Skip to main content
PLOS One logoLink to PLOS One
. 2014 Jun 10;9(6):e99411. doi: 10.1371/journal.pone.0099411

The Intestinal Archaea Methanosphaera stadtmanae and Methanobrevibacter smithii Activate Human Dendritic Cells

Corinna Bang 1, Katrin Weidenbach 1, Thomas Gutsmann 2, Holger Heine 3,#, Ruth A Schmitz 1,*,#
Editor: Benoit Foligne4
PMCID: PMC4051749  PMID: 24915454

Abstract

The methanoarchaea Methanosphaera stadtmanae and Methanobrevibacter smithii are known to be part of the indigenous human gut microbiota. Although the immunomodulatory effects of bacterial gut commensals have been studied extensively in the last decade, the impact of methanoarchaea in human's health and disease was rarely examined. Consequently, we studied and report here on the effects of M. stadtmanae and M. smithii on human immune cells. Whereas exposure to M. stadtmanae leads to substantial release of proinflammatory cytokines in monocyte-derived dendritic cells (moDCs), only weak activation was detected after incubation with M. smithii. Phagocytosis of M. stadtmanae by moDCs was demonstrated by confocal microscopy as well as transmission electronic microscopy (TEM) and shown to be crucial for cellular activation by using specific inhibitors. Both strains, albeit to different extents, initiate a maturation program in moDCs as revealed by up-regulation of the cell-surface receptors CD86 and CD197 suggesting additional activation of adaptive immune responses. Furthermore, M. stadtmanae and M. smithii were capable to alter the gene expression of antimicrobial peptides in moDCs to different extents.

Taken together, our findings strongly argue that the archaeal gut inhabitants M. stadtmanae and M. smithii are specifically recognized by the human innate immune system. Moreover, both strains are capable of inducing an inflammatory cytokine response to different extents arguing that they might have diverse immunomodulatory functions. In conclusion, we propose that the impact of intestinal methanoarchaea on pathological conditions involving the gut microbiota has been underestimated until now.

Introduction

Archaea belong to the second domain of Prokarya and their phylogenetic distance to Bacteria and Eukarya is reflected by genetic as well as structural differences [1]. Members of the domain archaea are ubiquitous and exist in a broad variety of habitats ranging from environments with temperatures above 100°C or with very high salinity (extremophiles) to ecosystems with mild growth conditions such as sewages, the oceans and soils (mesophils) [2][4]. Since archaea were originally described to occur only in extreme environments, their potential impact in the ecosystem of eukaryotes regarding physiology or pathogenicity was not considered for many years [5]. However, members of the archaea have currently been shown to appear frequently and in high numbers as part of the commensal microbiota found in insects, and mammals including humans [6][13]. Particularly, the methanoarchaeon Methanobrevibacter smithii has been shown to be the most abundant archaeon within the human intestine comprising up to 10% of all the present anaerobically growing microorganisms, and its quantities within the human gut have been shown to be stable over life time [6], [7], [10], [14]. By converting bacterial primary and secondary fermentation products, like hydrogen and carbon dioxide to methane, M. smithii is essential for syntrophic metabolisms within the microbial community in the human gut [7], [15], [16] and thus, plays a crucial role in energy balance [17]. Besides M. smithii, an additional member of the Methanobacteriales, Methanosphaera stadtmanae, has been detected in human stool samples, although in significant lower abundance [18], [19].

As a result of several reports on the apparent correlation between the quantities of methanoarchaea in the large intestine and the development of severe colon diseases, their role in pathogenicity has been addressed in a small number of studies [20][23]. In this respect, only few studies on the microbial diversity in individuals suffering from inflammatory bowel diseases proposed the involvement of human mucosa-associated methanoarchaea [24]. In general, it is currently assumed that methanoarchaea are able to promote the growth of pathogenic microbes and are thus indirectly involved in pathogenicity [5]. On the contrary, Blais-Lecours et al. provided evidence for immunogenical properties of M. smithii and M. stadtmanae in immunized mice and human serum [25], [26]; leading to the conclusion that methanoarchaea might be recognized by innate immune cells. Those cells recognize non-self molecules by numerous membrane-bound, cytosolic or secreted receptors (pattern recognition receptors, PRRs) and are thus the first line of defense against bacteria, fungi or viruses [27], [28]. By recognition and binding of microbe-associated molecular patterns (MAMPs) on the surface of microorganisms they activate innate immune responses such as production of cytokines, activation of the complement cascade or the release of antimicrobial peptides (AMPs) [27][29]. However, to date neither archaeal-associated molecular patterns nor human PRRs that recognize archaeal cells have been detected. Taking the unique composition and biochemical structure of methanoarchaeal cell envelopes and membranes as well as the previously detected immunogenic effects of methanoarchaeal cells into account [25], [26], [30][32], one can assume that methanoarchaea are (specifically) recognized by human immune cells. Consequently, we aimed to elucidate the activation of human immune cells in response to M. stadtmanae or M. smithii.

Materials and Methods

Ethics statement

Approval for these studies was obtained from the Institutional Ethics Committee at the University of Lübeck (Lübeck, Germany; Az. 12-202A) according to the Declaration of Helsinki. All donors gave written informed consent.

