Correction: Claudin-1, -3 and -4 proteins and mRNA expression in benign and malignant breast lesions: a research study

After publication of this work [1], it was brought to our attention that two corrections were required in the first table. First, the Claudin 1 forward and reverse primer sequences were the same. Second, the forward and reverse primer sequences of GAPDH were inversed.

The correct sequences can be found in Table 1.

Table 1.

The CLDN1, CLDN3, CLDN4 and GAPDH primer sequences, position and product size

Primer	Forward			Reverse			Product size (bp)	GI number
	Sequence 5'–3'	Position (bp)		Sequence 5'–3'	Position (bp)
CLDN1	gcgcgatatttcttcttgcagg	378–399	22	ttcgtacctggcattgactgg	470–490	21	112	4559277
GAPDH	gaaggtgaaggtcggagt	81–98	20	gaagatggtgatggatttc	287–306	18	225	7669491

bp, base pairs; CLDN, claudin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.