Background: The glucocorticoid receptor β (GRβ) is a positive regulator of growth.
Results: GRβ suppression of PTEN resulted in enhanced phosphorylation of Akt and growth.
Conclusion: GRβ enhances insulin-induced proliferation by suppressing PTEN and activating Akt1.
Significance: GRβ suppression of PTEN indicates that it has an important role in growth factor signaling and potentially cancer.
Keywords: Akt, Cell Growth, Cell Proliferation, Glucocorticoid, Glucocorticoid Receptor, Hormone Receptor, Insulin, Phosphatase and Tensin Homolog (PTEN)
Abstract
Glucocorticoids (GCs) are known inhibitors of proliferation and are commonly prescribed to cancer patients to inhibit tumor growth and induce apoptosis via the glucocorticoid receptor (GR). Because of alternative splicing, the GR exists as two isoforms, GRα and GRβ. The growth inhibitory actions of GCs are mediated via GRα, a hormone-induced transcription factor. The GRβ isoform, however, lacks helix 12 of the ligand-binding domain and cannot bind GCs. While we have previously shown that GRβ mRNA is responsive to insulin, the role of GRβ in insulin signaling and growth pathways is unknown. In the present study, we show that GRβ suppresses PTEN expression, leading to enhanced insulin-stimulated growth. These characteristics were independent of the inhibitory qualities that have been reported for GRβ on GRα. Additionally, we found that GRβ increased phosphorylation of Akt basally, which was further amplified following insulin treatment. In particular, GRβ specifically targets Akt1 in growth pathways. Our results demonstrate that the GRβ/Akt1 axis is a major player in insulin-stimulated growth.
Introduction
Regulation of growth pathways is an important component of cellular physiology that maintains division, nutrient uptake, and cell fate. The phosphatase and tensin homolog deleted on chromosome 10 (PTEN)2 is essential for growth regulation, and its inactivation or deletion has been shown in a variety of cancers (1). A prominent feature of PTEN signaling is inhibition of the phosphoinositide 3-kinase (PI3-kinase) pathway, which results in reduced 3-phosphoinositide (PIP3) levels and suppressed growth (2). A plethora of growth factors and cytokines activate the PI3-kinase lipid enzyme, resulting in the conversion of 2-phosphoinositide (PIP2) to 3-phosphoinositide (PIP3) (3). PIP3 binds to the PH domain of Akt resulting in phosphorylation and activation, which increases cell survival, growth, and metabolism (2, 3). Interestingly, glucocorticoids (GCs), which inhibit growth (4) and induce apoptosis in a variety of cells (5), have been shown to increase expression of PTEN in A549 human lung carcinoma cells (6). This suggests that one aspect of the anti-growth properties of GCs may be mediated through the up-regulation of PTEN. However, the roles of the glucocorticoid receptors (GRs), especially the separation of GRα and GRβ isoforms, in the regulation of PTEN-mediated effects on growth pathways, have not been investigated.
As a result of alternative splicing of exon 9 of a single gene, there exists two GR isoforms, α and β, which vary at their C terminus. There also exist a GRγ isoform from the use of an alternative splice donor site in which three base pairs are retained between exons 3 and 4 (7). As a consequence, an additional arginine is located in the DNA binding domain, resulting in decreased binding (8). The GR α and β isoforms have been the most studied. The GRα is a hormone-activated transcription factor that controls many physiological processes, extending from apoptosis, glucose metabolism to lung development (9, 10). The GRβ isoform, however, lacks helix 12 of the C terminus in the ligand-binding domain and cannot bind GCs (11). The anti-proliferative properties of GCs are mediated by GRα, which have been attributed to elevation of cell cycle arrest proteins, p27 and p21 (12, 13). A reduction in GRα in murine macrophages results in enhanced growth and decreased expression of p27 (14). This implies that resistance to GC-induced apoptosis may occur by reducing GRα levels. In humans, GC resistance can occur by two major mechanisms: loss-of-function mutations in GRα (15), or by increased expression of GRβ, which acts as a dominant-negative inhibitor to GRα (11). Although GRα mutations can result in a type of GC resistance that is both systemic and severe, these mutations are rare. In contrast, the evolving evidence suggests that GC resistance based on GRβ is much more common and likely to be tissue-specific in nature.
The best-studied apoptotic roles of GCs have been in cancers of the immune system such as lymphoma and leukemia. Immune system homeostasis is balanced by GCs, which regulate immune cell turnover by suppressing cytokine production and promoting apoptosis. GC insensitivity due to elevated human GRβ (hGRβ) expression results in higher levels of proinflammatory cytokines, leading to escalated cell growth and reduced cell death (16). As well, proinflammatory cytokines, such as tumor necrosis factor α (TNFα) and interleukin-1 (IL-1), increase expression of GRβ via the NF-κB pathway (17). Ascending levels of GRβ in asthma patients cause many disease complications, including GC resistance that can verge to a complete loss of drug response (18). Importantly, both leukemia (19) and systemic lupus erythematosus (20) have been linked to high levels of GRβ, which may underlie the exacerbated immune cell growth observed in these patients. How GRβ regulates growth is unknown, but the mechanism may involve inhibition of GRα-induced apoptosis or direct GRβ epigenetic signaling. A previous study reported gene-specific activity for GRβ that is independent of GRα (21), a known inhibitor of growth. Therefore, in this study, we investigated the effect of GRβ on the insulin signaling pathways guiding proliferation. Our findings demonstrate that GRβ plays an important role in the control of insulin signaling by suppressing PTEN, resulting in the enhancement of growth.
EXPERIMENTAL PROCEDURES
Cell Lines and Culture
The mouse 3T3-L1, C2C12, RAW 264.7, S49 and embryonic fibroblast (MEF) were routinely cultured and maintained in Dulbecco's Modified Eagles's Medium (DMEM) containing 10% bovine calf serum or FBS with 1% penicillin-streptomycin. The scramble and GRβ MEF cell lines were grown as previously described (11).