Strains and media

M. stadtmanae (DSM 3091) and M. smithii (DSM 861) were grown as described earlier and cell numbers were determined by microscopic counting using a Thoma counting chamber during the growth period [33]. Initial experiments were performed with viable and heat-inactivated (95°C for 10 min) cells of M. stadtmanae and M. smithii in minimal medium under strict anaerobic conditions at 37°C and in a humidified atmosphere of 5% carbon dioxide at 37°C for testing various viability conditions. Final immune cell stimulation experiments were carried out with exponentially growing M. stadtmanae and M. smithii cells that were centrifuged at 3200× g for 30 min, washed and resuspended in aerobic 50 mM Tris-HCl (pH 7.0).

Cell culture

Preparation of moDCs was performed by harvesting peripheral blood mononuclear cells (PBMCs) from heparinized blood of donors by Ficoll (PAA Laboratories GmbH, Pasching, Austria) separation [34] and subsequent isolation of monocytes by counter flow elutriation centrifugation [35]. MoDCs were then generated as described previously [36], harvested and re-cultured in RPMI medium (PAA Laboratories GmbH) supplemented with 10% FCS (Biochrom AG), 2 mmol/L glutamine (PAA Laboratories GmbH) and antibiotics (100 U/ml penicillin and 100 µg/ml streptomycin (both PAA Laboratories GmbH)) for stimulation experiments.

Caco-2/BBe cells (ATCC # CRL-2102, a gift from Dr. A. Frey, Research Center Borstel) were grown in DMEM with high glucose and stable L-glutamine (PAA Laboratories GmbH, Pasching, Austria) supplemented with 10% FCS (Biochrom AG, Berlin, Germany), 1% penicillin/streptomycin (PAA Laboratories GmbH), 10 µg/ml human transferrin (Roche Deutschland Holding GmbH) and 1 mM sodium pyruvate (PAA Laboratories GmbH).

Growth and transfection of HEK293 cells with the respective expression plasmids was carried out as described previously [37], [38] with the following additions: FLAG-TLR3 and -TLR5 have been obtained from P. Nelson (Seattle, USA); TLR7, 8, and 9 have been obtained from B. Beutler (Dallas, USA) and subcloned into pcDNA3.1 (Life Technologies GmbH). The respective control stimuli Poly IC, R848, Flagellin, E. coli K12, DAP and MDP were obtained from InvivoGen (San Diego, USA), Pam3CSK4 was purchased from EMC microcollections GmbH (Tübingen, Germany) and LPS from Salmonella enterica sv. Friedenau was a gift from Dr. Helmut Brade (Research Center Borstel).

All cells were grown and incubated in a humidified atmosphere of 5% carbon dioxide at 37°C.

Cytokine Measurements

Released cytokine concentrations in supernatants of moDCs after 24 h were determined by using commercial ELISA Kits (Life Technologies GmbH) specific for IL-1β, IL-8 and TNF-α.

Confocal laser scanning microscopy

For confocal laser scanning microscopy 105 moDCs were incubated at 37°C for 2 h on glass cover slips prior addition of 1 µM CytD in DMSO or DMSO alone for control. After 30 min preincubation, moDCs were stimulated with methanoarchaeal cells for 4 h and labeled with LysoTracker Red DND-99 (1∶1000, Sigma-Aldrich Chemie GmbH, Hamburg, Germany). After fixation in 3% paraformaldehyde, moDCs were labeled with Hoechst 33342 (1∶3000, (Life Technologies GmbH)). Images were captured using LSM 510 confocal microscopy (Zeiss) with Leica confocal software.

Electron microscopy

For TEM analysis 106 moDCs were stimulated for 4 h with 108 methanoarchaeal cells in 24-well plates (Corning Incorporated), washed with PBS and resuspended in 1 ml PBS containing 2.5% glutaraldehyde. The following probe preparation and TEM analysis was performed as described previously [39].

Quantitative Real-Time (RT)PCR

Total RNA was isolated by the use of NucleoSpin RNA II kit (Macherey-Nagel GmbH & Co. KG, Düren, Germany) and reverse-transcribed using the SuperScript III Reverse Transcriptase (Life Technologies GmbH). Primers that were used for quantitative RT-PCR analysis are listed in Table 1. Amplification was carried out in a LightCycler 480 instrument (Roche Deutschland Holding GmbH, Grenzach-Wyhlen, Germany) using the SYBR Green I Mastermix (Roche Deutschland Holding GmbH) according to the manufacturer's protocol. Relative quantification of mRNA was calculated with the LightCycler 480 Software, Version 1.5.

Table 1. Primer used for quantitative RT-PCR.

