the proteins at the primary sequence level (Kaesberg, 1990), there are notable variations in the amino acids that are used to establish subunit-subunit interactions in the protein shell and based on these differences it was anticipated that FHV and NoV subunits would be highly unlikely to form stable, mosaic particles. Nevertheless, electron microscopic analysis of particles purified from co-infected cells showed that some were slightly more stain-penetrable than native virions and a very small number appeared to be misformed. Such capsids may have resulted from situations where coat protein assembled around heterologous RNA as we have noted in the past that foreign RNAs can give rise to particles that show structural defects (Dong et al., 1998).

We also confirmed previous results pointing at a possible incompatibility between the two viruses at the level of RNA replication. Specifically, we showed that neither viral polymerase was able to use RNA2 of the heterologous virus as a template for RNA synthesis. The 3’ ends of FHV and NoV RNA2, as well as those of the alphanodaviruses black beetle virus (BBV) and Boolara virus (BoV), can be folded into two small, consecutive stem-loops (Kaesberg, 1990), which are similar for FHV, BBV and BoV RNA2, but distinct for NoV RNA2. It has been suspected that these stem loops represent important cis-acting elements for RNA2 replication and this was recently confirmed for NoV using mutational analyses (Rosskopf et al., 2010). It was therefore not surprising that NoV RdRp did not recognize FHV RNA2 as a template for replication and vice versa. It is likely that the same is true for the respective RNA1 segments but this is technically more difficult to prove as autonomous replication of RNA1 by the RdRp encoded in cis must be inhibited prior to testing ability of the enzyme to replicate a heterologous RNA1, whose own RdRp has to be rendered inactive.

A complication of our experimental set-up resided in the fact that we could not infect cells with the two viruses but had to transfect them with RNAs that were either extracted from purified virus particles or synthesized by in vitro transcription. The transfection procedure is inherently inefficient, but more importantly, it resulted in a fraction of cells acquiring only a subset of the RNAs of interest. This led to a background of cells infected by only one virus or cells containing self-replicating RNA1 of either NoV or FHV. The presence of this background interfered with a rigorous, quantitative analysis of our results and they remain therefore qualitative at this point.

We monitored the results of RNA transfection by confocal immunofluorescence microscopy using antisera against NoV and FHV coat proteins. The RNA replication incompatibility between the two viruses enabled us to conclude that cells containing both types of coat protein had acquired all four RNAs. Coat protein in FHV-infected BHK21 cells was known from a previous study to be distributed throughout the cytoplasm in a reticular pattern (Petrillo et al., 2013), which is also observed in FHV-infected Drosophila cells (Venter et al., 2009). Here we found that NoV coat protein is distributed in the same manner and that it appears to co-localize with that of FHV in dually infected cells. Similarly, FISH analysis revealed that the viral RNAs assume similar subcellular distributions and together these results argue against the idea that the viruses set up distinct cellular microenvironments in which they execute their replicative programs and assemble progeny virus particles. This raises the question of how NoV and FHV RNA polymerases and associated replication complexes are distributed in co-infected cells. Both enzymes are known to be located on the outer mitochondrial membrane and in dually infected cells could be either positioned on separate or the same organelles. Either arrangement is intriguing, the former because it would require a mechanism that regulates trafficking of the proteins to separate mitochondria, the latter because mutual interference of the enzymes in a mixed arrangement on the same membrane would have to be avoided. This is relevant as FHV RNA replication, and presumably NoV RNA replication as well, induces spherules, i.e. invaginations in the outer mitochondrial membrane, that are lined with RdRp molecules (Kopek et al., 2007). The two enzymes would have to partition into different areas and form separate spherules with their cognate viral RNAs, a process that would require a high degree of coordination and could be facilitated by protein-protein interactions specific to the RdRp molecules of each virus. Unfortunately, we were unable to further investigate which of these two scenarios might be employed, as we currently do not have antibodies against the NoV polymerase and attempts to generate functional, epitope-tagged derivatives of this protein failed.

