Skip to main content
International Journal of Biochemistry and Molecular Biology logoLink to International Journal of Biochemistry and Molecular Biology
. 2014 May 15;5(1):11–20.

Transgene-mediated co-suppression of DNA topoisomerase-1 gene in Caenorhabditis elegans

Myon-Hee Lee 1,2,3, Dong Seok Cha 1,4, Srivalli Swathi Mamillapalli 1, Young Chul Kwon 1, Hyeon-Sook Koo 5
PMCID: PMC4058960  PMID: 24955284

Abstract

Ectopic expression of multi-transgenic copies can result in reduced expression of the transgene and can induce silence of endogenous gene; this process is called as co-suppression. Using a transgene-mediated co-suppression technique, we demonstrated the biological function of DNA topoisomerase-1 (top-1) in C. elegans development. Introduction of full-length top-1 transgene sufficiently induced the co-suppression of endogenous top-1 gene, causing embryonic lethality and abnormal germline development. We also found that the co-suppression of top-1 gene affected morphogenesis, lifespan and larval growth that were not observed in top-1 (RNAi) animals. Strikingly, co-suppression effects were significantly reduced by the elimination of top-1 introns, suggesting that efficient co-suppression may require intron(s) in C. elegans. Sequence analysis revealed that the introns 1 and 2 of top-1 gene possess consensus binding sites for several transcription factors, including MAB-3, LIN-14, TTX-3/CEH-10, CEH-1, and CEH-22. Among them, we examined a genetic link between ceh-22 and top-1. The ceh-22 is partially required for the specification of distal tip cells (DTC), which functions as a stem cell niche in the C. elegans gonad. Intriguingly, top-1 (RNAi) significantly enhanced DTC loss in ceh-22 mutant gonads, indicating that top-1 may play an important role in CEH-22-mediated DTC fate specification. Therefore, our findings suggest that transgene-mediated co-suppression facilitates the silencing of the specific genes and the study of gene function in vivo.

Keywords: DNA topoisomerase I, co-suppression, Caenorhabditis elegans, morphogenesis, distal tip cells (DTCs), lifespan

Introduction

DNA topoisomerase 1 (TOP-1) is an essential enzyme, which eases the torsional stress involved in DNA replication, transcription and chromosome condensation [1,2]. TOP-1 protein is also critical for cell proliferation in multicellular organisms [3-5]. TOP-1 is highly relevant in cancer as a number of anti-cancer drugs selectively target DNA TOP-1 [6]. For example, TOP-1 is a specific molecular target for anti-cancer drugs (e.g., Camptothecin), which are used in the treatment of many types of cancers, including ovarian and colorectal cancer [2,7]. These drugs convert TOP-1 into cellular poisons by trapping the enzyme as it cleaves DNA [8]. Therefore, TOP-1 is considered to be an attractive target for chemotherapy in malignancies.

We previously identified two alternatively spliced products of C. elegans top-1 (top-1α and top-1β) [9]. These two isoforms display differential subcellular localization during development: top-1α is mostly present in centrosomes, neuronal cells, excretory cells and centrosomes of germ cells, while top-1β with missing the second exon is broadly localized to the nuclei of many cells at all developmental stages and is concentrated in nucleoli of embryo gut and oogenic cells [10]. A reporter analysis and immunohistochemistry showed that top-1 is strongly expressed in the C. elegans distal tip cells (DTCs) at the larval stages [10]. This is interesting because C. elegans DTC functions as a mesenchymal niche to promote germline stem cells self-renewal [11]. It also leads gonadal migration [12]. Notably, RNA interference (RNAi) targeted to top-1 has consistently shown germline proliferation defects and abnormal gonadal migration [10].

We further demonstrate in this report that top-1 is also required for morphogenesis, stem cell niche (DTC) fate specification as well as normal lifespan and growth control using a transgene-mediated co-suppression. In plants and Drosophila, co-suppression can mediate transcriptional gene silencing or post-transcriptional gene silencing mechanism [13]. The transcriptional gene silencing mechanism involves DNA-related processes such as methylation [14,15] and binding of polycomb-group proteins to co-suppressed genes [16,17]. In C. elegans, RNAi and co-suppression are mediated at least in part by the same molecular machinery, possibly through RNA-guided degradation of mRNAs [18]. Although RNAi and transgene-mediated co-suppression share many key regulators, like dcr-1 and rde-2 genes [18], the transgene-mediated co-suppression has several benefits over RNAi-mediated knockdown; First, the transgene-mediated co-suppression can be inherited for several generations. Second, a somatic selection marker can be used to identify stable co-suppressed transgenic lines. Third, stable co-suppressed transgenic lines can be used to identify suppressor or enhancer genes through RNAi screening or classical mutagenesis. Therefore, our results may benefit studies related to the development of new genetic biotechnology and help in understanding the biological function of genes of interest.