Primer name Forward primer (5′→3′) Reverse primer (3′→5′)
LL37/CAMP18 TCGGATGCTAACCTCTACCG ACAGGCTTTGGCGTGTCT
HBD1 TGTCTGAGATGGCCTCAGGT GGGCAGGCAGAATAGAGACA
HBD2 TCAGCCATGAGGGTCTTGTA GGATCGCCTATACCACCAAA
HBD3 TTCTGTTTGCTTTGCTCTTCC CGCCTCTGACTCTGCAATAA
HBD4 GCCGGAAGAAATGTCGCAGC AGCGACTCTAGGGACCAGCA
HD5 GCCATCCTTGCTGCCATTC TGATTTCACACACCCCGGAGA
HD6 CCTCACCATCCTCACTGCTGTTC CCATGACAGTGCAGGTCCCATA
HPRT GTCAGGCAGTATAATCCAAAGA GGGCATATCCTACAACAAACT
TNF-α CCTGTAGCCCATGTTGTAGCA TTGAAGAGGACCTGGGAGTAG
IL-1β TGGGCCTCAAGGAAAAGAATC GGGAACTGGGCAGACTCAAAT
IL-8 TTGCCAAGGAGTGCTAAAGAA CAACCCTACAACAGACCCACAC

Fluorescence activated cell sorting (FACS)

FACS analysis of 2×105 moDCs after 24 and 48 h of stimulation with the methanoarchaeal strains was performed after washing moDCs with phosphate buffered saline (PBS) containing sodium azide, centrifugation and incubation for 30 min with antibodies labeled either with phycoerythrin (PE) or fluorescein isothiocyanate (FITC) (BD Biosciences, San Rose, USA). Labeled moDCs were washed, fixed in PBS and 3% paraformaldehyde and analyzed with a FACS flow cytometer (LSRII, BD Biosciences) by using BD FACSDiva Version 6. MoDCs were selected by forward and side scattered signals before measuring the intensity of PE or FITC fluorescence signals of 10000 cells. Shown graphics were performed with FlowJo Software, Version 7.5.5.

Statistical analysis

Statistics were performed with GraphPad Prism 5.02 software (GraphPad, San Diego, CA, USA) with differences *p<0.05, **p<0.01 and ***p<0.001 considered significant.

Results and Discussion

Immune reaction of intestinal epithelial cells in response to M. stadtmanae- and M. smithii-stimulation

Since M. stadtmanae and M. smithii were found to be inhabitants of the human gut, we initially examined cell activation of the intestinal epithelial cell line Caco-2/BBe concerning expression and release of different proinflammatory cytokines and several AMPs. However, neither cytokine release of IL-8 nor significant changes in transcript levels of genes encoding TNF-α, IL-8, human beta defensin 1 (HBD1), HBD4, human defensin 6 (HD6) or human cathelicidin LL37 after stimulation with M. stadtmanae or M. smithii were observed (Fig. S1). These findings strongly argue that M. stadtmanae and M. smithii are not recognized by human intestinal epithelial cells. Taking this observation into account and the fact that innate immune cells get in contact with epithelial invading microorganisms from the human gut, the following experiments were performed with human monocyte-derived dendritic cells (moDCs).

Activation of monocyte-derived dendritic cells in response to M. stadtmanae and M. smithii

Activation of 2×105 moDCs from at least three donors was evaluated by stimulation with 106 and 107 M. stadtmanae or M. smithii cells for 20 h and subsequent analysis of TNF-α and IL-1β release. High amounts of both cytokines monitored were detected after stimulation with M. stadtmanae in a cell concentration-dependent manner, whereas M. smithii in general lead to a comparably weak release of the tested cytokines (Fig. 1A). This finding of a stronger immune cell activation by M. stadtmanae is in agreement with previous observations of Blais-Lecours et al. [25]; revealing much higher accumulation of myeloid dendritic cells and higher induction of antigen-specific IgGs in plasma of mice and human after intranasal application of M. stadtmanae cells when compared to M. smithii. In addition, it has very recently been demonstrated that lyophilized cells of M. stadtmanae induce significant higher release of TNF-α by peripheral blood mononuclear cells (PBMCs) compared to M. smithii [26].

Figure 1. M. stadtmanae induces significant higher release of cytokines in moDCs than M. smithii.

Figure 1

Cytokine release after stimulation of 2×105 moDCs with 1×106 and 1×107 M. stadtmanae or M. smithii cells for 20 h was quantified using commercial ELISA-Kits (AC). MoDCs were preincubated with 2 µM Cytochalasin D in DMSO (B) or 10 nM Bafilomycin A1 in DMSO (C) for 30 min prior stimulation. LPS (100 ng/ml) and medium were used as controls. Stated data are means of at least 3 independent biological replicates with their respective standard errors of the mean (SEM).

Phagocytosis of M. stadtmanae and M. smithii is crucial for activation of monocyte-derived dendritic cells