Having established that co-infected cells did not give rise to mosaic particles we initially attempted to separate progeny FHV from NoV particles by ion exchange chromatography. However, NoV particles were not stable under the relatively high salt conditions required for elution of the capsids from the column and we thus used immunoprecipitation with specific antisera to obtain separate FHV and NoV populations. RT-PCR analysis showed that each population contained all four viral RNAs, indicating that both capsid proteins had selected their cognate genome segments as well as those of the other virus for packaging. Given the sensitivity of RT-PCR, we used a stringent biological assay to confirm this result and exclude the possibility that it reflected the presence of contamination by the other type of particle. Specifically, we took advantage of the fact that Drosophila cells can be infected by FHV but not NoV capsids and demonstrated that inoculating the cells with the mixture of particles obtained form dually infected BHK21 led to replication of NoV RNA1 and RNA2 in S2 cells.

Because these types of analyses are performed on a population of particles, it was unclear how the four segments were distributed in individual FHV and NoV capsids. This knowledge, however, could provide important clues about the selection of the RNAs for encapsidation and the parameters that must be satisfied for co-packaging of RNA1 and RNA2. To further explore whether co-packaging is based on recognition of a pair of viral RNAs from the same virus, we performed experiments in which FHV RNAs were mixed with NoV RNA1 and vice versa prior to transfection of BHK21 cells. As shown, RNA1 of the heterologous virus was detected in progeny particles, indicating that the mechanism for co-packaging does not rely on features displayed by a cognate pair of RNA1 and RNA2. These results, combined with our previous data, which showed preferential encapsidation of RNA1 or RNA2 by certain FHV coat protein mutants (Marshall and Schneemann, 2001; Schneemann and Marshall, 1998; Venter et al., 2009), support the notion that nodaviral RNAs are recognized for packaging independently of each other.

Taken together, our data lead us to conclude that nodaviral RNAs lack specific signals that direct them towards their cognate capsid proteins. Nevertheless, they must have common features that make them preferred targets for encapsidation relative to cellular RNA. These features probably reside in their ability to fold readily into secondary and tertiary structures that satisfy the arrangement of nucleic acid observed in the three-dimensional structures of the virus particles, specifically the formation of dsRNA segments at defined locations. This arrangement is unlikely to exist in the naked RNAs but is most likely induced by the interaction with assembling coat protein subunits. The assembly scenario that we envision follows a model recently proposed by Borodavka et al. (Borodavka et al., 2012), in which multiple coat protein subunits simultaneously but independently bind to numerous distinct, yet functionally equivalent packaging sites (e.g. small stem-loops) in the viral RNA, followed by condensation of the subunits into an icosahedral particle with concurrent refolding of the RNA. Such a mechanism naturally requires that viral RNA synthesis is complete prior to assembly and that the RNAs do not establish extensive interactions with other viral or cellular RNA binding proteins prior to encapsidation. For nodaviral RNAs it is known that RNA packaging occurs with a significant delay after synthesis (Gallagher and Rueckert, 1988), suggesting that a mechanism as described would be possible. Instead of binding to stem-loops, however, it has been hypothesized that nodaviral coat protein binding sites are likely to reside in the core or framework of the RNA, possibly including pre-formed dsRNA regions (Harvey et al., 2013).

Taking into account the common location of FHV and NoV coat proteins and RNAs in co-infected cells, assembly would then lead to non-selective viral RNA packaging, while discrimination apparently occurs at the level of protein-protein interactions, preventing formation of mosaic capsids. Compared to formation of particles in singly infected cells, however, one might expect a negative effect on assembly kinetics, because the two types of coat protein would presumably interact at random with accessible binding sites on a given RNA and multiple protein dissociation and re-association events would have to take place before a capsid can be completed.

In summary, we have shown that cells infected with two distantly related nodaviruses form viral progeny in which the coat proteins segregate into separate capsids while the genomes are trans-encapsidated. The observed RNA packaging phenotypes are consistent with the hypothesis that the RNAs lack specific packaging signals and are more likely to have structural features that promote their encapsidation. RNA1 and RNA2 can be re-assorted in different combinations into hybrid progeny indicating that they are recognized and packaged independently of each other. The mechanism that controls encapsidation of the two RNAs into a single particle requires further investigations.