Materials and methods

C. elegans culture and strains

All strains were derived from Bristol strain N2 and maintained at 20°C or 25°C as described [19]. The ceh-22(q632) mutant [20] was used for this work. The integrated transgene qIs56 [lag-2::GFP] was used as a DTC marker.

Embryo isolation

To isolate the embryos, avid worms at mixed stages were lysed in 10 volumes of a 1% NaOCl and 0.5 M NaOH solution, and embryos were precipitated from the lysate by a centrifugation at 140 × g for 1 min. The precipitated embryos were washed three times with an M9 buffer (3 g KH2PO4, 6 g Na2HPO4, 5 g NaCl, 1 ml 1 M MgSO4, H2O to 1 liter) and placed on nematode growth medium (NGM) or RNAi plates.

Construction of top-1FL and top-1(ΔInt1&2) plasmid DNAs

In order to construct a top-1FL plasmid DNA, an about 8 kb-long top-1 full length (FL) DNA fragment was amplified by polymerase chain reaction (PCR) on C. elegans genomic DNA using gene-specific primers (nt 17546~17565, GGTACGAATGGAGAATACTG and nt 25576~25557 in the sequence of M01E5 genomic cosmid clone, CCTCTCACACTTATGAAATC). The amplified DNA fragment containing the top-1 genomic DNA from the -3.0 kb upstream of the trans-splicing site to the +0.8 kb downstream of termination codon sequence was cloned into Topo TA cloning vector (Invitrogen) using a standard cloning procedure. For top-1(ΔInt1&2) plasmid DNAs, top-1FL plasmid DNA was digested with SacI (78 bp downstream sequence from the trans-splicing site) and PstI (in the exon 3) restriction enzymes and then replaced with a cDNA fragment containing the exons 1, 2 and 3 (Figure 1A). The resulting plasmid DNAs were microinjected into wild-type worms with pRF4 (rol-6) [21] or csb-1::GFP [22] as transformation-positive markers. Injected worms were grown at a lower temperature (18°C) due to embryonic lethality at 25°C, and an integrated transgenic line was generated by UV-irradiation (240 nm, 300 J/m2) [23]. Phenotype of transgenic worms were observed under fluorescence microscope with a differential interference contrast (DIC) optics.

Figure 1.

Figure 1

Co-suppression effect of top-1 gene. A: Structure of the top-1FL and top-1(ΔInt1&2) transgenes. The top-1FL transgene includes promoter, exons (yellow), introns, and 3’ flanking region. The top-1(ΔInt1&2) transgene is removed two introns juxtaposing the second exon. Box, exon; connected line, intron. B: Phenotype analysis. The co-suppression of top-1 gene copies the phenotype of top-1(RNAi) with a high efficiency. C: Prediction of transcription factor binding sites in intron 1 and 2 using ConTra v2 program.

Measurement of embryonic lethality and germline phenotypes

In order to measure embryonic lethality, embryos were collected from wild-type or top-1FL transgenic worms and embryonic hatching rate was scored 24 h later at 20°C or 25°C. To determine the cosuppression phenotype of top-1FL gene in the C. elegans germline, L1 synchronized top-1FL transgenic worms were placed on NGM plates containing OP50 bacteria. 3 days later, the germline phenotypes were observed by staining dissected gonads with DAPI.

Antibody staining

Embryo staining was performed as described [24]. After freeze-cracking, embryos on a poly (lysine)-coated glass slide were serially immersed in methanol, acetone, and then methanol at -20°C for 5 min each. After leaving it in methanol at an ambient temperature for 5 min, the specimen was submerged in 90% methanol/H2O, 70% methanol/PBS, and then in 50% methanol/PBS for 1 min each. After a pre-incubation in 1XPBS/0.5% BSA solution for 1 h, the embryos were incubated at room temperature for 1 h with MH27 mouse monoclonal antibodies (antibody against Jam-1, Developmental Studies Hybridoma Bank). After washing with 1XPBS/0.5% BSA solution three times, the embryos were treated with a secondary antibody (Molecular Probe, Alexa 488, 1:300 dilutions). After staining with DAPI, the embryos were observed under a fluorescence microscope.

Prediction of transcription factor binding sites within top-1 introns

Transcription factor binding sites in the introns of top-1 gene were searched using a ConTra v2 program (http://bioit.dmbr.ugent.be/contrav2/contradoc.php) as described [25]. ConTra v2 can analyze promoter regions, 5’UTRs (untranslated regions), 3’UTRs, introns or any other genomic region of interest.

RNA interference (RNAi)

RNAi was performed essentially as described [26]. In brief, synchronized L1s were placed on RNAi plates (NGM/Amp/IPTG) seeded with ceh-22 double stranded RNA (dsRNA)-expressing or empty vector control bacteria, and were incubated at 25°C.