Since uptake of living commensal microorganisms by immune cells in the human gut has been shown to be crucial for cell activation by several bacterial species [40], we further investigated whether phagocytosis is involved in cell activation by methanoarchaea. Thus, phagocytosis and the effects of Cytochalasin D (Cyt D) and Bafilomycin A1 (Baf A1) on moDCs was monitored during stimulation with M. stadtmanae or M. smithii. Cyt D is known to specifically inhibit the uptake of microorganisms, whereas Baf A1 prevents intracellular lysosome formation. The cytokine release by moDCs monitored after stimulation with both methanoarchaeal strains was significantly inhibited upon treatment with Cyt D (Fig. 1B) and Baf A1 (Fig. 1C), whereas LPS-activation (control) was not affected. Furthermore, DAPI-prestained moDCs were visualized using confocal microscopy and revealed rapid phagocytosis of M. stadtmanae after 4 h of incubation (Fig. 2A, M. stadtmanae, Control, DAPI). Prestaining of moDCs with LysoTracker displayed lysosome formation after 4 h of incubation with M. stadtmanae (Fig. 2A, M. stadtmanae, Control, LysoTracker). For verification, moDCs were preincubated with 1 µM Cyt D and subsequently stimulated with M. stadtmanae. In this experimental setup, due to the Cyt D treatment M. stadtmanae cells were no longer visible inside moDCs (Fig. 2A, M. stadtmanae, Cytochalasin D, DAPI) and lysosome formation was not detected (Fig. 2A, M. stadtmanae, Cytochalasin D, LysoTracker). In contrast, stimulation of moDCs with M. smithii in the same experimental setup did not reveal uptake or lysosome formation after 4 h of stimulation (Fig. 2A, M. smithii). Moreover, TEM analysis of moDCs after 4 h of stimulation with M. stadtmanae or M. smithii confirmed extensive uptake of M. stadtmanae cells by moDCs, whereas uptake of M. smithii was not detected (Fig. 2B). These findings strongly indicate that M. stadtmanae cells are rapidly phagocytosed by human immune cells and, moreover, this uptake is crucially required for cellular activation. In contrast to M. stadtmanae, phagocytosis of M. smithii by moDCs appeared to be less frequent or much slower; nevertheless, cytokine release appeared as well to be dependent on phagocytosis.

Figure 2. Phagocytosis of M. stadtmanae is crucial for immune cell activation.

Figure 2

A) After preincubation with 1 µM Cytochalasin D (in DMSO) and with DMSO alone (control) for 30 min 1×105 moDCs were stimulated with 1×107 methanoarchaeal cells in glass cover slips for a period of 4 h. Lysosomes in moDCs were stained with LysoTracker Red DND-99 during time of incubation. After incubation, moDCs were washed, fixed with 3% paraformaldehyde and labeled with Hoechst (DAPI-staining). Images were captured using LSM 510 confocal microscopy (Zeiss) with Leica confocal software and are representative of the respective samples. B) 1×106 moDCs were stimulated with 1×108 methanoarchaeal cells for a period of 4 h. After washing in PBS, moDCs were fixed for electron microscopy. Images are representative for the respective sample.

Activation and modulation of moDCs by M. stadtmanae and M. smithii

DCs are known to act as crucial messengers between innate and adaptive immunity. In particular, activated moDCs maturate and migrate from nonlymphoid tissues to lymphoid organs to initiate T cell-mediated immune responses [27], [41]. Thus, the cell-surface expressions of CD197 and of the co-stimulatory receptor CD86 were investigated. MoDCs were stimulated with M. stadtmanae and M. smithii or medium as control for 24 and 48 h followed by incubation with the respective antibodies directed against CD86 and CD197. The subsequent FACS analyses of these cells revealed increased expression of both cell-surface receptors on moDCs after stimulation with both, M. stadtmanae and M. smithii, whereas medium controls were not affected (Fig. 3). The expression of both cell-surface receptors on moDCs however, was found to be higher after stimulation with M. stadtmanae compared to M. smithii. Since the expression of CD86 and CD197 after activation is crucial for co-stimulatory signals that are involved in maturation of moDCs and their functions in adaptive immune responses such as T- and B-cell activation [41], [42], those results implicate activation not only of the innate but also of the adaptive immune system in response to M. stadtmanae and M. smithii. This assumption is further supported by a very recently published study, demonstrating development of a significant and specific anti-M. stadtmanae IgG response in patients suffering from inflammatory bowel diseases (IBD) [26].

Figure 3. Increased expressions of cell-surface receptors on moDCs after stimulation with M. stadtmanae and M. smithii.

Figure 3

1×106 moDCs were stimulated with 1×107 M. stadtmanae or M. smithii cells or medium for 24 h and 48 h at 37°C. Subsequently, 2×105 moDCs were incubated with antibodies (PE- or FITC-labeled) and analyzed with a FACS flow cytometer. MoDCs were selected by forward and side scattered signals before measuring the intensity of PE or FITC fluorescence signals of 10000 cells. Depicted graphics are original plots of FlowJo Software, Version 7.5.5.

We further aimed to determine the expression of various human antimicrobial peptides in stimulated moDCs by qRT-PCR. Thus, moDCs were stimulated for 24 h with the methanoarchaeal strains prior isolating their respective RNA and quantifying gene expression of genes encoding AMPs. In this respect, HBD1 gene expression was found to be up-regulated in moDCs in response to both, M. stadtmanae and M. smithii (Fig. 4). Gene expression of further antimicrobial peptides in moDCs such as HBD2, HBD3 and RNase7, was not detectable using qRT-PCR analysis. DCs are clearly not major producers of the antimicrobial peptide response, however HBD1 has been shown to be selectively chemotactic for human intestinal DCs [43]. Thus, the regulation of HBD1 gene expression in moDCs in response to stimulation with M. stadtmanae and M. smithii might link our results to the physiological functions of those methanoarchaea as immunomodulators in the human gut.

Figure 4. Altered gene expression of AMPs in moDCs after stimulation with M. stadtmanae and M. smithii.

Figure 4

2–4×106 moDCs were stimulated with 1×107 M. stadtmanae or M. smithii cells and medium (for control) over a period of 24 h. Subsequently, RNA was isolated according to manufacturer's protocol and reverse-transcribed. Relative quantification of expression of genes encoding HBD1 and LL37 were calculated with the LightCycler 480 Software in relation to house-keeping gene hprt.