Whole Cell Extraction
Cells were washed and collected in 1× PBS followed by centrifugation at 1500 × g for 10 min. The supernatant was discarded, and the pellet was resuspended in 1× PBS. After a short spin at 20,800 × g for 5 min at 4 °C, the pellet was rapidly frozen on a dry ice ethanol mix and stored at −80 °C for 30 min. The frozen pellet was then resuspended in 3 volumes of cold whole cell extract buffer (20 mm HEPES, 25% glycerol, 0.42 m NaCl, 0.2 mm EDTA, pH 7.4) with protease inhibitors and incubated on ice for 10 min. The samples were centrifuged at 100,000 × g for 5 min at 4 °C. Protein levels were measured spectrophotometrically by a Nanodrop 2000 (Thermo Fisher Scientific, Wilmington, DE). The supernatants were either stored at −80 °C or used immediately for Western analysis to determine protein expression levels.
Quantitative Real-Time PCR Analysis
Total RNA was extracted from mouse tissues using 5-Prime PerfectPure RNA Cell Kit (Fisher Scientific Company, LLC). Total RNA was read on a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE) and cDNA was synthesized using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). PCR amplification of the cDNA was performed by quantitative real-time PCR using TrueAmp SYBR Green qPCR SuperMix (Smart Bioscience). The thermocycling protocol consisted of 10 min at 95 °C, 40 cycles of 15 s at 95 °C, 30 s at 60 °C, and 20 s at 72 °C and finished with a melting curve ranging from 60–95 °C to allow distinction of specific products. Primer sequences were downloaded from a primer database. Normalization was performed in separate reactions with primers to GAPDH.
Generation of Lentiviral Constructs
To establish a 3T3-L1 cell line that has mGRβ stably overexpressed, mGRβ cDNA was ligated into the XbaI/XhoI sites of the FG12 vector that has an independent GFP marker and transformed in DH5α cells (Invitrogen). The construct was co-transfected together with vectors expressing gag-pol, REV, and VSV-G into 293FT cells (Invitrogen) to generate a third generation lentiviral construct. Transfection was achieved using GeneFect (Alkali Scientific, Inc.) using 100 ng of total DNA per cm2 of the growth plate or well. The supernatants were harvested, and the cell debris was removed by centrifugation at 2000 × g. The supernatant was used to infect 3T3-L1 cells after addition of polybrene (5 ng/ml, Sigma) to establish cell lines with stable overexpression of mGRβ mRNA (3T3-GRβ) or expressing empty vector (3T3-V). After 72 h, the cells were sorted by flow cytometry for GFP by the Flow Cytometry Core Facility at the University of Toledo Health Science Campus. GFP-positive cells were used for all experiments.
Transient Transfection
For transient transfection cells were plated on a 6-well dish in DMEM containing 10% calf serum prior to transfection and allowed to grow to 85–90% confluency. Cells were washed with OPTI-MEM and transfected using GeneFect (Alkali Scientific, Inc.), according to the manufacturer's protocol. OPTI-MEM was removed after 5 h and DMEM containing 10% calf serum was added. All insulin treatments were done 24 h post-transfection for 30 min.
Targeting of Mouse GRβ mRNA
Targeting of mouse GRβ was designed and purchased using the Integrated DNA Technologies (IDT) sciTools RNAi Design website. Two siRNA targets were designed: Seq 1 (gatgtaagtaccaaacataaatc) and Seq 2 (gtcagagatacgtaagagatccta), as well as scramble control. Transient transfection of the siRNAs was performed using GeneFect (Alkali Scientific, Inc.) for 24 h.
Targeting of the Mouse GR Gene
A peptide nucleic acid (PNA) targeting the branch point sequences (BPS) in intron 8 of the mouse GR gene (previously identified in Ref. 11) was designed using PANAGENE. Two different PNAs were designed: CPP-PNA-i8BPS (gactgattggtatat) and CPP-PNA-i8C (atataccaatcagtc). All PNAs were attached to an O Linker and a modified TAT protein (VQRKRQKLMP) for delivery into the cell (cell penetrating peptide - CPP). Treatment with CPP-PNAs was performed for 24 h.
Promoter Reporter Assays
Expression vector for mGRβ (pMGRβ-H57) was constructed as previously described (11). PTEN promoter (full-length, truncations and mutants) activity was measured by luciferase, and these constructs were made as defined in Ref. 22, and pRL-CMV Renilla reporter for normalization to transfection efficiency. Transient transfection was achieved using GeneFect (Alkali Scientific, Inc.). 24-h post-transfected cells were lysed, and the luciferase assay was performed using the Promega luciferase assay system (Promega).
Gel Electrophoresis and Western Blotting
Whole cell extracts (WCE) were prepared by freezing the cell pellet overnight at −80 °C. The pellet was then resuspended in 3 volumes of WCE buffer (20 mm HEPES, 0.42 m NaCl, 0.2 m EDTA, 25% glycerol, pH 7.4) plus protease inhibitor mixture and incubated on ice for 10 min followed by 100,000 × g centrifugation at 4 °C. Protein samples were resolved by SDS-polyacrylamide gel electrophoresis and electrophoretically transferred to Immobilon-FL membranes. Membranes were blocked at room temperature for 1 h in TBS (TBS; 10 mm Tris-HCl (pH 7.4) and 150 mm NaCl) containing 3% BSA. Subsequently, the membrane was incubated overnight at 4 °C with FiGR antibody for mGRα (Santa Cruz Biotechnology, Dallas, Texas) or rMGRβ antibody for mGRβ (described in Ref. 11) at a dilution of 1:1000 in TBS. Antibodies that recognize HSP90, Akt1, Akt2, pAkt, and total Akt were purchased from Santa Cruz Biotechnology and added at a dilution of 1:1000 in TBS. After three washes in TBST (TBS plus 0.1% Tween 20), the membrane was incubated with an infrared anti-rabbit (IRDye 800, green) or anti-mouse (IRDye 680, red) secondary antibody labeled with IRDye infrared dye (LI-COR Biosciences) (1:15,000 dilution in TBS) for 2 h at 4 °C. Immunoreactivity was visualized and quantified by infrared scanning in the Odyssey system (LI-COR Biosciences).
Proliferation Assays
Scramble and mGRβ OE 3T3-L1 cells (1 × 104 cells per well) were plated in 24-well plates in DMEM containing 10% calf serum. The growth rate was determined as a function of time for 0–5 days. To determine the effect of insulin-stimulated cell growth, Scramble and mGRβ OE 3T3-L1 cells were grown in DMEM containing dialyzed serum were treated with 100 nm insulin for 24 h, cell proliferation was determined by a calorimetric assay using MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-dipheyltetrazoline bromide) as previously described (23).