Lifespan measurement

Adult wild-type and top-1FL worms were allowed to lay eggs overnight on separate plates. The adult worms were then removed from the plates to measure the lifespan of their progeny. About one hundred worms were picked at L2 or L3 larval stage and were transferred to new plates at the density of about 25 worms per plate. Dead worms were counted daily after the transfer of live worms to a new plate. The average lifespan and its deviation were calculated using Microsoft Excel program and the measurement was repeated three times.

Results and discussion

Transgene array induces top-1 loss-of-function phenotype

To determine the co-suppression phenotype of top-1, we generated a transgenic line carrying the multicopies of a full-length (FL) top-1 transgene (about 8 kb-long), called top-1FL (Figure 1A) and an injection marker, pRF4 plasmid DNA (rol-6) [21] or csb-1::GFP DNA [22]. Extrachromosomal array was integrated into the C. elegans genome using UV irradiation to establish non-mosaic transgenic strains with high transmission rate [27]. Interestingly, the integrated top-1(FL) transgenic worms exibited temperature sensitive phenotypes: 58% of transgenic worms (n=496) carrying the multicopies of top-1FL transgene died at embryo or early larval stage at permissive temperature (20°C) (not shown). At restrictive temperature (25°C), most transgenic animals showed embryonic lethality or larval arrest (Figure 1B), phenocopying top-1(RNAi) [10] or loss-of-function top-1 mutant (not shown). Notably, the co-suppression of top-1 gene also affected the germline development, including germ cell proliferation, gonadal migration, germ cell survival in the adult at 20°C (Figure S1). The overall phenotypes of top-1 co-suppression showed much stronger than that of top-1(RNAi) [10] (Figures 1B and S1). These results suggest that top-1FL transgene arrays efficiently induce the co-suppression of top-1 gene.

The effect of top-1 introns on co-suppression

Transgene-mediated co-suppression depends on the presence of a functional promoter [18]; constructs lacking a promoter cannot induce co-suppression [18]. In this report, we tested whether transgene-mediated co-suppression is also required for functional introns because introns and their removal by the spliceosome can influence gene expression and enhance mRNA metabolism [28]. To do so, we generated a transgenic line carrying a top-1 transgene missing both intron 1 and 2, called top-1(ΔInt1&2) (Figure 1A). The majortity of embryos obtained from top-1FL transgenic worms at 25°C died at the early embryonic stage. However, embryos from top-1(ΔInt1&2) transgenic lines died at a relatively later stage of embryogenesis (31%) or were arrested at early larval stages (24% in L1 and 18% in L2/L3) (Figure 1B). This result suggests that transgene-mediated co-suppression may be influenced by the elimination of introns. It is important to know how introns affect the efficiency of the transgene-mediated co-suppression. One of the possible ideas is that introns may regulate the expressional level of transgenes in C. elegans. The mechanisms of intron-mediated enhancement of gene expression have been explored in several model systems [29]. For example, the gene expression in C. elegans is specifically regulated by first or second intron, which have conserved sequences for transcription factor interaction and are bound by more transcription factors when compared to other introns [30]. We therefore searched for potential transcription factor binding sites in the intron 1 and 2 of top-1 gene using ConTra v2 program [25]. Interestingly, the program predicted eight consensus binding sites for four transcription factors in the intron 1, and four consensus binding sites for three transcription factors in the intron 2 (Figures 1C and S2). Therefore, we speculate that intron may influence the effects of co-suppression probably by regulating the expression levels of a specific gene in C. elegans.

In general, the silencing of specific genes can be induced by the introduction of multi-copies of homologous transgenes (called by co-suppression) [31-34] or by the delivery of double stranded RNA to target the specific gene (called by RNAi) [35,36]. Although gene silencing by co-suppression is technically more difficult than that by RNAi, it provides notable experimental advantages over RNAi, including a reproducible and inheritable outcome, a germline specific functional analysis, and a source for genetic screening. Germline silencing of a specific gene can indeed result in a maternal effect lethal phenotype in the early embryos, causing decreased or absent transmitting lines. In this case, transgenic lines can be obtained by the injection of transgene into mut-7(pk204) mutant, which have a defective co-suppression response, and then be crossed out to yield the co-suppression effect [37]. In this report, we demonstrated that the presence or absence of intron could influence the co-suppression effects. Therefore, this genetic manipulation of intron may provide an additional experimental advantage for understanding the mechanism of co-suppression and the biological function of essential gene in vivo.

The effect of top-1 on CEH-22-mediated DTC specification

In C. elegans, the distal tip cell (DTC) acts as a mesenchymal niche that maintains germline stem cells [38]. The C. elegans DTC fate is specified by Wnt/β-catenin signaling [39] (Figure 2A). One of the downstream targets of this signaling is ceh-22 (a homeodomain transcription factor), which is required for DTC fate specification. Wild-type hermaphrodites normally have two DTCs, but 79% of ceh-22 mutants often cause DTC loss (Figure 2B and 2C). Since top-1 is expressed in the C. elegans DTCs [10] and top-1 intron 2 possesses a consensus binding site for the CEH-22 transcription factor (Figures 1C and S2), we examined whether top-1 is genetically linked to ceh-22 in the DTC fate specification. The depletion of top-1 by RNAi did not affect DTC specification (Figure 2C) in wild-type hermaphrodites, but it significantly enhanced DTC loss and a consequent loss of germline stem cells in ceh-22(q632) mutants (Figure 2C). This result suggests that top-1 may be linked genetically with ceh-22 in the DTC specification. How does top-1 control DTC fate specification in ceh-22 mutant? One of the possible mechanisms is that top-1 may control proper cell division timing of somatic gonadal precursor (SGP), which divides to generate one daughter with DTC potential and one daughter with non-DTC potential [11]. Similarly, C. elegans CYD-1/Cyclin D regulating G1/S phase transition, specifies DTC fate by regulating the cell divion timing of SGP [40]. Therefore, we speculate that a delayed cell division of SGP in top-1(RNAi) may contribute to DTC loss in ceh-22 mutants.

Figure 2.

Figure 2

TOP-1 is required for CEH-22-mediated DTC specification. A: Schematic of wild-type DTC specification. Wnt/β-catenin asymmetry pathway, including POP-1/TCF and SYS-1/β-catenin controls the transcription of ceh-22/Nkx2.5 to specify DTC fate. The DTC maintains germline stem cell (GSC) self-renewal. B: The expression of lag-2::GFP transgene in DTCs. Wild-type animals have two DTCs, but some ceh-22(q632) mutants fail to generate DTCs. Arrowheads indicate DTCs (lag-2::GFP, DTC marker). Asterisk indicates vulva. C: A table quantifying the percentage of DTC loss.

The effect of top-1FL on embryonic survival and morphology

To analyze the co-suppression phenotype of top-1 gene during embryogenesis, we observed embryos obtained from integrated top-1FL transgenic worms under DIC microscope. Most top-1FL embryos were arrested (or died) at different stages of embryonic development (Figure 1B), confirming the critical role of top-1 in embryogenesis [10]. We recently reported that top-1(RNAi) showed chromosomal bridges, DNA fragmentation, and cell division defects in early embryos [10]. The top-1FL embryos also exhibited multiple nuclei per cells at the early embryonic stages (not shown). Next, to determine the maternal effects of top-1 co-suppression on embryogenesis, we measured daily hatching rates of embryos obtained from wild-type and top-1FL transgenic worms at 20°C. Most embryos from wild-type adults survived (Figure 3A). However, the hatching rate of embryos from adult top-1FL worms was gradually decreased in an age-dependent manner (Figure 3A). This suggests that the maternal effect of top-1FL co-suppression on embryogenesis may be associated with adult age.

Figure 3.

Figure 3

Phenotypes in embryos produced by wild-type and top-1FL. (A) Maternal effects on embryonic hatching produced by top-1FL co-suppression. Top-1FL worms were allowed to lay embryos, which were collected every day, and their hatching rate was measured 15 h later. Each experiment was carried out for 10 worms and repeated three times. (B) Comma-staged wild-type embryo (C) Comma-staged top-1FL embryo that has abnormal enclosure, elongation and morphogenesis. The lateral focal planes of comma-staged wild-type (D) and top-1FL (E) embryos stained with MH27 monoclonal antibody. (F) L1 staged wild-type. (G) L1 staged top-1FL with an abnormal morphology.

C. elegans top-1 is predominantly expressed in the nuclei of most embryonic cells. Interestingly, top-1α isoform appears to localize in excretory cells of embryonic and larval stages [10]. The role of the excretory cell is to regulate osmotic/ionic regulation and waste elimination, which is analogous to the renal system of mammals [41-43]. In C. elegans, ceh-6 (one of three POU homeobox gene) is the ortholog of vertebrate Brn, Brn2, SCIP/Oct6 and Brn4 and fly Cf1a/drifter/ventral veinless [44]. Importantly, ceh-6(mg60) mutants showed excretory canal defects, resulting in embryonic lethality with grossly malformed morphology [44]. Therefore, we examined whether the co-suppression of top-1 gene affects embryonic morphogenesis. Notably, both top-1FL and top-1(ΔInt1&2) animals exhibited morphological defects (Figure 3C and 3E). To further examine the morphology defects, we used the MH27 monoclonal antibody, which recognizes adherens junction surrounding hypodermal cells in the pharynx and intestine [45]. In wild-type comma stage embryos, cells on each side line-up from one end to the other (Figure 3D). By contrast, comma-staged top-1FL embryos exhibited abnormal MH27 staining (Figure 3E). It was also noted that the hatched L1 top-1FL worms had severe morphological defects (Compare Figure 3F and 3G). Therefore, our results suggest that top-1 may be involved in a normal cell division during early embryogenesis and in proper morphogenesis during late embryogenesis and early larval stages.