Besides, we found that the expression level of the human cathelicidin LL-37 was down-regulated in moDCs after stimulation with M. stadtmanae (6-fold) and M. smithii (3-fold). The regulation of LL37 by different bacterial components in various disease patterns has been observed in earlier studies [44]. In enteric infections, for example, it was proposed that bacterial DNA actively down-regulates the gene expression of LL37 in monocytes and epithelial cells [45]. However, since methanoarchaea are considered to be commensals within the human intestine, it might also thinkable that they evolved mechanisms protecting themselves from human immune clearance. This would be in accordance with our recently published data on the susceptibility of methanoarchaea against numerous AMPs, in particular against LL32 [33] that is described as the shortest active unit of human LL37 [46].

Recognition of M. stadtmanae and M. smithii by human immune cells

Based on the observed rapid activation processes of moDCs after stimulation with M. stadtmanae shown by confocal scanner microscopy analyses during this study, we propose a specific recognition mechanism for M. stadtmanae. This mechanism might differ from that of M. smithii. The cell envelope of both, M. stadtmanae and M. smithii, is in general built up by a dense layer of pseudomurein, which consists of glycan strands consisting of β-1,3-glycosidic linked N-acetylglucosamine and N-acetyltalosaminuronic acid, and a variable peptide moiety [47][49]. However, structural alterations of pseudomurein in the cell envelope of M. stadtmanae and M. smithii might be responsible for the obtained differences in the recognition process by human immune cells, since studies employing monoclonal antibodies against methanoarchaea by Conway de Macario and colleges revealed diverse immunogenic properties by several pseudomurein glycan structures of M. smithii fecal isolates [30], [31], [50]. Genomic heterogeneity of M. smithii populations present in the gut microbiota of individuals has already been described earlier [51]. Thus, alterations of the methanoarchaeal cell envelope might occur in case of M. smithii isolates derived from diverse human individuals that may also result in diverse immunogenic properties of these strains. Although the overall structure of pseudomurein in some parts resembles that of murein [49], we obtained evidence that M. stadtmanae or M. smithii cells are not recognized by human NOD1- and 2 receptors, which are known to be activated by bacterial murein components (Fig. S2). Moreover, by transfection of common TLRs into HEK293-cells we also get strong indication that none of the so far known members of the human toll-like receptor family [52] appears to be involved in the recognition processes of M. stadtmanae or M. smithii cells (Fig. S2). Hence, activation of immune cells by M. stadtmanae and M. smithii appears not to occur via commonly known TLRs or NLRs that recognize prominent bacterial MAMPs, strongly pointing towards a different recognition mechanism.

The functional role of M. stadtmanae and M. smithii in the human intestine

The existence of methanoarchaea as a part of the human gut microbiota has been accepted in the last two decades [6], [7], [19], [24], however their impact on the immune system in human's health and disease was hardly examined. Even today, they are still overlooked in many studies dealing with the interdependency between members of the microbiome and components of the immune system. Due to the broad variety of detection assays the abundance and diversity of archaea in the human gut is still not fully elucidated and remains indistinct [10], [24]. Hence, the current knowledge on the functional role of methanoarchaea in the human intestine is mainly focused on bioenergetic aspects and syntrophic interactions with bacteria [12], [16]. However, few studies reported strong immunological properties of methanoarchaea after immunization of rabbits and mice [25], [26], [30], [31], [50]. Thus, it is most likely that methanoarchaea are also capable to influence the community structure of the human gut microbiota through their interaction with blood immune cells or the mucosa itself. Remarkably, by using an adapted DNA-isolation and qRT-PCR approach, Dridi et al. demonstrated that M. smithii inhabits nearly every human individual gut ecosystem, whereas M. stadtmanae is less abundant (29%) [19]. Moreover, M. stadtmanae was recently found to be more abundant in patients suffering from IBD than in healthy control individuals [26]. Taking those findings and our results on M. stadtmanae's severe activation of moDCs into consideration, it appears that the presence of M. stadtmanae might directly or indirectly correlate with inflammation processes in the human gut.

Regarding the overall immunogenic potential of methanoarchaeal strains this study focuses on the strains M. stadtmanae (DSM 3091) and M. smithii (DSM 861), however other isolates of these strains as well as further methanoarchaeal strains inhabiting the human intestine such as Methanomassilicoccus luminyensis [53] might elicit far diverse immune responses when exposed to human epithelial or blood immune cells.

Conclusions

We report here on the inflammatory response of human moDCs to methanoarchaea and demonstrate that M. stadtmanae is capable to induce a markedly higher inflammatory cytokine response than M. smithii, and may represent a hitherto overlooked contributor to pathological conditions in the human intestine. Moreover, our data implicate the presence of a specific archaeal-associated pattern recognition receptor in humans. Since members of the domain Archaea were not only found in the human intestine, but also in the oral cavity and in high abundance on human skin [6][12], [19], archaeal strains may influence the overall human immune homeostasis to comparable extents as has been shown for bacteria. Consequently, there is an urgent need to include archaea in future studies regarding the role of the human microbiome.