Statistical Analysis
Data were analyzed with Prism 5 (GraphPad Software, San Diego, CA) using analysis of variance combined with Tukey's post-test to compare pairs of group means or unpaired t tests. Additionally, two-way ANOVA was utilized in multiple comparisons, and followed by the Bonferroni post hoc analysis to identify interactions. p values of 0.05 or smaller were considered statistically significant.
RESULTS
Detection of GRβ Expression in Tissues and Cells from Different Murine Lineages
The recent discovery of the mouse GRβ (mGRβ) has opened new avenues for studying glucocorticoids and the actions of glucocorticoid receptors (11): whether mouse GRβ (mGRβ) is expressed by various cell types and lineages are largely unknown. To detect mGRβ and mGRα in different tissues of murine origin, we analyzed lysates from muscle, liver, spleen, kidney, and heart (Fig. 1A). The mGRα was detected at 97 kDa in muscle, liver, spleen, and to a lesser extent in kidney and heart. We detected the GRβ protein in muscle and liver at 92 and 102 kDa. In spleen, kidney, and heart only the 102-kDa GRβ band was present. The shift in molecular weight was also noticed for human GRβ in heart and skeletal muscle tissues (24). We therefore wanted to analyze the expression of mGRβ in murine cells from hepatic and muscle lineages (Fig. 1B). We found in Hepa1c1c7 hepatocytes that mouse GRβ is detectable at the 92 and 102 kDa bands, and C2C12 myocytes had a single band at 102 kDa. The mGRα levels were lower in C2C12 myocytes compared with Hepa1c1c7 hepatocytes. These results suggest that cells from mesenchymal and endodermal origins may have a differential GRβ and GRα expression. To compare murine cells of mesenchymal origin we used mouse embryonic fibroblast (MEF), 3T3-L1 and C2C12 cells (Fig. 1C). Western blotting analysis showed that MEF and C2C12 have similar detectable levels of mGRβ (p = 0.23). C2C12 cells have reduced mGRα levels compared with MEF (p = 0.007). Interestingly, the 3T3-L1 cell line has very low to undetectable levels of mGRβ and mGRα. Furthermore, we determined mGRβ and mGRα expression in two murine immune cell lines, RAW 264.7 leukemic monocyte/macrophage, and S49 lymphoma cells (Fig. 1D). Interestingly, S49 lymphocytes have significantly higher expression of mGRβ (p = 0.0036) compared with RAW 264.7 cells, and lower expression of mGRα (p < 0.001).
FIGURE 1.
Expression of GRβ and α in mouse tissues and cell lines. A, Western blot of GRβ, GRα, and HSP90 from mouse lysates of muscle, liver, spleen, kidney, and heart. B, Western blot of GRα and β in mouse Hepa1c1c7 hepatocytes and C2C12 myocytes. C, Western blot and densitometry of GRβ & α in MEF, 3T3-L1, and C2C12 cells. ##, p < 0.01 (versus C2C12 GRβ); ***, p < 0.001 (versus MEF GRβ); #, p < 0.05 (versus C2C12 GRα); **, p < 0.05 (versus MEF GRα); $, p < 0.05 (versus C2C12 GRβ); (±S.E.; n = 3). D, Western blot and densitometry of GRβ & α in RAW 264.7 mouse macrophage and S49 lymphoma mouse T cells. **, p < 0.01 (versus RAW 264.7 GRβ); ***, p < 0.001 (versus RAW 264.7 GRα) (±S.E.; n = 3).
Mouse GRβ Sensitizes to Insulin Signaling
We have previously shown that mGRβ mRNA was increased in MEF cells and in livers of mice that were fasted and refed (11). Here, we treated MEF cells with 100 nm insulin for 24 h and determined mGRβ expression. Confirming our previous mRNA results, mGRβ protein expression was significantly increased following insulin treatment and no change was observed in mGRα (Fig. 2A). The capacity of GRβ in insulin signaling is unknown. Therefore, we determined the impact of mGRβ on the phosphorylation of Akt with and without insulin treatments for 30 min in MEF cells overexpressing mGRβ. To our surprise, overexpression of mGRβ basally increased pAkt, which was further elevated upon insulin treatment compared with vector controls (Fig. 2B).
FIGURE 2.
GRβ sensitizes to insulin signaling. A, Western blot and densitometry of GRα, GRβ, and GAPDH in MEF cells published treated with 100 nm insulin for 24 h. **, p < 0.01 (versus control GRβ) (±S.E.; n = 3). B, Western blot and densitometry of phospho and total Akt in MEFs transiently transfected with plasmids for vector and GRβ (GRβ OE) in dialyzed serum treated with 100 nm insulin for 30 min. *, p < 0.05 (versus vector control); #, p < 0.05 (versus vector control); $, p < 0.05 (versus vector insulin treated) (±S.E.; n = 3).
Mouse GRβ Enhances Growth by Suppression of PTEN
Our studies in Fig. 1C showed that 3T3-L1 cells have undetectable levels of mGRβ and mGRα protein. Therefore, we created a cell line that stably overexpressed only mGRβ (3T3-GRβ) or vector control (3T3-V) to elucidate the actions of mGRβ outside of its known GRα inhibitory role (11, 25). In Fig. 3A, we show that the 3T3-GRβ cell line highly expressed mGRβ protein. Interestingly, this cell line had significantly reduced PTEN expression (p = 0.0001), suggesting a positive role of mGRβ in insulin signaling. Therefore, we measured protein expression of Akt1 and Akt2. Unexpectedly, the 3T3-GRβ cells had significantly higher Akt1 (p = 0.0060) with no change in Akt2 (p = 0.1867) expression (Fig. 3A). To confirm that mGRβ regulates phosphorylation of Akt, we treated 3T3-GRβ and 3T3-V cells with insulin for 30 min. Basally, mGRβ significantly increased pAkt, which was further enhanced upon insulin treatments (Fig. 3B). Because mGRβ inhibited expression of PTEN and enhanced Akt1, which has been shown to regulate cellular proliferation (26), we investigated proliferation in the 3T3-GRβ cells (Fig. 3C). Growth of 3T3-GRβ cells was significantly higher (ANOVA, p = 0.0001) than the 3T3-V cells (Fig. 3D), specifically at days 4 (p < 0.001) and 5 (p < 0.001) of growth. Additionally, 24 h of insulin treatment significantly increased growth of 3T3-GRβ cells (p = 0.0405).