Co-suppression of top-1FL affects lifespan and growth

In eukaryotes, DNA topoisomerase I is critical for DNA replication, transcription, and genomic stability [46]. Interference between replication and transcription mainly causes sponteneous replication stress and DNA damages, which contribute to genomic instability during the early stages of tumorigenesis [46]. Interestingly, DNA topoisomerase I (TopA) is associated with telomere complex with DNA polymerase I (PolA) in Streptomyces. Moreover, both TopA and PolA regulate telomeric repeats by a highly efficient reverse transcriptase activity [47,48]. However, the role of top-1 controlling lifespan has not been adequately investigated in multi-cellular organisms. In order to determine whether top-1FL affects the lifespan, we measured the lifespan of both wild-type and top-1FL transgenic worms. As shown in Figure 4A, the average lifespan for top-1FL worms was 7 days at 20°C, which was 51% of the wild-type lifespan. Moreover, top-1FL transgenic worms showed a strikingly slow growth rate, which corresponded to 59% of the value of the wild-type (Figure 4B and 4C).

Figure 4.

Figure 4

Shortened lifespan and slow growth of top-1FL worms. (A) Average lifespan of wild-type and top-1FL worms. Over 100 worms were tested in a single set of experiment, and each experiment was repeated three times. Growth rate of wild-type (B) top-1FL (C) worms. The growth rate was represented by the relative body length of top-1FL worms when wild-type worms grew up to the adult stage (3 days from L1). Growth rate of top-1FL worms corresponded to 59% of the wild type growth rate.

The human Topoisomerase 1 (Top 1) physically interacts with Werner protien (WRN) [49], which belongs to the RecQ family of DNA helicase. This is required for the maintenance of genomic stability and aging in human cells [49-51]. In addition, mammalian Top 1 is associated with several DNA metabolism proteins that have been implicated in aging [49,52]. Our results also suggest that C. elegans top-1 may play a role in the maintenance of lifespan. Although further studies are necessary to understand mechanisms underlying aging, our findings provide valuable insight into the function of mammalian Top 1 in reguating senescence.

Conclusion

Our recent studies determined the differential subcellular localization of C. elegans top-1 isoforms using immunohistochemistry and GFP reporter analysis [10]. The top-1β isoform is expressed in the nucleus of most tissues and cells, but top-1α isoform has tissue specificity [10]. RNAi targeted to both top-1 isoforms demonstrated that top-1 is essential for chromosome segregation in embryo [10] and spermatocyte [53] (Figure 5). It is also critical for germline proliferation and migration [10] (Figure 5). We here used a transgene-mediated co-suppression technique to investigate the further biological role of top-1 in vivo. We found that a full-length of top-1 transgene sufficiently induced co-suppression of endogenous top-1 genes, resulting in embryonic lethality and defects in germline proliferation and migration. Notably, transgene-mediated co-suppression copied the phenotypes of top-1(RNAi) with a stronger effect (Figure 1A). We also found that top-1 may function in morphogenesis, stem cell niche (DTC) specification, normal lifespan, and growth control (Figure 5). Evidently, the roles of Topoisomerase II in development events, including neural [54], retinal [55], and embryonic development [56] have been reported in several model systems to date, but the biological roles of top-1 in the specific developmental events are poorly understood. Therefore, our results may provide better understanding of the role of Topoisomerase I in other multicellular organisms, including humans.

Figure 5.

Figure 5

The role of C. elegans top-1 in various developmental processes. The summary of top-1 functions that were characterized by RNAi and/or the transgene-mediated co-suppression.

Acknowledgements

We thank the members of the Lee’s laboratory, Dr. Asch, Dr. Ruiz-Echevarría, and Dr. Yang for helpful discussion during the course of this work. The JK2736 (ceh-22(q632)) mutant and JK2868 (qIs56 [lag-2p::GFP+unc-119(+)]) transgenic line were provided by Dr. Judith Kimble (HHMI, University of Wisconsin-Madison) and Caenorhabditis Genetics Center (CGC). The CGC is supported by the National Institutes of Health - Office of Research Infrastructure Programs (P40 OD010440). This work was supported in part by East-West Collaboration Research Awards, Research and Education Fund, University of Research and Creative Awards (URCA), and Oncology Internal Grant from Brody School of Medicine at East Carolina University to M.H.L.

Supporting Information

References

  • 1.Champoux JJ. DNA topoisomerase I-mediated nicking of circular duplex DNA. Met Mol Biol. 2001;95:81–87. doi: 10.1385/1-59259-057-8:81. [DOI] [PubMed] [Google Scholar]
  • 2.Leppard JB, Champoux JJ. Human DNA topoisomerase I: relaxation, roles, and damage control. Chromosoma. 2005;114:75–85. doi: 10.1007/s00412-005-0345-5. [DOI] [PubMed] [Google Scholar]
  • 3.Lee MP, Brown SD, Chen A, Hsieh TS. DNA topoisomerase I is essential in Drosophila melanogaster. Proc Natl Acad Sci U S A. 1993;90:6656–6660. doi: 10.1073/pnas.90.14.6656. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Morham SG, Kluckman KD, Voulomanos N, Smithies O. Targeted disruption of the mouse topoisomerase I gene by camptothecin selection. Mol Cell Biol. 1996;16:6804–6809. doi: 10.1128/mcb.16.12.6804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Zhang CX, Chen AD, Gettel NJ, Hsieh TS. Essential functions of DNA topoisomerase I in Drosophila melanogaster. Dev Biol. 2000;222:27–40. doi: 10.1006/dbio.2000.9704. [DOI] [PubMed] [Google Scholar]
  • 6.Moukharskaya J, Verschraegen C. Topoisomerase 1 inhibitors and cancer therapy. Hematol Oncol Clin North Am. 2012;26:507–525. vii. doi: 10.1016/j.hoc.2012.03.002. [DOI] [PubMed] [Google Scholar]
  • 7.Garcia-Carbonero R, Supko JG. Current perspectives on the clinical experience, pharmacology, and continued development of the camptothecins. Clin Cancer Res. 2002;8:641–661. [PubMed] [Google Scholar]
  • 8.Froelich-Ammon SJ, Osheroff N. Topoisomerase poisons: harnessing the dark side of enzyme mechanism. J Biol Chem. 1995;270:21429–21432. doi: 10.1074/jbc.270.37.21429. [DOI] [PubMed] [Google Scholar]
  • 9.Lee MH, Jang YJ, Koo HS. Alternative splicing in the Caenorhabditis elegans DNA topoisomerase I gene. Biochim Biophys Acta. 1998;1396:207–214. doi: 10.1016/s0167-4781(97)00209-1. [DOI] [PubMed] [Google Scholar]
  • 10.Cha DS, Hollis SE, Datla US, Lee S, Ryu J, Jung HR, Kim E, Kim K, Lee M, Li C, Lee MH. Differential subcellular localization of DNA topoisomerase-1 isoforms and their roles during Caenorhabditis elegans development. Gene Expr Patterns. 2012;12:189–195. doi: 10.1016/j.gep.2012.03.002. [DOI] [PubMed] [Google Scholar]
  • 11.Byrd DT, Kimble J. Scratching the niche that controls Caenorhabditis elegans germline stem cells. Semin Cell Dev Biol. 2009;20:1107–1113. doi: 10.1016/j.semcdb.2009.09.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Wong MC, Schwarzbauer JE. Gonad morphogenesis and distal tip cell migration in the Caenorhabditis elegans hermaphrodite. Wiley Interdiscip Rev Dev Biol. 2012;1:519–531. doi: 10.1002/wdev.45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Bingham PM. Cosuppression comes to the animals. Cell. 1997;90:385–387. doi: 10.1016/s0092-8674(00)80496-1. [DOI] [PubMed] [Google Scholar]
  • 14.Mette MF, van der Winden J, Matzke MA, Matzke AJ. Production of aberrant promoter transcripts contributes to methylation and silencing of unlinked homologous promoters in trans. EMBO J. 1999;18:241–248. doi: 10.1093/emboj/18.1.241. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Rountree MR, Selker EU. DNA methylation inhibits elongation but not initiation of transcription in Neurospora crassa. Genes Dev. 1997;11:2383–2395. doi: 10.1101/gad.11.18.2383. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Pal-Bhadra M, Bhadra U, Birchler JA. Cosuppression in Drosophila: gene silencing of Alcohol dehydrogenase by white-Adh transgenes is Polycomb dependent. Cell. 1997;90:479–490. doi: 10.1016/s0092-8674(00)80508-5. [DOI] [PubMed] [Google Scholar]
  • 17.Pal-Bhadra M, Bhadra U, Birchler JA. Cosuppression of nonhomologous transgenes in Drosophila involves mutually related endogenous sequences. Cell. 1999;99:35–46. doi: 10.1016/s0092-8674(00)80060-4. [DOI] [PubMed] [Google Scholar]
  • 18.Ketting RF, Plasterk RH. A genetic link between co-suppression and RNA interference in C. elegans. Nature. 2000;404:296–298. doi: 10.1038/35005113. [DOI] [PubMed] [Google Scholar]
  • 19.Brenner S. The genetics of Caenorhabditis elegans. Genetics. 1974;77:71–94. doi: 10.1093/genetics/77.1.71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Lam N, Chesney MA, Kimble J. Wnt signaling and CEH-22/tinman/Nkx2.5 specify a stem cell niche in C. elegans. Curr Biol. 2006;16:287–295. doi: 10.1016/j.cub.2005.12.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Kramer JM, French RP, Park EC, Johnson JJ. The Caenorhabditis elegans rol-6 gene, which interacts with the sqt-1 collagen gene to determine organismal morphology, encodes a collagen. Mol Cell Biol. 1990;10:2081–2089. doi: 10.1128/mcb.10.5.2081-2089.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Lee MH, Ahn B, Choi IS, Koo HS. The gene expression and deficiency phenotypes of Cockayne syndrome B protein in Caenorhabditis elegans. FEBS Lett. 2002;522:47–51. doi: 10.1016/s0014-5793(02)02880-6. [DOI] [PubMed] [Google Scholar]
  • 23.Mariol MC, Walter L, Bellemin S, Gieseler K. A rapid protocol for integrating extrachromosomal arrays with high transmission rate into the C. elegans genome. J Vis Exp. 2013;82:e50773. doi: 10.3791/50773. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Lee MH, Hollis SE, Yoo BH, Nykamp K. Caenorhabditis elegans DNA-2 helicase/endonuclease plays a vital role in maintaining genome stability, morphogenesis, and life span. Biochem Biophys Res Commun. 2011;407:495–500. doi: 10.1016/j.bbrc.2011.03.045. [DOI] [PubMed] [Google Scholar]
  • 25.Broos S, Hulpiau P, Galle J, Hooghe B, Van Roy F, De Bleser P. ConTra v2: a tool to identify transcription factor binding sites across species, update 2011. Nucleic Acids Res. 2011;39:W74–78. doi: 10.1093/nar/gkr355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Timmons L, Court DL, Fire A. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene. 2001;263:103–112. doi: 10.1016/s0378-1119(00)00579-5. [DOI] [PubMed] [Google Scholar]
  • 27.Mariol MC, Walter L, Bellemin S, Gieseler K. A rapid protocol for integrating extrachromosomal arrays with high transmission rate into the C. elegans genome. J Vis Exp. 2013:e50773. doi: 10.3791/50773. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Le Hir H, Nott A, Moore MJ. How introns influence and enhance eukaryotic gene expression. Trends Biochem Sci. 2003;28:215–220. doi: 10.1016/S0968-0004(03)00052-5. [DOI] [PubMed] [Google Scholar]
  • 29.Rose AB. Requirements for intron-mediated enhancement of gene expression in Arabidopsis. RNA. 2002;8:1444–1453. doi: 10.1017/s1355838202020551. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Fuxman Bass JI, Tamburino AM, Mori A, Beittel N, Weirauch MT, Reece-Hoyes JS, Walhout AJ. Transcription factor binding to Caenorhabditis elegans first introns reveals lack of redundancy with gene promoters. Nucleic Acids Res. 2014;42:153–162. doi: 10.1093/nar/gkt858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Cogoni C, Macino G. Isolation of quelling-defective (qde) mutants impaired in posttranscriptional transgene-induced gene silencing in Neurospora crassa. Proc Natl Acad Sci U S A. 1997;94:10233–10238. doi: 10.1073/pnas.94.19.10233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Ruiz F, Vayssie L, Klotz C, Sperling L, Madeddu L. Homology-dependent gene silencing in Paramecium. Mol Biol Cell. 1998;9:931–943. doi: 10.1091/mbc.9.4.931. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Vaucheret H, Beclin C, Elmayan T, Feuerbach F, Godon C, Morel JB, Mourrain P, Palauqui JC, Vernhettes S. Transgene-induced gene silencing in plants. Plant J. 1998;16:651–659. doi: 10.1046/j.1365-313x.1998.00337.x. [DOI] [PubMed] [Google Scholar]
  • 34.Jensen S, Gassama MP, Heidmann T. Taming of transposable elements by homology-dependent gene silencing. Nat Genet. 1999;21:209–212. doi: 10.1038/5997. [DOI] [PubMed] [Google Scholar]
  • 35.Guo S, Kemphues KJ. par-1, a gene required for establishing polarity in C. elegans embryos, encodes a putative Ser/Thr kinase that is asymmetrically distributed. Cell. 1995;81:611–620. doi: 10.1016/0092-8674(95)90082-9. [DOI] [PubMed] [Google Scholar]
  • 36.Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 1998;391:806–811. doi: 10.1038/35888. [DOI] [PubMed] [Google Scholar]
  • 37.Ketting RF, Tijsterman M, Plasterk RH. Cosuppression in C. elegans. CSH Protoc. 2006;2006 doi: 10.1101/pdb.prot4318. [DOI] [PubMed] [Google Scholar]
  • 38.Kimble JE, White JG. On the control of germ cell development in Caenorhabditis elegans. Dev Biol. 1981;81:208–219. doi: 10.1016/0012-1606(81)90284-0. [DOI] [PubMed] [Google Scholar]
  • 39.Kimble J, Crittenden SL. Controls of germline stem cells, entry into meiosis, and the sperm/oocyte decision in Caenorhabditis elegans. Annu Rev Cell Dev Biol. 2007;23:405–433. doi: 10.1146/annurev.cellbio.23.090506.123326. [DOI] [PubMed] [Google Scholar]
  • 40.Tilmann C, Kimble J. Cyclin D regulation of a sexually dimorphic asymmetric cell division. Dev Cell. 2005;9:489–499. doi: 10.1016/j.devcel.2005.09.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Nelson FK, Riddle DL. Functional study of the Caenorhabditis elegans secretory-excretory system using laser microsurgery. J Exp Zool. 1984;231:45–56. doi: 10.1002/jez.1402310107. [DOI] [PubMed] [Google Scholar]
  • 42.Nelson FK, Albert PS, Riddle DL. Fine structure of the Caenorhabditis elegans secretory-excretory system. J Ultrastruct Res. 1983;82:156–171. doi: 10.1016/s0022-5320(83)90050-3. [DOI] [PubMed] [Google Scholar]
  • 43.Igarashi P. Overview: nonmammalian organisms for studies of kidney development and disease. J Am Soc Nephrol. 2005;16:296–298. doi: 10.1681/ASN.2004110951. [DOI] [PubMed] [Google Scholar]
  • 44.Burglin TR, Ruvkun G. Regulation of ectodermal and excretory function by the C. elegans POU homeobox gene ceh-6. Development. 2001;128:779–790. doi: 10.1242/dev.128.5.779. [DOI] [PubMed] [Google Scholar]
  • 45.Labouesse M. Deficiency screen based on the monoclonal antibody MH27 to identify genetic loci required for morphogenesis of the Caenorhabditis elegans embryo. Dev Dyn. 1997;210:19–32. doi: 10.1002/(SICI)1097-0177(199709)210:1<19::AID-AJA3>3.0.CO;2-4. [DOI] [PubMed] [Google Scholar]
  • 46.Tuduri S, Crabbe L, Tourriere H, Coquelle A, Pasero P. Does interference between replication and transcription contribute to genomic instability in cancer cells? Cell Cycle. 2010;9:1886–1892. doi: 10.4161/cc.9.10.11539. [DOI] [PubMed] [Google Scholar]
  • 47.Bao K, Cohen SN. Reverse transcriptase activity innate to DNA polymerase I and DNA topoisomerase I proteins of Streptomyces telomere complex. Proc Natl Acad Sci U S A. 2004;101:14361–14366. doi: 10.1073/pnas.0404386101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Kang MR, Muller MT, Chung IK. Telomeric DNA damage by topoisomerase I. A possible mechanism for cell killing by camptothecin. J Biol Chem. 2004;279:12535–12541. doi: 10.1074/jbc.M309779200. [DOI] [PubMed] [Google Scholar]
  • 49.Laine JP, Opresko PL, Indig FE, Harrigan JA, von Kobbe C, Bohr VA. Werner protein stimulates topoisomerase I DNA relaxation activity. Cancer Res. 2003;63:7136–7146. [PubMed] [Google Scholar]
  • 50.Singh DK, Ahn B, Bohr VA. Roles of RECQ helicases in recombination based DNA repair, genomic stability and aging. Biogerontology. 2009;10:235–252. doi: 10.1007/s10522-008-9205-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Mohaghegh P, Hickson ID. Premature aging in RecQ helicase-deficient human syndromes. Int J Biochem Cell Biol. 2002;34:1496–1501. doi: 10.1016/s1357-2725(02)00039-0. [DOI] [PubMed] [Google Scholar]
  • 52.Plaschkes I, Silverman FW, Priel E. DNA topoisomerase I in the mouse central nervous system: Age and sex dependence. J Comp Neurol. 2005;493:357–369. doi: 10.1002/cne.20793. [DOI] [PubMed] [Google Scholar]
  • 53.Chu DS, Liu H, Nix P, Wu TF, Ralston EJ, Yates JR 3rd, Meyer BJ. Sperm chromatin proteomics identifies evolutionarily conserved fertility factors. Nature. 2006;443:101–105. doi: 10.1038/nature05050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Yang X, Li W, Prescott ED, Burden SJ, Wang JC. DNA topoisomerase IIbeta and neural development. Science. 2000;287:131–134. doi: 10.1126/science.287.5450.131. [DOI] [PubMed] [Google Scholar]
  • 55.Li Y, Hao H, Tzatzalos E, Lin RK, Doh S, Liu LF, Lyu YL, Cai L. Topoisomerase IIbeta is required for proper retinal development and survival of postmitotic cells. Biol Open. 2014;3:172–184. doi: 10.1242/bio.20146767. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Dovey M, Patton EE, Bowman T, North T, Goessling W, Zhou Y, Zon LI. Topoisomerase II alpha is required for embryonic development and liver regeneration in zebrafish. Mol Cell Biol. 2009;29:3746–3753. doi: 10.1128/MCB.01684-08. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials


Articles from International Journal of Biochemistry and Molecular Biology are provided here courtesy of e-Century Publishing Corporation

RESOURCES