Supporting Information

Figure S1

Stimulation of intestinal epithelial cells does not reveal activation by M. stadtmanae and M. smithii . A) Cytokine release after stimulation of 1×105 Caco-2/BBe cells with 1×107 M. stadtmanae or M. smithii cells for 20 h was quantified using commercial ELISA-Kits. TNF-α (10 ng/ml), medium and 1×107 E. coli K12 were used as controls. Stated data are means of 3 independent biological replicates with their respective standard errors of the mean (SEM). B) 1×106 Caco-2/BBe cells were stimulated with 1×107 M. stadtmanae or M. smithii cells, TNF-α (10 ng/ml), medium and 1×107 E. coli K12 cells (for control) over periods of 6 h and 24 h. After RNA isolation (Macherey-Nagel) and reverse transcription the relative quantification of TNF-α, IL-8, HBD1, HD6, HBD4 and LL37 mRNA expression was carried out in relation to house-keeping gene hprt calculated with the LightCycler 480 Software. Stated data are means of 3 independent biological replicates with their respective SEM.

(PDF)

Figure S2

Transfection of HEK293 cells with common TLRs or NLRs does not reveal activation by M. stadtmanae or M. smithii via these receptors. 2.5×104 HEK cells were transfected with various common human innate immune receptors as indicated. Cells were then stimulated with 1×107 M. stadtmanae and M. smithii cells or the indicated control stimuli (Pam3CSK4, Pam3Cys-Ser-(Lys)4; Poly IC, polyriboinosinic:polyribocytidylic acid; LPS, lipopolysachharide; R848, resiquimod; DAP, diaminopimelic acid; MDP, muramyl dipeptide) for 20 h and IL-8 release was quantified using a commercial ELISA-Kit. Stated data are means of at least 3 independent biological replicates with their respective SEM.

(PDF)

Acknowledgments

We gratefully acknowledge Dr. Thomas Scholzen (Research Center Borstel) for confocal microscopy of moDCs, Suhad Al-Badri and Ina Goroncy for excellent technical assistance and Kerstin Stephan for electron microscopy of moDCs.