FIGURE 3.
GRβ increases growth by suppression of PTEN. A, Western blot and densitometry of GRβ, PTEN, Akt1, Akt2, and HSP90 in 3T3-V and 3T3-GRβ cells grown in regular BCS serum. ***, p < 0.001 (versus 3T3-V); **, p < 0.01 (versus 3T3-V) (±S.E.; n = 3). B, Western blot and densitometry of phospho and total Akt in 3T3-V and 3T3-GRβ cells in dialyzed serum treated with 100 nm insulin for 30 min. *, p < 0.05 (versus 3T3-V control); #, p < 0.01 (versus 3T3-V control); ***, p < 0.001 (versus 3T3-V insulin treated) (±S.E.; n = 3). C, 5 day growth curve of 3T3-V and 3T3-GRβ cells in regular BCS growth serum. (ANOVA, p < 0.0001) (***, p < 0.001, interaction on days 4 and 5) (±S.E.; n = 6). D, 3T3-V and 3T3-GRβ cells were equally plated and grown in dialyzed FBS serum for 24 h. Then, cells were treated with insulin for 24 h. Growth was measured as MTT. *, p < 0.05 (versus 3T3-V control); #, p < 0.01 (versus 3T3-V control) (±S.E.; n = 3).
Targeting of Mouse GRβ Enhances PTEN Expression
We designed two siRNAs targeting mGRβ expression to determine if PTEN expression is enhanced with reduced levels of mGRβ (Fig. 4A). Sequence 1 (Seq 1) was designed within the coding region of mGRβ within intron 8. Seq 2, however, was designed outside of the coding region of mGRβ to determine if mGRβ expression can be regulated outside this region. Seq 1 significantly decreased mGRβ expression by 62%, resulting in 2.1-fold enhancement of PTEN expression (p = 0.0113) (Fig. 4B). Seq 1 targeting of mGRβ had no effect on mGRα expression. Interestingly, Seq 2 had no effect on mGRβ expression demonstrating that siRNA targeting of mGRβ must occur within the coding region of intron 8 of the mouse glucocorticoid receptor gene.
FIGURE 4.
Knockdown of GRβ increases PTEN expression. A, targeting of siRNA knockdown of mGRβ. B, Western blot and densitometry of GRβ, GRα, PTEN, and HSP90 in MEF cells. ***, p < 0.001 (versus scramble); **, p < 0.05 (versus scramble) (±S.E.; n = 6).
Targeting of the Mouse GR Gene Enhances mGRβ Expression
We have previously identified two putative branch point sequences (BPS) within intron 8 of the mouse GR gene (11). We wanted to determine if specific targeting of the BPS utilizing a PNA conjugated to a cell-penetrating peptide (CPP) (modified TAT protein) can bind to intron 8 of the mouse GR gene to regulate alternative splicing of GRβ or GRα. A dose-dependence treatment with CPP-PNA-i8BPS significantly enhanced mGRβ expression at 100 nm and 500 nm, and decreased expression of mGRα (Fig. 5A). Treatment with the control CPP-PNA-i8C resulted in no change in either mGRβ or mGRα mRNA expression. We have shown in Fig. 3A that increasing mGRβ expression decreased PTEN. Therefore, we measured mRNA expression of PTEN with 100 nm BPS1-CPP-i8BPS treatment for 24 h. Increasing mGRβ expression via CPP-PNA-i8BPS decreased PTEN mRNA expression by 38% (Fig. 5B). In Fig. 5C, immunoblotting confirmed that treatment with 100 nm of BPS1-CPP-i8BPS significantly decreased expression of PTEN (p = 0.0405), enhanced mGRβ (p = 0.0358), and no change in GRα (p = 0.3716).
FIGURE 5.
Increasing GRβ expression by PNA decreases PTEN expression. A, real-time PCR of MEF cells treated with CPP-PNA-i8BPS (targeting GRβ) or CPP-PNA-i8C (control) for 24 h to enhance mouse GRβ expression-dose dependence (0, 25, 50, 100, and 500 nm PNA) in dialyzed serum (±S.E.; n = 6). B, real-time PCR expression of PTEN in MEF cells treated with 100 nm CPP-PNA-i8C or CPP-PNA-i8C for 24 h. ***, p < 0.001 (versus control) (±S.E.; n = 3). C, Western blot and densitometry GRβ & α MEFs with 100 nm CPP-PNA-i8BPS or CPP-PNA-i8C treatment for 24 h in dialyzed serum. **, p < 0.01 (versus control); *, p < 0.01 (versus control); (±S.E.; n = 3).
Mouse GRβ Regulates Promoter Activity of PTEN
To determine if mGRβ inhibits the PTEN promoter we utilized the PTEN-luciferase construct. Overexpression of mGRβ in MEF cells resulted in a significant (p = 0.0136) reduction of PTEN promoter activity by 21% compared with vector controls (Fig. 6A). In the 3T3-L1 cells, which have very low levels of both GRβ and GRα (Fig. 1A), overexpression of GRβ resulted in a robust 56% reduction in PTEN promoter activity (Fig. 6A). We determined if targeting of PTEN expression would have a reciprocal effect on mGRβ or mGRα expression. Interestingly, siRNA knockdown of PTEN in MEF cells had no effect on mGRβ, mGRα or Akt1 mRNA expression (Fig. 6B). In the mGRβ shRNA knockdown MEF cells published in (11) (Fig. 6C), PTEN mRNA expression was significantly increased (p < 0.05) with no change in Akt1 (Fig. 6D). Insulin treatment in 3T3-L1 and MEF cells increased PTEN promoter activity, which was inhibited by overexpression of GRβ (Fig. 6E). Truncations of the PTEN promoter showed that GRβ is targeting the −1344 to −1001 region (Fig. 7A). Mutations of the PTEN promoter in the −1228 to −1149 region showed that GRβ is specifically targeting the SubB and SubC mutant regions (Fig. 7B).
FIGURE 6.