MATERIALS AND METHODS

Cells

Baby hamster kidney (BHK21) and BSR-T7 cells were maintained at 37°C, 5% CO2. BHK21 cells were propagated as monolayers in high-glucose Dulbecco’s Modified Eagle Medium (DMEM, Invitrogen 10313-021) supplemented with 5% (v/v) heat-inactivated fetal bovine serum, 2 mM L-glutamine, 100 U/ml penicillin and 100 g/ml streptomycin. Medium used for propagation of BSR-T7 cells contained the following additional supplements: 10 mM HEPES pH 7.5, 0.52% (w/v) glucose, 1 mM sodium pyruvate and, in alternate passages, 200 g/ml of G418 (Teknova G5005). BHK21 and BSR-T7 cells transfected or electroporated with viral RNA were maintained at 28°C, 5% CO2. Drosophila melanogaster line-2 (S2) monolayers were maintained at 27°C in Schneider’s insect medium (SchIM) supplemented with 15% (v/v) heat-inactivated fetal bovine serum, 100 U/ml penicillin, and 100 g/ml streptomycin.

Antibodies and fluorescence reagents

Monoclonal mouse antibodies to FHV RdRp were a generous gift from Paul Ahlquist, University of Wisconsin-Madison. MitoTracker Red CMH2Xros, DAPI (4’,6-diamidino-2-phenylindole) and Alexa Fluor secondary antibodies were from Invitrogen. IRDye 800CW (goat anti-mouse) and IRDye 680LT (goat anti-rabbit) secondary antibodies were from LICOR biosciences. Rabbit polyclonal serum against NoV was a generous gift from Roland Rueckert, University of Wisconsin-Madison. Mouse polyclonal serum against FHV was raised against wildtype FHV VLPs.

Plasmids and RNA transcripts

FHV RNA1 was generated by transfecting 5 μg of plasmid FHV (1,0) (Ball, 1995) into BSR-T7 cells (90% confluent monolayer in a 35 mm dish) and incubating them for 48 h at 28°C. Total RNA was extracted and 500 ng were re-transfected into fresh BSR -T7 cells to further amplify RNA1. Total RNA was extracted from the second batch of cells 24 h later. NoV RNA1 was generated in a similar manner by transfecting 5 μg of plasmid, pSVNodaWT, kindly provided by L. Gitlin and R. Andino, University of California, San Francisco, into BHK21 cells and re-amplifying as described above. These total RNA samples, adjusted to contain equivalent amounts of viral RNA, were used as sources for FHV and NoV RNA1. FHV RNA2 transcripts were generated as described previously (Schneemann and Marshall, 1998). Briefly, plasmid p2BS (+)-WT was linearized with XbaI and used as a template for in vitro transcription using the mMessage mMachine T3 Kit (Ambion AM1348). To generate NoV RNA2 transcripts, the full-length cDNA sequence was amplified from plasmid pCR2, kindly provided by L. Gitlin and R. Andino, UCSF. Primers used were EcoRIT7NR2S (gaattctaatacgactcactatagtaaacaaccaataacatcatg) and XbaI3'UTR (gctctagaccaagaggttgaagaccc). The amplified product was digested with EcoRI and XbaI and inserted into pBluescript KS (+) linearized with the same enzymes. The NoV RNA2 cDNA in the resulting plasmid (pNR2pBS) was amplified by PCR using primers T3NR2pBS (aattaaccctcactaaagtaaacaaccaataacatca) and XbaI3'UTR. The purified PCR product was used as a template for in vitro transcription of NoV RNA2 with the mMessage Machine T3 Kit.

Liposome-mediated RNA transfection of BHK-21 cells

Liposome-mediated RNA transfection was used for small scale experiments. To this end, 4×105 BHK21 cells were cultured overnight in 35-mm tissue culture dishes (Corning 430165), washed once with 1 ml PBS containing calcium and magnesium (Cellgro 21-030-CV) and covered with 900 μl of serum-and antibiotic-free DMEM. RNA-liposome complexes were prepared as follows: 15 μl of Lipofectamine 2000 (Invitrogen 11668-019) were diluted to 50 μl with serum- and antibiotic-free medium and incubated at room temperature for 5 min. FHV vRNA (200 ng), NoV vRNA (200 ng) or a mixture of both in 50 μl of serum- and antibiotic-free medium was added. Alternatively, total cellular RNA containing FHV RNA1 and/or NoV RNA1 (approximately 500 ng each containing equal amounts of the viral RNA) and 200 ng in vitro synthesized RNA2 transcripts were added. RNA-liposome complexes were allowed to form at room temperature for 20 min. and were then applied directly to the cells. After a 4 h incubation period at 28°C, serum- and antibiotic-free medium was replaced with 2 ml of complete growth medium. Incubation was continued at 28°C. Total cellular RNA was extracted 24 hours post transfection, virus particles purified at 48 h.