Funding Statement

This work was support by German research foundation (DFG) (SCHM1051/11-1) (www.dfg.de/). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Woese CR, Kandler O, Wheelis ML (1990) Towards a natural system of organisms: proposal for the domains Archaea, Bacteria, and Eucarya. Proceedings of the National Academy of Sciences of the United States of America 87: 4576–4579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. DeLong EF, Pace NR (2001) Environmental diversity of bacteria and archaea. Systematic Biology 50: 470–478. [PubMed] [Google Scholar]
  • 3. Barns SM, Delwiche CF, Palmer JD, Pace NR (1996) Perspectives on archaeal diversity, thermophily and monophyly from environmental rRNA sequences. Proceedings of the National Academy of Sciences of the United States of America 93: 9188–9193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Chaban B, Ng SY, Jarrell KF (2006) Archaeal habitats–from the extreme to the ordinary. Canadian Journal of Microbiology 52: 73–116. [DOI] [PubMed] [Google Scholar]
  • 5. Conway de Macario E, Macario AJL (2009) Methanogenic archaea in health and disease: a novel paradigm of microbial pathogenesis. International Journal of Medical Microbiology 299: 99–108. [DOI] [PubMed] [Google Scholar]
  • 6. Miller TL, Weaver GA, Wolin MJ (1984) Methanogens and anaerobes in a colon segment isolated from the normal fecal stream. Applied and Environmental Microbiology 48: 449–450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Miller TL, Wolin MJ, Conway de Macario E, Macario AJ (1982) Isolation of Methanobrevibacter smithii from human feces. Applied and Environmental Microbiology 43: 227–232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Belay N, Johnson R, Rajagopal BS, Conway de Macario E, Daniels L (1988) Methanogenic bacteria from human dental plaque. Applied and Environmental Microbiology 54: 600–603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Belay N, Mukhopadhyay B, Conway de Macario E, Galask R, Daniels L (1990) Methanogenic bacteria in human vaginal samples. Journal of Clinical Microbiology 28: 1666–1668. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Eckburg PB, Bik EM, Bernstein CN, Purdom E, Dethlefsen L, et al. (2005) Diversity of the human intestinal microbial flora. Science 308: 1635–1638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Probst AJ, Auerbach AK, Moissl-Eichinger C (2013) Archaea on human skin. PLOS ONE 8: e65388. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Dridi B, Raoult D, Drancourt M (2011) Archaea as emerging organisms in complex human microbiomes. Anaerobe: 1–8. [DOI] [PubMed]
  • 13. Human Microbiome Project C (2012) Structure, function and diversity of the healthy human microbiome. Nature 486: 207–214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Levitt MD, Furne JK, Kuskowski M, Ruddy J (2006) Stability of human methanogenic flora over 35 years and a review of insights obtained from breath methane measurements. Clinical Gastroenterology and Hepatology 4: 123–129. [DOI] [PubMed] [Google Scholar]
  • 15. McNeil NI (1984) The contribution of the large intestine to energy supplies in man. The American Journal of Clinical Nutrition 39: 338–342. [DOI] [PubMed] [Google Scholar]
  • 16. Samuel BS, Gordon JI (2006) A humanized gnotobiotic mouse model of host-archaeal-bacterial mutualism. Proceedings of the National Academy of Sciences of the United States of America 103: 10011–10016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Macpherson AJ, Harris NL (2004) Interactions between commensal intestinal bacteria and the immune system. Nature Reviews Immunology 4: 478–485. [DOI] [PubMed] [Google Scholar]
  • 18. Miller TL, Wolin MJ (1985) Methanosphaera stadtmaniae gen. nov., sp. nov.: a species that forms methane by reducing methanol with hydrogen. Archives of Microbiology 141: 116–122. [DOI] [PubMed] [Google Scholar]
  • 19. Dridi B, Henry M, El Khechine A, Raoult D, Drancourt M (2009) High prevalence of Methanobrevibacter smithii and Methanosphaera stadtmanae detected in the human gut using an improved DNA detection protocol. PLOS ONE 4: e7063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Haines A, Metz G, Dilawari J, Blendis L, Wiggins H (1977) Breath-methane in patients with cancer of the large bowel. The Lancet 2: 481–483. [DOI] [PubMed] [Google Scholar]
  • 21. Piqué JM, Pallarés M, Cusó E, Vilar-Bonet J, Gassull MA (1984) Methane production and colon cancer. Gastroenterology 87: 601–605. [PubMed] [Google Scholar]
  • 22. Eckburg PB, Lepp PW, Relman DA (2003) Archaea and their potential role in human disease. Infection and Immunity 71: 591–596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Cavicchioli R, Curmi PMG, Saunders N, Thomas T (2003) Pathogenic archaea: do they exist? BioEssays: news and reviews in molecular, cellular and developmental biology 25: 1119–1128. [DOI] [PubMed] [Google Scholar]
  • 24. Scanlan PD, Shanahan F, Marchesi JR (2008) Human methanogen diversity and incidence in healthy and diseased colonic groups using mcrA gene analysis. BMC Microbiology 8: 79–79. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Blais-Lecours P, Duchaine C, Taillefer M, Tremblay C, Veillette M, et al. (2011) Immunogenic properties of archaeal species found in bioaerosols. PLOS ONE 6: e23326–e23326. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Blais-Lecours P, Marsolais D, Cormier Y, Berberi M, Hache C, et al. (2014) Increased Prevalence of Methanosphaera stadtmanae in Inflammatory Bowel Diseases. PLOS ONE 9: e87734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Banchereau J, Steinman RM (1998) Dendritic cells and the control of immunity. Nature 392: 245–252. [DOI] [PubMed] [Google Scholar]
  • 28. Lipscomb MF, Masten BJ (2002) Dendritic cells: immune regulators in health and disease. Physiological Reviews 82: 97–130. [DOI] [PubMed] [Google Scholar]
  • 29. Hart DN, McKenzie JL (1990) Interstitial dendritic cells. International Reviews of Immunology 6: 127–138. [DOI] [PubMed] [Google Scholar]
  • 30. Conway de Macario E, König H, Macario AJ, Kandler O (1984) Six antigenic determinants in the surface layer of the archaebacterium Methanococcus vannielii revealed by monoclonal antibodies. The Journal of Immunology 132: 883–887. [PubMed] [Google Scholar]
  • 31. Conway de Macario E, Macario AJ, Magariños MC, König H, Kandler O (1983) Dissecting the antigenic mosaic of the Archaebacterium Methanobacterium thermoautotrophicum by monoclonal antibodies of defined molecular specificity. Proceedings of the National Academy of Sciences of the United States of America 80: 6346–6350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. König H, Ralik RI, Kandler O (1982) Structure and Modifications of Pseudomurein in Methanobacteriales. Zentralblatt für Bakteriologie Mikrobiologie und Hygiene: I Abt Originale C: Allgemeine, angewandte und ökologische Mikrobiologie 3: 179–191. [Google Scholar]
  • 33. Bang C, Schilhabel A, Weidenbach K, Kopp A, Goldmann T, et al. (2012) Effects of antimicrobial peptides on methanogenic archaea. Antimicrobial Agents and Chemotherapy 56: 4123–4130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Boyum A (1964) Separation of white blood cells. Nature 204: 793–794. [DOI] [PubMed] [Google Scholar]
  • 35. Turpin J, Hester JP, Hersh EM, Lopez-Berestein G (1986) Centrifugal elutriation as a method for isolation of large numbers of functionally intact human peripheral blood monocytes. Journal of Clinical Apheresis 3: 111–118. [DOI] [PubMed] [Google Scholar]
  • 36. Sallusto F, Lanzavecchia A (1994) Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. The Journal of Experimental Medicine 179: 1109–1118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Zähringer U, Lindner B, Knirel YA, van den Akker WMR, Hiestand R, et al. (2004) Structure and biological activity of the short-chain lipopolysaccharide from Bartonella henselae ATCC 49882T. The Journal of Biological Chemistry 279: 21046–21054. [DOI] [PubMed] [Google Scholar]
  • 38. Heine H, Gronow S, Zamyatina A, Kosma P, Brade H (2007) Investigation on the agonistic and antagonistic biological activities of synthetic Chlamydia lipid A and its use in in vitro enzymatic assays. Journal of Endotoxin Research 13: 126–132. [DOI] [PubMed] [Google Scholar]
  • 39. Andrä J, Monreal D, Martinez de Tejada G, Olak C, Brezesinski G, et al. (2007) Rationale for the design of shortened derivatives of the NK-lysin-derived antimicrobial peptide NK-2 with improved activity against Gram-negative pathogens. The Journal of Biological Chemistry 282: 14719–14728. [DOI] [PubMed] [Google Scholar]
  • 40. Rescigno M (2010) Intestinal dendritic cells. Advances in Immunology 107: 109–138. [DOI] [PubMed] [Google Scholar]
  • 41. Yanagihara S, Komura E, Nagafune J, Watarai H, Yamaguchi Y (1998) EBI1/CCR7 is a new member of dendritic cell chemokine receptor that is up-regulated upon maturation. The Journal of Immunology 161: 3096–3102. [PubMed] [Google Scholar]
  • 42. Chen C, Gault A, Shen L, Nabavi N (1994) Molecular cloning and expression of early T cell costimulatory molecule-1 and its characterization as B7-2 molecule. The Journal of Immunology 152: 4929–4936. [PubMed] [Google Scholar]
  • 43. Yang D, Chertov O, Bykovskaia SN, Chen Q, Buffo MJ, et al. (1999) Beta-defensins: linking innate and adaptive immunity through dendritic and T cell CCR6. Science 286: 525–528. [DOI] [PubMed] [Google Scholar]
  • 44. Dürr UHN, Sudheendra US, Ramamoorthy A (2006) LL-37, the only human member of the cathelicidin family of antimicrobial peptides. Biochimica et Biophysica Acta 1758: 1408–1425. [DOI] [PubMed] [Google Scholar]
  • 45. Islam D, Bandholtz L, Nilsson J, Wigzell H, Christensson B, et al. (2001) Downregulation of bactericidal peptides in enteric infections: a novel immune escape mechanism with bacterial DNA as a potential regulator. Nature Medicine 7: 180–185. [DOI] [PubMed] [Google Scholar]
  • 46. Gutsmann T, Hagge SO, David A, Roes S, Böhling A, et al. (2005) Lipid-mediated resistance of Gram-negative bacteria against various pore-forming antimicrobial peptides. Journal of Endotoxin Research 11: 167–173. [DOI] [PubMed] [Google Scholar]
  • 47.König H (1988) Archaeobacterial cell envelopes. Canadian Journal of Microbiology: 395–406.
  • 48. Kandler O, König H (1998) Cell wall polymers in Archaea (Archaebacteria). Cellular and Molecular Life Sciences 54: 305–308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.König H (2010) Prokaryotic Cell Wall Compounds. Berlin, Heidelberg: Springer Berlin Heidelberg. 159–162 p. [Google Scholar]
  • 50. Conway de Macario E, Macario AJ, Kandler O (1982) Monoclonal antibodies for immunochemical analysis of methanogenic bacteria. The Journal of Immunology 129: 1670–1674. [PubMed] [Google Scholar]
  • 51. Samuel BS, Hansen EE, Manchester JK, Coutinho PM, Henrissat B, et al. (2007) Genomic and metabolic adaptations of Methanobrevibacter smithii to the human gut. Proceedings of the National Academy of Sciences of the United States of America 104: 10643–10648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Takeda K, Akira S (2005) Toll-like receptors in innate immunity. International Immunology 17: 1–14. [DOI] [PubMed] [Google Scholar]
  • 53. Dridi B, Fardeau ML, Ollivier B, Raoult D, Drancourt M (2012) Methanomassiliicoccus luminyensis gen. nov., sp. nov., a methanogenic archaeon isolated from human faeces. International Journal of Systematic and Evolutionary Microbiology 62: 1902–1907. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1