GRβ inhibits the promoter of PTEN. A, 3T3-L1 and MEF cells were transiently transfected with the PTEN promoter luciferase plasmid construct (PTEN-luc) for 24 h with vector and mGRβ overexpressed. *, p < 0.05 (versus vector); **, p < 0.01 (versus vector) (±S.E.; n = 3). B, knockdown of PTEN by siRNA in MEF cells for 24 h. Real-time PCR expression of GRβ, GRα, PTEN, Akt1, and Akt2. ***, p < 0.001 (versus scramble) (±S.E.; n = 3). C, Western blot of GRα, GRβ, and GAPDH in vector and GRβ KD MEF cells (published in Ref. 11). D, real-time PCR expression of PTEN, Akt1, and Akt2 expression in vector and GRβ KD MEF cells. *, p < 0.05 (versus vector) (±S.E.; n = 3). E, 3T3-L1 and MEF cells were transiently transfected with the PTEN promoter luciferase plasmid construct (PTEN-luc) for 24 h in dialyzed FBS serum with vector and mGRβ overexpressed followed by 24 h insulin treatment. 3T3-L1, *, p < 0.05 (versus vector control); **, p < 0.01 (versus vector control); #, p < 0.01 (versus vector insulin treated) (±S.E.; n = 6). MEF, ***, p < 0.001 (versus vector control); *, p < 0.05 (versus vector control); #, p < 0.001 (versus vector insulin treated); (±S.E.; n = 6).
FIGURE 7.
Target area that GRβ inhibits the PTEN promoter. A, 3T3-L1 cells were transiently transfected with the PTEN promoter truncated luciferase plasmid constructs for 48 h with vector and mGRβ overexpressed. ***, p < 0.001 (versus vector 1344–0); **, p < 0.01 (versus vector 1344–1001); (±S.E.; n = 12). B, 3T3-L1 cells were transiently transfected with the PTEN promoter mutant luciferase plasmid constructs for 48 h with vector and mGRβ overexpressed. ***, p < 0.001 (versus vector 1344–0); **, p < 0.01 (versus vector SubA); #, p < 0.01 (versus vector SubD); (±S.E.; n = 6).
DISCUSSION
This is the first study to demonstrate that GRβ can enhance proliferation by the suppression of PTEN. Here we report that GRβ protein expression is elevated by insulin treatment, which enhances growth through modulating PTEN promoter activity. Increasing levels of PTEN has been shown to be essential for the suppression of PI3-kinase induced tumor growth in mice (27). Insulin increased PTEN promoter activity over a 24-h period, which implies a negative feedback regulation. Interestingly, GRβ suppressed the negative feedback regulation decreasing PTEN expression, leading to exacerbated Akt phosphorylation and growth. This suggests that long term increases in GRβ expression may enhance growth by suppressing PTEN leading to over stimulation of PI3-kinase and Akt. Inhibitors of the PI3-kinase pathway enhanced GC induced apoptosis in human lymphoma cells (28), which indicate a positive feedback between glucocorticoids/GRα and PTEN in the suppression of growth. The interplay between GRα and PTEN was demonstrated in T-cells extracted from human leukemia patients, which had increased PTEN expression following GC treatment (29). However, patients that relapsed had a complete loss of PTEN expression. The recruitment of GRβ to the PTEN promoter uncovers an essential pathway for understanding the mechanism of the inhibition of GC induced apoptosis and sensitization to Akt stimulated growth. The GRβ inhibition of GC-induced growth has been shown in peripheral mononuclear cells, in which cytokine stimulation increased GRβ expression and prevented apoptosis (30). Interestingly, we show that protein expression of GRβ is more abundant in mouse lymphoma cells compared with GRα. Similarly, high expression levels of GRβ have been reported in immune cells of lupus (20) and leukemia (19) patients, suggesting that a leading target for inhibiting growth in these cells would be GRβ. Here we show that siRNA targeting of GRβ in MEF cells concomitantly increased PTEN expression.
We have also discovered that GRβ selectively increases Akt1 expression over that of Akt2. Our finding of GRβ in mice (11) and the recent report by Dubois et al. on GRβ in the rat (31), suggest that rodent GRβ has a possible role in metabolic signaling (11). Therefore, we determined the impact of elevated GRβ on the insulin signaling pathway, showing that it leads to exacerbated Akt phosphorylation and growth. Akt exists as three structurally similar, yet different, isoforms: Akt1, Akt2, and Akt3. The functionality of these isoforms has been shown to be divergent, even though their structures are similar. The Akt1 isoform has been shown to be essential in the regulation of development and growth (26, 32). In contrast, the Akt2 isoform is mostly involved in glucose uptake (33) and adipogenesis (34). These actions have lead several investigators to study the involvement of Akt2 in metabolic diseases, such as diabetes and obesity (33). Akt3 has been the least studied of the isoforms, but investigations show that Akt3 may have a possible role in brain development (35). The growth regulation properties of Akt1 have made it a major target in cancer studies (32, 36, 37), especially PTEN-mediated inhibition of Akt1 in tumor development (38). The selectively of GRβ for Akt1 indicates a potential capacity of this nuclear receptor in growth pathways. This was demonstrated by lentiviral overexpression of GRβ in 3T3-L1 cells, which resulted in elevated Akt1 expression and enhanced insulin-stimulated proliferation. Akt1 is a direct target of the insulin/PI3-kinase induced growth pathway, and deletions have been beneficial in cancer, especially in lung tumorigenesis by mutant K-ras (36). Additionally, the suppression of the PI3-kinase/Akt1 growth pathway by gene targeting or by the PI3-kinase inhibition has been shown to decrease tumor mass size (37). Interestingly, Piovan et al. identify Akt1 as a negative regulator of GRα by phosphorylating serine 134, which resulted in GC resistance in T cell acute lymphoblastic leukemia (39). They also show that suppression of PTEN inhibits GRα expression and activity, enhances Akt phosphorylation, resulting in GC-resistance.
To date, most studies have only considered GRβ as an inhibitor of GC action, primarily due to its ability to heterodimerize with GRα (18, 40) and to recruit histone deacetylases inhibiting gene activity (41). The impedimentary action of GRβ on GRα was recently demonstrated by Varricchio et al. in polycythemia vera (PV) patients, which have increased erythroid cell growth (42). This study found that PV patients have a polymorphism in the human GR gene that leads to the stabilization of the GRβ mRNA, resulting in higher protein levels. Interestingly, these patients have exacerbated GRβ/GRα heterodimerization and expansion of erythroblast. GRα is known to heterodimerize with other members of the steroid receptor family, such as the mineralocorticoid (MR) and androgen (AR) receptors (43, 44). It is also possible that GRβ may regulate steroid receptor activity other than GRα. The GRβ/Akt1 growth axis may have an important function in the regulation of AR activity. Knockdown of hGRβ by siRNA reduced androgen induced growth in LNCaP prostate cancer cells (45). However, Akt1 and PTEN were never investigated, and it is only now coming to light that GRβ has a consummate role in these pathways. Furthermore, bombesin treatment attenuated GC-induced apoptosis in PC-3 human prostate cancer cells by increasing hGRβ expression (46), albeit, through GRβ inhibition of PTEN. Importantly, GRβ may have a major function in the development of several cancers. The HT-29 colon cancer and MCF-7 breast carcinoma (47), as well as, Hut-78 T- and Raji B-lymphoma cell lines (48) have shown high expression of GRβ. Interestingly, treatment with growth inhibitors 5-aza-2′-deoxycytidine (5-dAzaC), sodium butyrate (NaBu), and trichostatin A (TSA) reduced GRβ and increased GRα expression in all of these cancer cell lines (47, 48). Unfortunately, sensitivity to GC-induced apoptosis or expression of PTEN was never tested in these studies. Likewise, hepatocarcinoma (HepG2) and osteosarcoma cells (SaOS-2) have elevated expression of GRβ, which was found to be mostly located within the nucleoli (49, 50).
In conclusion, the predominant aspects studied for GRβ have been on the inhibition of GRα. Our studies clearly show that GRβ has a preeminent role in insulin signaling and growth. These properties have not been previously known for GRβ, especially the epigenetic Akt1/PTEN growth signaling that is independent of GRα (Fig. 8). Given that Akt1 regulates embryonic and fetal growth (26), this work suggests that GRβ may have a paramount role in development and proliferation. Thus, the GRβ/Akt1 axis is emerging as a major signaling paradigm regulating growth, which may also lead to GC-resistance in cancer. Therapeutics inhibiting GRβ may increase sensitivity to GCs, as well as increase PTEN expression allowing for the regulation of growth.
FIGURE 8.

GRβ growth diagram. GRβ suppresses PTEN expression, which leads to activation of Akt1, resulting in enhanced growth.
This work was supported, in whole or in part by National Institutes of Health PRIDE Grant HL106365 (to T. D. H.) and the University of Toledo deArce-Memorial Endowment Fund (to J. W. H.).
- PTEN
- phosphatase and tensin homolog
- GC
- glucocorticoid
- GR
- glucocorticoid receptor
- PNA
- peptide nucleic acid
- BPS
- branch point sequence
- CPP
- cell-penetrating peptide.
REFERENCES
- 1. Gericke A., Munson M., Ross A. H. (2006) Regulation of the PTEN phosphatase. Gene 374, 1–9 [DOI] [PubMed] [Google Scholar]
- 2. Goswami A., Ranganathan P., Rangnekar V. M. (2006) The phosphoinositide 3-kinase/Akt1/Par-4 axis: a cancer-selective therapeutic target. Cancer Res. 66, 2889–2892 [DOI] [PubMed] [Google Scholar]
- 3. Hers I., Vincent E. E., Tavaré J. M. (2011) Akt signalling in health and disease. Cell. Signalling 23, 1515–1527 [DOI] [PubMed] [Google Scholar]
- 4. Wang Z., Garabedian M. J. (2003) Modulation of glucocorticoid receptor transcriptional activation, phosphorylation, and growth inhibition by p27Kip1. J. Biol. Chem. 278, 50897–50901 [DOI] [PubMed] [Google Scholar]
- 5. Zheng Y. C., Izumi K., Li Y., Ishiguro H., Miyamoto H. (2012) Contrary Regulation of Bladder Cancer Cell Proliferation and Invasion by Dexamethasone-Mediated Glucocorticoid Receptor Signals. Mol. Cancer Ther. 11, 2621–2632 [DOI] [PubMed] [Google Scholar]
- 6. Ni Z., Tang J., Cai Z., Yang W., Zhang L., Chen Q., Zhang L., Wang X. (2011) A new pathway of glucocorticoid action for asthma treatment through the regulation of PTEN expression. Respir. Res. 12, 47. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Rivers C., Levy A., Hancock J., Lightman S., Norman M. (1999) Insertion of an amino acid in the DNA-binding domain of the glucocorticoid receptor as a result of alternative splicing. J. Clin. Endocrinol. Metab. 84, 4283–4286 [DOI] [PubMed] [Google Scholar]
- 8. Ray D. W., Davis J. R., White A., Clark A. J. (1996) Glucocorticoid receptor structure and function in glucocorticoid-resistant small cell lung carcinoma cells. Cancer Res. 56, 3276–3280 [PubMed] [Google Scholar]
- 9. Sapolsky R. M., Romero L. M., Munck A. U. (2000) How do glucocorticoids influence stress responses? Integrating permissive, suppressive, stimulatory, and preparative actions. Endocrine Rev. 21, 55–89 [DOI] [PubMed] [Google Scholar]
- 10. Vegiopoulos A., Herzig S. (2007) Glucocorticoids, metabolism and metabolic diseases. Mol. Cell. Endocrinol. 275, 43–61 [DOI] [PubMed] [Google Scholar]
- 11. Hinds T. D., Jr., Ramakrishnan S., Cash H. A., Stechschulte L. A., Heinrich G., Najjar S. M., Sanchez E. R. (2010) Discovery of glucocorticoid receptor-β in mice with a role in metabolism. Mol. Endocrinol. 24, 1715–1727 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Rogatsky I., Trowbridge J. M., Garabedian M. J. (1997) Glucocorticoid receptor-mediated cell cycle arrest is achieved through distinct cell-specific transcriptional regulatory mechanisms. Mol. Cell. Biol. 17, 3181–3193 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Yemelyanov A., Czwornog J., Chebotaev D., Karseladze A., Kulevitch E., Yang X., Budunova I. (2007) Tumor suppressor activity of glucocorticoid receptor in the prostate. Oncogene 26, 1885–1896 [DOI] [PubMed] [Google Scholar]
- 14. Zhu X. Y., Liu Y. J., Lu J., Xu R. B. (2004) Knockdown of glucocorticoid receptor expression by RNA interference promotes cell proliferation in murine macrophage RAW264.7 cells. J. Steroid Biochem. Mol. Biol. 92, 375–382 [DOI] [PubMed] [Google Scholar]
- 15. Kino T., Chrousos G. P. (2001) Glucocorticoid and mineralocorticoid resistance/hypersensitivity syndromes. J. Endocrinol. 169, 437–445 [DOI] [PubMed] [Google Scholar]
- 16. Strickland I., Kisich K., Hauk P. J., Vottero A., Chrousos G. P., Klemm D. J., Leung D. Y. (2001) High constitutive glucocorticoid receptor β in human neutrophils enables them to reduce their spontaneous rate of cell death in response to corticosteroids. J. Exp. Med. 193, 585–593 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Webster J. C., Oakley R. H., Jewell C. M., Cidlowski J. A. (2001) Proinflammatory cytokines regulate human glucocorticoid receptor gene expression and lead to the accumulation of the dominant negative β isoform: a mechanism for the generation of glucocorticoid resistance. Proc. Natl. Acad. Sci. U. S. A. 98, 6865–6870 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Leung D. Y., Hamid Q., Vottero A., Szefler S. J., Surs W., Minshall E., Chrousos G. P., Klemm D. J. (1997) Association of glucocorticoid insensitivity with increased expression of glucocorticoid receptor β. J. Exp. Med. 186, 1567–1574 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Longui C. A., Vottero A., Adamson P. C., Cole D. E., Kino T., Monte O., Chrousos G. P. (2000) Low glucocorticoid receptor α/β ratio in T-cell lymphoblastic leukemia. Horm. Metab. Res. 32, 401–406 [DOI] [PubMed] [Google Scholar]
- 20. Piotrowski P., Burzynski M., Lianeri M., Mostowska M., Wudarski M., Chwalinska-Sadowska H., Jagodzinski P. P. (2007) Glucocorticoid receptor β splice variant expression in patients with high and low activity of systemic lupus erythematosus. Folia histochemica et cytobiologica/Polish Academy of Sciences, Polish Histochemical and Cytochemical Society 45, 339–342 [PubMed] [Google Scholar]
- 21. Kino T., Manoli I., Kelkar S., Wang Y., Su Y. A., Chrousos G. P. (2009) Glucocorticoid receptor (GR) β has intrinsic, GRα-independent transcriptional activity. Biochem. Biophys. Res. Commun. 381, 671–675 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Wang Y., Romigh T., He X., Tan M. H., Orloff M. S., Silverman R. H., Heston W. D., Eng C. (2011) Differential regulation of PTEN expression by androgen receptor in prostate and breast cancers. Oncogene 30, 4327–4338 [DOI] [PubMed] [Google Scholar]
- 23. Periyasamy S., Hinds T., Jr., Shemshedini L., Shou W., Sanchez E. R. (2010) FKBP51 and Cyp40 are positive regulators of androgen-dependent prostate cancer cell growth and the targets of FK506 and cyclosporin A. Oncogene 29, 1691–1701 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Oakley R. H., Webster J. C., Sar M., Parker C. R., Jr., Cidlowski J. A. (1997) Expression and subcellular distribution of the β-isoform of the human glucocorticoid receptor. Endocrinology 138, 5028–5038 [DOI] [PubMed] [Google Scholar]
- 25. Oakley R. H., Sar M., Cidlowski J. A. (1996) The human glucocorticoid receptor β isoform. Expression, biochemical properties, and putative function. J. Biol. Chem. 271, 9550–9559 [DOI] [PubMed] [Google Scholar]
- 26. Yang Z. Z., Tschopp O., Hemmings-Mieszczak M., Feng J., Brodbeck D., Perentes E., Hemmings B. A. (2003) Protein kinase B α/Akt1 regulates placental development and fetal growth. J. Biol. Chem. 278, 32124–32131 [DOI] [PubMed] [Google Scholar]
- 27. Garcia-Cao I., Song M. S., Hobbs R. M., Laurent G., Giorgi C., de Boer V. C., Anastasiou D., Ito K., Sasaki A. T., Rameh L., Carracedo A., Vander Heiden M. G., Cantley L. C., Pinton P., Haigis M. C., Pandolfi P. P. (2012) Systemic elevation of PTEN induces a tumor-suppressive metabolic state. Cell 149, 49–62 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Nuutinen U., Postila V., Mättö M., Eeva J., Ropponen A., Eray M., Riikonen P., Pelkonen J. (2006) Inhibition of PI3-kinase-Akt pathway enhances dexamethasone-induced apoptosis in a human follicular lymphoma cell line. Exp. Cell Res. 312, 322–330 [DOI] [PubMed] [Google Scholar]
- 29. Zhang C., Ryu Y. K., Chen T. Z., Hall C. P., Webster D. R., Kang M. H. (2012) Synergistic activity of rapamycin and dexamethasone in vitro and in vivo in acute lymphoblastic leukemia via cell-cycle arrest and apoptosis. Leukemia Res. 36, 342–349 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Vazquez-Tello A., Halwani R., Hamid Q., Al-Muhsen S. (2013) Glucocorticoid receptor-β up-regulation and steroid resistance induction by IL-17 and IL-23 cytokine stimulation in peripheral mononuclear cells. J. Clin. Immunol. 33, 466–478 [DOI] [PubMed] [Google Scholar]
- 31. DuBois D. C., Sukumaran S., Jusko W. J., Almon R. R. (2013) Evidence for a glucocorticoid receptor β splice variant in the rat and its physiological regulation in liver. Steroids 78, 312–320 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Skeen J. E., Bhaskar P. T., Chen C. C., Chen W. S., Peng X. D., Nogueira V., Hahn-Windgassen A., Kiyokawa H., Hay N. (2006) Akt deficiency impairs normal cell proliferation and suppresses oncogenesis in a p53-independent and mTORC1-dependent manner. Cancer Cell 10, 269–280 [DOI] [PubMed] [Google Scholar]
- 33. Cho H., Mu J., Kim J. K., Thorvaldsen J. L., Chu Q., Crenshaw E. B., 2nd, Kaestner K. H., Bartolomei M. S., Shulman G. I., Birnbaum M. J. (2001) Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKB β). Science 292, 1728–1731 [DOI] [PubMed] [Google Scholar]
- 34. Fischer-Posovszky P., Tews D., Horenburg S., Debatin K. M., Wabitsch M. (2012) Differential function of Akt1 and Akt2 in human adipocytes. Mol. Cell. Endocrinol. 358, 135–143 [DOI] [PubMed] [Google Scholar]
- 35. Easton R. M., Cho H., Roovers K., Shineman D. W., Mizrahi M., Forman M. S., Lee V. M., Szabolcs M., de Jong R., Oltersdorf T., Ludwig T., Efstratiadis A., Birnbaum M. J. (2005) Role for Akt3/protein kinase Bγ in attainment of normal brain size. Mol. Cell. Biol. 25, 1869–1878 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Hollander M. C., Maier C. R., Hobbs E. A., Ashmore A. R., Linnoila R. I., Dennis P. A. (2011) Akt1 deletion prevents lung tumorigenesis by mutant K-ras. Oncogene 30, 1812–1821 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Xia C., Meng Q., Cao Z., Shi X., Jiang B. H. (2006) Regulation of angiogenesis and tumor growth by p110 α and AKT1 via VEGF expression. J. Cell. Physiol. 209, 56–66 [DOI] [PubMed] [Google Scholar]
- 38. Luo C., Yi B., Bai L., Xia Y., Wang G., Qian G., Feng H. (2010) Suppression of Akt1 phosphorylation by adenoviral transfer of the PTEN gene inhibits hypoxia-induced proliferation of rat pulmonary arterial smooth muscle cells. Biochem. Biophys. Res. Commun. 397, 486–492 [DOI] [PubMed] [Google Scholar]
- 39. Piovan E., Yu J., Tosello V., Herranz D., Ambesi-Impiombato A., Da Silva A. C., Sanchez-Martin M., Perez-Garcia A., Rigo I., Castillo M., Indraccolo S., Cross J. R., de Stanchina E., Paietta E., Racevskis J., Rowe J. M., Tallman M. S., Basso G., Meijerink J. P., Cordon-Cardo C., Califano A., Ferrando A. A. (2013) Direct reversal of glucocorticoid resistance by AKT inhibition in acute lymphoblastic leukemia. Cancer Cell 24, 766–776 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Oakley R. H., Jewell C. M., Yudt M. R., Bofetiado D. M., Cidlowski J. A. (1999) The dominant negative activity of the human glucocorticoid receptor β isoform. Specificity and mechanisms of action. J. Biol. Chem. 274, 27857–27866 [DOI] [PubMed] [Google Scholar]
- 41. Kelly A., Bowen H., Jee Y. K., Mahfiche N., Soh C., Lee T., Hawrylowicz C., Lavender P. (2008) The glucocorticoid receptor β isoform can mediate transcriptional repression by recruiting histone deacetylases. J. Allergy Clin. Immunol. 121, 203–208.e1 [DOI] [PubMed] [Google Scholar]
- 42. Varricchio L., Masselli E., Alfani E., Battistini A., Migliaccio G., Vannucchi A. M., Zhang W., Rondelli D., Godbold J., Ghinassi B., Whitsett C., Hoffman R., Migliaccio A. R. (2011) The dominant negative β isoform of the glucocorticoid receptor is uniquely expressed in erythroid cells expanded from polycythemia vera patients. Blood 118, 425–436 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Trapp T., Rupprecht R., Castrén M., Reul J. M., Holsboer F. (1994) Heterodimerization between mineralocorticoid and glucocorticoid receptor: a new principle of glucocorticoid action in the CNS. Neuron 13, 1457–1462 [DOI] [PubMed] [Google Scholar]
- 44. Liu W., Wang J., Sauter N. K., Pearce D. (1995) Steroid receptor heterodimerization demonstrated in vitro and in vivo. Proc. Natl. Acad. Sci. U. S. A. 92, 12480–12484 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Ligr M., Li Y., Logan S. K., Taneja S., Melamed J., Lepor H., Garabedian M. J., Lee P. (2012) Mifepristone inhibits GRβ coupled prostate cancer cell proliferation. J. Urol. 188, 981–988 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Zhu J., Gong J. Y., Goodman O. B., Jr., Cartegni L., Nanus D. M., Shen R. (2007) Bombesin attenuates pre-mRNA splicing of glucocorticoid receptor by regulating the expression of serine-arginine protein p30c (SRp30c) in prostate cancer cells. Biochim. Biophys. Acta 1773, 1087–1094 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Piotrowska H., Jagodzinski P. P. (2009) Glucocorticoid receptor α and β variant expression is associated with ASF/SF2 splicing factor upregulation in HT-29 colon cancer and MCF-7 breast carcinoma cells. Arch. Med. Res. 40, 156–162 [DOI] [PubMed] [Google Scholar]
- 48. Piotrowska H., Jagodzinski P. P. (2007) Trichostatin A, sodium butyrate, and 5-aza-2′-deoxycytidine alter the expression of glucocorticoid receptor α and β isoforms in Hut-78 T- and Raji B-lymphoma cell lines. Biomed. Pharmacother. 61, 451–454 [DOI] [PubMed] [Google Scholar]
- 49. Psarra A. M., Solakidi S., Trougakos I. P., Margaritis L. H., Spyrou G., Sekeris C. E. (2005) Glucocorticoid receptor isoforms in human hepatocarcinoma HepG2 and SaOS-2 osteosarcoma cells: presence of glucocorticoid receptor α in mitochondria and of glucocorticoid receptor β in nucleoli. Int. J. Biochem. Cell Biol. 37, 2544–2558 [DOI] [PubMed] [Google Scholar]
- 50. Solakidi S., Psarra A. M., Sekeris C. E. (2007) Differential distribution of glucocorticoid and estrogen receptor isoforms: localization of GRβ and ERα in nucleoli and GRα and ERβ in the mitochondria of human osteosarcoma SaOS-2 and hepatocarcinoma HepG2 cell lines. JMNI 7, 240–245 [PubMed] [Google Scholar]