Electroporation of BHK21 cells

For large scale experiments cells were transfected with RNA using electroporation. To this end, BHK21 cells were grown overnight in several T75 flasks (Sarstedt 83.1811) to approximately 80% confluency, trypsinized and collected by centrifugation at 250 × g for 5 min. Cells from each flask were washed once with PBS lacking divalent cations, centrifuged again, resuspended in 800 μl PBS and transferred to a chilled 0.4 cm cuvette (Invitrogen 65-0032). FHV vRNA, NoV vRNA or both were added in 10 μg quantities and cells were pulsed at 0.85 kV, 25 μF with a final pulse length of 0.4 msec (Bio-Rad Gene Pulser II). Electroporated cells were immediately diluted with 12 ml chilled growth medium and 2 ml aliquots were transferred to 60 mm tissue culture dishes (Sarstedt 83.1801). The cells were incubated for 48 h at 28°C before further processing.

Gradient-purification of virus particles

At 48 h post transfection or electroporation, BHK21 cells were lysed by addition of NP-40 substitute (Fluka 74835) to a final concentration of 1% (v/v). After 10 min. on ice, cell debris was pelleted at 13,751 × g for 10 min at 4°C. The supernatant was treated with RNase A at a final concentration of 10 μg/ml for 30 min at 27°C and particles were then pelleted through a 30% (wt/wt) sucrose cushion in 50 mM HEPES pH7 at 140,435 × g (SW32Ti rotor, 28,700 rpm) for 5.5 h. The pellet was resuspended in 0.2 ml of 50 mM HEPES pH7, clarified by brief centrifugation at 16,168 × g in a microfuge and subjected to sedimentation through a 10-40% (wt/wt) sucrose gradient in 50 mM HEPES pH7 at 273,865 × g (SW41 rotor, 40,000 rpm) for 1.5 h. Particles were harvested from the gradients by needle puncture.

Immunoprecipitation of virus particles

Immunoprecipitation was performed with a Protein G immunoprecipitation kit (Roche 11719386001) according to protocols provided by the manufacturer. In brief, 50 μl of protein G beads were used in conjunction with 20 μl of mouse anti-FHV antibody to precipitate 10 μg of gradient-purified virus particles. The mixtures were incubated overnight at 4°C on a rocking platform. Immune complexes were collected by centrifugation and washed four times with buffers containing different salt and detergent concentrations. The first supernatant fraction from each experiment was concentrated approximately four-fold in a Savant SpeedVac concentrator and subjected, together with the immunoprecipitated particles, to immunoblot analysis with either rabbit anti-FHV or anti-NoV antibodies. For larger scale experiments, 54 μg of gradient-purified virus particles were immunoprecipitated with 100 μl protein G beads and 50 μl of mouse anti-FHV or rabbit anti-NoV antibody. The final pellet was subjected to phenol-chloroform extraction and ethanol precipitation to recover packaged RNA.

Immunoblot analysis

SDS gel electrophoresis and immunoblot analysis were carried out as described previously (Dong et al., 1998) with the following modifications: for immunoblot of virus particles from singly and co-transfected BHK21 cells, mouse and rabbit secondary antibodies from LICOR biosciences were used at a 1:13,000 dilution. The blots were scanned using an Odyssey imaging system and figures were generated using the associated application software (LICOR Biosciences).

Immunofluorescence microscopy and fluorescence in situ hybridization (FISH)

Transfected BHK21 cells were grown in poly-d-lysine-coated 35-mm glass bottom dishes (MatTek Corporation P35GC-1.5-14-C). At the indicated times, they were washed in PBS containing 1 mM EGTA and 1 mM MgCl2 and fixed for 10 min. in 0.5 ml of the same buffer containing 0.3% glutaraldehyde (Sigma G5882), 3% paraformaldehyde (EM Sciences 15710), and 1 mg/ml saponin (Sigma S4521-10G). Antibody labeling, mitotracker staining and confocal microscopy were performed as described previously (Venter et al., 2009). For FISH analysis of Drosophila cells, 2×106 S2 cells were infected with F+N particles at an moi of 100 and plated on ConA-coated 35-mm glass bottom dishes (MatTek Corporation P35G-1.5-14-C). Cells were fixed at 12 hpi and FISH was carried out using the QuantiGene® ViewRNA ISH Cell Assay kit (Affymetrix QVC0001) with custom-designed probes directed against positive-sense FHV RNA1 (VF4-14080-01), FHV RNA2 (VF1-13994-01), NoV RNA1 (AF174533) and NoV RNA2 (AF174534) according to the manufacturer's instructions and as described previously (Petrillo et al., 2013).

Electron microscopy

A 5 μl drop of gradient-purified virus particles (1 mg/ml) was applied to a glow-discharged carbon coated copper grid (Ted Pella Inc.) and allowed to adsorb for 1 min. Excess solution was removed with filter paper and the grids were washed three times by floating them on droplets of PBS and blotting with filter paper in between. Each grid was then washed two times with a drop of 2% (w/v) uranyl acetate and floated on a third drop for 1 min. The grid was then blotted and air-dried. Samples were viewed in a Tecnai Spirit transmission electron microscope operating at 120 kV. To visualize mitochondria, BHK21 cells transfected with FHV RNA1 were processed as described previously (Gilula et al., 1978). Briefly, cells were fixed with 2.5% glutaraldehyde in 0.1M cacodylate buffer, washed and postfixed with 1% osmium tetroxide. Fixed cells were treated with 0.5% tannic acid in 1% sodium sulfate buffer, dehydrated, transferred to 2-hydroxypropyl methacrylate and embedded in LX112 (Ladd Research, Williston, VT). Thin sections (60 nm) were stained with uranyl acetate and lead citrate and examined in a Philips CM100 electron microscope operated at 80 kV.

RT-PCR

RT-PCR was performed using the OneStep RT-PCR kit (QIAGEN 210210) following recommendations by the manufacturer. Briefly, a 25 μl reaction mixture was set up using a final concentration of 0.6 μM for each primer and 20 ng of template RNA mixture. The reaction cycle started with a 50°C reverse transcription for 30 min, a 95°C incubation for 15 min to inactivate the reverse transcriptase, 29 cycles of PCR amplification (94°C for 30 sec, annealing for 30 sec, 72°C for 60 sec) and a final extension at 72°C for 10 min. Annealing temperatures of 60°C (FHV RNA1) and 55°C (FHV RNA2, NoV RNA1 and NoV RNA2) were used. Each primer pair used was confirmed to be specific for a given viral RNA of interest. Primers corresponded to the following regions: nucleotides (nts) 142-163 and 399-379 for NoV RNA1; nts181-201 and 400-380 for NoV RNA2; nts 2800-2819 and 3107-3087 for FHV RNA1; nts 116-135 and 400-383 for FHV RNA2.

We explored formation of reassortants between the nodaviruses FHV and NoV

In mixed infections the viruses were incompatible at the level of RNA replication

Their coat proteins segregated into separate particles

RNA packaging was indiscriminate

The results suggest that nodaviral RNAs lack rigorously defined packaging signals

ACKNOWLEDGMENTS

This work was supported by National Institutes of Health grant GM053491. We thank Malcolm R. Wood and Theresa A. Fassel at the TSRI Core Microscopy Facility for help in preparing the electron micrographs shown in figure 2.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

REFERENCES

  1. Ball LA. Requirements for the self-directed replication of flock house virus RNA 1. J. Virol. 1995;69:720–727. doi: 10.1128/jvi.69.2.720-727.1995. [published erratum appears in J Virol 1995 Apr;69(4):2722]. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ball LA, Amann JM, Garrett BK. Replication of nodamura virus after transfection of viral RNA into mammalian cells in culture. J. Virol. 1992;66:2326–2334. doi: 10.1128/jvi.66.4.2326-2334.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Borodavka A, Tuma R, Stockley PG. Evidence that viral RNAs have evolved for efficient, two-stage packaging. Proc Natl Acad Sci U S A. 2012;109:15769–15774. doi: 10.1073/pnas.1204357109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chao JA, Lee JH, Chapados BR, Debler EW, Schneemann A, Williamson JR. Dual modes of RNA-silencing suppression by Flock House virus protein B2. Nat. Struct. Mol. Biol. 2005;12:952–957. doi: 10.1038/nsmb1005. [DOI] [PubMed] [Google Scholar]
  5. Choi YG, Dreher TW, Rao AL. tRNA elements mediate theassembly of an icosahedral RNA virus. Proc Natl Acad Sci U S A. 2002;99:655–660. doi: 10.1073/pnas.022618199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Devkota B, Petrov AS, Lemieux S, Boz MB, Tang L, Schneemann A, Johnson JE, Harvey SC. Structural and electrostatic characterization of pariacoto virus: implications for viral assembly. Biopolymers. 2009;91:530–538. doi: 10.1002/bip.21168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Dong XF, Natarajan P, Tihova M, Johnson JE, Schneemann A. Particle polymorphism caused by deletion of a peptide molecular switch in a quasi-equivalent virus. J. Virol. 1998;72:6024–6033. doi: 10.1128/jvi.72.7.6024-6033.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Fisher AJ, Johnson JE. Ordered duplex RNA controls capsid architecture in an icosahedral animal virus. Nature. 1993;361:176–179. doi: 10.1038/361176a0. [DOI] [PubMed] [Google Scholar]
  9. Friesen PD, Rueckert RR. Synthesis of Black Beetle Virus Proteins in Cultured Drosophila Cells: Differential Expression of RNAs 1 and 2. J. Virol. 1981;37:876–886. doi: 10.1128/jvi.37.3.876-886.1981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Galiana-Arnoux D, Dostert C, Schneemann A, Hoffmann JA, Imler JL. Essential function in vivo for Dicer-2 in host defense against RNA viruses in drosophila. Nat Immunol. 2006;7:590–597. doi: 10.1038/ni1335. [DOI] [PubMed] [Google Scholar]
  11. Gallagher T, Rueckert RR. Assembly-dependent maturation cleavage in provirions of a small icosahedral insect ribovirus. J. Virol. 1988;62:3399–3406. doi: 10.1128/jvi.62.9.3399-3406.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gallagher TM. PhD Thesis. University of Wisconsin-Madison; Madison: 1987. Synthesis and assembly of nodaviruses. [Google Scholar]
  13. Garzon S, Charpentier G. Nodaviridae. In: Adams JR, Bonami JR, editors. Atlas of Invertebrate Viruses. Boca Raton. CRC Press; 1991. pp. 351–370. [Google Scholar]
  14. Garzon S, Strykowski H, Charpentier G. Implication of mitochondria in the replication of Nodamura virus in larvae of the Lepidoptera, Galleria mellonella (L.) and irlfuckling mice. Arch Virol. 1990;113:165–176. doi: 10.1007/BF01316670. [DOI] [PubMed] [Google Scholar]
  15. Gilula NB, Epstein ML, Beers WH. Cell-to-cell communication and ovulation. A study ofthe cumulus-oocyte complex. J Cell Biol. 1978;78:58–75. doi: 10.1083/jcb.78.1.58. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Harvey SC, Zeng Y, Heitsch CE. The icosahedral RNA virus as a grotto: organizing the genome into stalagmites and stalactites. J Biol Phys. 2013;39:163–172. doi: 10.1007/s10867-013-9312-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kaesberg P, Dasgupta R, Sgro J-Y, Wery J-P, Selling BH, Hosur MV, Johnson JE. Structural Homology Among Four Nodaviruses as Deduced by Sequencing and X-ray Crystallography. J. Mol. Biol. 1990;214:423–435. doi: 10.1016/0022-2836(90)90191-N. [DOI] [PubMed] [Google Scholar]
  18. Kopek BG, Perkins G, Miller DJ, Ellisman MH, Ahlquist P. Three-dimensional analysis of a viral RNA replication complex reveals a virus-induced mini-organelle. PLoS Biology. 2007;5:e220. doi: 10.1371/journal.pbio.0050220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Krishna NK, Schneemann A. Formation of an RNA heterodimer upon heating of nodavirus particles. J. Virol. 1999;73:1699–1703. doi: 10.1128/jvi.73.2.1699-1703.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Li H, Li WX, Ding SW. Induction and suppression of RNA silencing by an animal virus. Science (New York, N.Y. 2002;296:1319–1321. doi: 10.1126/science.1070948. [DOI] [PubMed] [Google Scholar]
  21. Marshall D, Schneemann A. Specific packaging of nodaviral RNA2 requires the N-terminus of the capsid protein. Virology. 2001;285:165–175. doi: 10.1006/viro.2001.0951. [DOI] [PubMed] [Google Scholar]
  22. Miller DJ, Ahlquist P. Flock house virus RNA polymerase is a transmembrane protein with amino-terminal sequences sufficient for mitochondrial localization and membrane insertion. J. Virol. 2002;76:9856–9867. doi: 10.1128/JVI.76.19.9856-9867.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Miller DJ, Schwartz MD, Ahlquist P. Flock house virus RNA replicates on outer mitochondrial membranes in Drosophila cells. J. Virol. 2001;75:11664–11676. doi: 10.1128/JVI.75.23.11664-11676.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Petrillo JE, Venter PA, Short JR, Gopal R, Deddouche S, Lamiable 0, Imler JL, Schneemann A. Cytoplasmic Granule Formation and Translational Inhibition of Nodaviral RNAs in the Absence of the Double-Stranded RNA Binding Protein B2. J. Virol. 2013;87:13409–13421. doi: 10.1128/JVI.02362-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Price BD, Eckerle LD, Ball LA, Johnson KL. Nodamura virus RNA replication in Saccharomyces cerevisiae: heterologous gene expression allows replication-dependent colony formation. J. Virol. 2005;79:495–502. doi: 10.1128/JVI.79.1.495-502.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Rosskopf JJ, Upton JH, 3rd, Rodarte L, Romero TA, Leung MY, Taufer M, Johnson KL. A 3' terminal stem-loop structure in Nodamura virus RNA2 forms an essential cis-acting signal for RNA replication. Virus Res. 2010;150:12–21. doi: 10.1016/j.virusres.2010.02.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Scherer WF, Hurlbut HS. Nodamura virus from Japan: a new and unusual arbovirus resistant to diethyl ether and chloroform. Am. J. Epidemiol. 1967;86:271–285. doi: 10.1093/oxfordjournals.aje.a120737. [DOI] [PubMed] [Google Scholar]
  28. Scherer WF, Verna JE, Richter W. Nodamura virus, an ether- and chloroform-resistant arbovirus from Japan: physical and biological properties, with ecologic observations. Am. J. Trop. Med. Hyg. 1968;17:120–128. doi: 10.4269/ajtmh.1968.17.120. [DOI] [PubMed] [Google Scholar]
  29. Schneemann A, Marshall D. Specific encapsidation of nodavirus RNA is mediated through the C terminus of capsid precursor protein alpha. J. Virol. 1998;72:8738–8746. doi: 10.1128/jvi.72.11.8738-8746.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Scotti PD, Dearing S, Mossop DW. Flock House virus: a nodavirus isolated from Costelytra zealandica (White) (Coleoptera: Scarabaeidae). Arch. Virol. 1983;75:181–189. doi: 10.1007/BF01315272. [DOI] [PubMed] [Google Scholar]
  31. Tang L, Johnson KN, Ball LA, Lin T, Yeager M, Johnson JE. The structure of pariacoto virus reveals a dodecahedral cage of duplex RNA. Nat Struct Biol. 2001;8:77–83. doi: 10.1038/83089. [DOI] [PubMed] [Google Scholar]
  32. Thiery R, Johnson KL, Nakai T, Schneemann A, Bonami JR, Lightner DV. Nodaviridae. In: King AMQ, Adams MJ, Carstens EB, Lefkowitz EJ, editors. Virus Taxonomy. Elsevier; Oxford: 2012. pp. 1061–1068. [Google Scholar]
  33. Tihova M, Dryden KA, Le TV, Harvey SC, Johnson JE, Yeager M, Schneemann A. Nodavirus coat protein imposes dodecahedral RNA structure independent of nucleotide sequence and length. J. Virol. 2004;78:2897–2905. doi: 10.1128/JVI.78.6.2897-2905.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Venter PA, Marshall D, Schneemann A. Dual roles for an arginine-rich motif in specific genome recognition and localization of viral coat protein to RNA replication sites in flock house virus-infected cells. J. Virol. 2009;83:2872–2882. doi: 10.1128/JVI.01780-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Venter PA, Schneemann A. Assembly of two independent populations of flock house virus particles with distinct RNA packaging characteristics in the same cell. J. Virol. 2007;81:613–619. doi: 10.1128/JVI.01668-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Zlotnick A, Natarajan P, Munshi S, Johnson JE. Resolution of space-group ambiguity and structure determination of nodamura virus to 3.3 A resolution from pseudo-R32 (monoclinic) crystals. Acta Crystallogr D Biol Crystallogr. 1997;53:738–746. doi: 10.1107/S0907444997007427. [DOI] [PubMed] [Google Scholar]

RESOURCES