Stimulation of intestinal epithelial cells does not reveal activation by M. stadtmanae and M. smithii . A) Cytokine release after stimulation of 1×105 Caco-2/BBe cells with 1×107 M. stadtmanae or M. smithii cells for 20 h was quantified using commercial ELISA-Kits. TNF-α (10 ng/ml), medium and 1×107 E. coli K12 were used as controls. Stated data are means of 3 independent biological replicates with their respective standard errors of the mean (SEM). B) 1×106 Caco-2/BBe cells were stimulated with 1×107 M. stadtmanae or M. smithii cells, TNF-α (10 ng/ml), medium and 1×107 E. coli K12 cells (for control) over periods of 6 h and 24 h. After RNA isolation (Macherey-Nagel) and reverse transcription the relative quantification of TNF-α, IL-8, HBD1, HD6, HBD4 and LL37 mRNA expression was carried out in relation to house-keeping gene hprt calculated with the LightCycler 480 Software. Stated data are means of 3 independent biological replicates with their respective SEM.

(PDF)

Figure S2

Transfection of HEK293 cells with common TLRs or NLRs does not reveal activation by M. stadtmanae or M. smithii via these receptors. 2.5×104 HEK cells were transfected with various common human innate immune receptors as indicated. Cells were then stimulated with 1×107 M. stadtmanae and M. smithii cells or the indicated control stimuli (Pam3CSK4, Pam3Cys-Ser-(Lys)4; Poly IC, polyriboinosinic:polyribocytidylic acid; LPS, lipopolysachharide; R848, resiquimod; DAP, diaminopimelic acid; MDP, muramyl dipeptide) for 20 h and IL-8 release was quantified using a commercial ELISA-Kit. Stated data are means of at least 3 independent biological replicates with their respective SEM.

(PDF)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES