Skip to main content
PLOS One logoLink to PLOS One
. 2014 Jun 23;9(6):e99649. doi: 10.1371/journal.pone.0099649

Hybrid Lentivirus-phiC31-int-NLS Vector Allows Site-Specific Recombination in Murine and Human Cells but Induces DNA Damage

Nicolas Grandchamp 1,2,3, Dorothée Altémir 1,2, Stéphanie Philippe 1,2,3, Suzanna Ursulet 1,2,3, Héloïse Pilet 1,2,3, Marie-Claude Serre 4, Aude Lenain 5, Che Serguera 6, Jacques Mallet 1, Chamsy Sarkis 1,2,*
Editor: Yuntao Wu7
PMCID: PMC4067480  PMID: 24956106

Abstract

Gene transfer allows transient or permanent genetic modifications of cells for experimental or therapeutic purposes. Gene delivery by HIV-derived lentiviral vector (LV) is highly effective but the risk of insertional mutagenesis is important and the random/uncontrollable integration of the DNA vector can deregulate the cell transcriptional activity. Non Integrative Lentiviral Vectors (NILVs) solve this issue in non-dividing cells, but they do not allow long term expression in dividing cells. In this context, obtaining stable expression while avoiding the problems inherent to unpredictable DNA vector integration requires the ability to control the integration site. One possibility is to use the integrase of phage phiC31 (phiC31-int) which catalyzes efficient site-specific recombination between the attP site in the phage genome and the chromosomal attB site of its Streptomyces host. Previous studies showed that phiC31-int is active in many eukaryotic cells, such as murine or human cells, and directs the integration of a DNA substrate into pseudo attP sites (pattP) which are homologous to the native attP site. In this study, we combined the efficiency of NILV for gene delivery and the specificity of phiC31-int for DNA substrate integration to engineer a hybrid tool for gene transfer with the aim of allowing long term expression in dividing and non-dividing cells preventing genotoxicity. We demonstrated the feasibility to target NILV integration in human and murine pattP sites with a dual NILV vectors system: one which delivers phiC31-int, the other which constitute the substrate containing an attB site in its DNA sequence. These promising results are however alleviated by the occurrence of significant DNA damages. Further improvements are thus required to prevent chromosomal rearrangements for a therapeutic use of the system. However, its use as a tool for experimental applications such as transgenesis is already applicable.

Background

Gene transfer technologies are essential for genetics studies and gene therapies. However, major challenges remain to be addressed. A major issue is the lack of control over the site of DNA integration in the host genome which leads to unpredictable gene expression level and potentially undesirable mutagenesis of important cellular genes [1]. Recent strategies to tackle this challenge are relying on the use of genome editing tools such as ZFNs [2]–[7], TALENs [8]–[13] or more recently CRISPR-Cas system [14]–[17]. However, the vectorization of these tools into viral vectors to optimize their use ex vivo or in vivo raises several problems. Indeed, ZFNs function as dimers and generally require cotransduction of three vectors (one for each dimer and one for the recombinating substrate) [18]–[20]. Moreover ZFNs may induce cellular toxicity due to off target activity [21]–[23]. TALENs have an important size with repeat domains hampering their vectorization [24]. CRISPR-Cas is a very recent tool and its vectorization has not yet been described. One may however expect its vectorization into viral vectors will be challenging as the system is based on the concomitant use of a chimeric DNA displaying hairpin structures [25] and of Caspase 9 which induces apoptosis when over-expressed [26]. These features will undoubtedly represent challenges for the vectorization of CRISPR-Cas into viral vectors for targeted integration.

Site-specific recombinases such as Cre [27]–[34] or FLP [35]–[38] of the tyrosine recombinases family are other genome editing tools more easily vectorizable and widely used for the purpose of site specific integration. However, the use of these recombinases is limited by the absence of endogenous recognition site in mammalian cells and by the bidirectionality of the recombination reaction they mediate. Within the superfamily of site-specific recombinases, phage integrases catalyse unidirectional recombination events [39]. Among these the PhiC31 phage integrase (phiC31-int), of the large serine recombinases family, is the most commonly used site-specific integrase for gene transfer purposes [40], [41]. In its natural context, phiC31-int mediates efficient recombination between the phage attachment site (attP) and the bacterial attachment site (attB). The recombination of these two sites results in the unidirectional and site-specific integration of the phage genome into the bacterial chromosome (reviewed in [39]) leading to an integrated phage genome flanked by the recombinant attL (left) and attR (right) sites (Figure 1). When used for gene transfer into eukaryotic cells, phiC31-int can catalyse integration of a plasmid containing an attB sequence into endogenous pseudo attP sites (pattP) displaying a high degree of homology with the wild type attP site [42]. Hence, associated with transfection techniques, phiC31-int has been successfully exploited to stably modify the genome into particular genomic sites of many types of eukaryotic cells in vitro [43]–[50] for transgenesis [48], [51]–[55] and gene therapy applications [56]–[65]. The use of phiC31-int presents several advantages. First, the recombinase can be used to generate conservative recombination between attB and pseudo attP sites [42]. Second, Chalberg et al demonstrated that the majority of phiC31-int mediated recombination events in the human genome occur in intergenic regions [66]. However, in most of these studies the vectorization of phiC31-int relied on cotransfection (or nucleofection) of plasmids for both the delivery of phiC31-int and of the transgene, thus limiting this technology to in vitro or ex vivo applications.

Figure 1. Scheme of phiC31-int mediated recombination in bacterial host.

Figure 1

PhiC31 integrase performs precise recombination between an attB site located in the Streptomyces genome and an attP site located on the phiC31 phage genome. The outcome is integration of the phage into the host genome.

A strategy to increase the efficiency of DNA delivery in vivo is to use viral-derived vectors. As the expression of the genome editing tool must be transitory to avoid genotoxicity, it could therefore be delivered by a transient viral vector [67]. Even though phiC31-int has already been delivered by an adenoviral vector system [68], [69] the use of such vectors is limited by their cell toxicity and immunogenicity [70]–[72]. In contrast, lentiviral vectors (LV) have the advantage to be non-immunogenic [73], [74] and offers the possibility to be pseudotyped by different envelops, allowing a high degree of flexibility regarding the tropism of the particles and the type of cell(s) they transduce (for review see Cronin J. et al [75]). Most importantly, it was shown that LV integrase can be modified to obtain non integrating lentiviral vectors (NILVs) [76]–[78], which act as episomal vectors. Hence, NILVs are vectors of choice to deliver genome editing tools and have been successfully used to deliver transposases [79], [80], FLP [81] or ZFNs [82], [83]. However, the use of NILVs has never been described for the vectorization of a serine recombinase.

In the present study, we combine the unidirectional site-specific recombination capability of phiC31-int with the efficiency of NILVs for gene transfer. For targeted integration,two different NILVs, one delivering the DNA sequence to be integrated and containing the natural attB site, the other expressing the phiC31-int are used. Through a step by step approach, we demonstrate for the first time that phiC31-int can be vectorized in NILV and we provide clues to further improve the system. However, analysis of integration events reveals that significant DNA damages can result from phiC31-int mediated recombination. In conclusion, the vectorization of serine recombinases in NILVs is feasible and constitutes a promising tool for basic research; however, one should remain cautious about the chromosomal aberrations that can be induced by these recombinases, particularly for clinical uses.

Results and Discussion

NILV genomes can be used as a substrate for site-specific integration mediated by phiC31-int into human genome

We first assessed the ability of a NILV DNA genome to be used as a substrate for phiC31-int. We therefore generated a Hela cell line constitutively expressing phiC31-int thanks to an integrative lentiviral vector expressing the phiC31-int under the control of the CMV promoter (LV CMV-phiC31-int) to. Hela cells were transduced and clonal populations were isolated and analyzed by RT-PCR to estimate the phiC31-int expression level (Figure 2A). The clone Hi16 was selected for its robust constitutive expression of phiC31-int.

Figure 2. Analysis of cell lines which constitutively expressed phiC31-int.

Figure 2

A) PhiC31 RT-PCR on three different cell lines. HFi and Hi16 are derived from Hela cell line and TC1 from NIH-3T3 cell line. Control condition lane lacks RNA. B) PCR which detects LTR junctions or intact attB sites after transduction with a NILV attB-CMV-Neo.

The ability of the constitutively expressed phiC31-int to mediate recombination between a NILV bearing an attB site with genomic pattP sites was then tested. Hi16 cells were transduced with a non-integrative lentiviral vector expressing the Neomycine (Neo) resistance gene under the control of the CMV promoter and containing an attB site (NILV attB-CMV-Neo). After two weeks of G418 selection we obtained four cell clones which genomes were analyzed. Theoretically Neo integration is expected to arise from 3 distinct mechanisms: (i) phiC31-int-specific integration, (ii) residual integration mediated by a residual activity of the mutant HIV integrase (review about this field [84]) or (iii) illegitimate integration due to recombination of the episomal DNA molecule with the cellular genome by host cell mechanisms (Figure 3A). If the analysis is realized with clonal populations, these three different mechanisms should be discriminated by performing 2 PCR assays, one amplifying the LTR and the other amplifying the attB site. A positive LTR PCR reveals the presence of a LTR-LTR junction, indicating that the integration has occurred through a LTR-independent mechanism, either involving attB site-specific recombination or illegitimate recombination. In contrast, a positive attB PCR reveals that the attB site is intact, indicating an attB-independent integration, either involving LTR dependent (residual) integration or illegitimate recombination. In summary, cells are analyzed without knowing whether their genome contains one or several integration of NILV. A positive result for LTR PCR only or for attB PCR only allows to identify the mechanism of integration without ambiguities (ie respectively phic31-int specific integration or residual integration). As the LTR PCR does not amplify the 1-LTR region generated when the linear genome circularized through homologous recombination of both LTR regions, recombination involving 1-LTR circles would always result in LTR− in the PCR test. In cells where a single integration of a 1-LTR circle event arose, attB+/LTR− or attB−/LTR− profiles may be detected, respectively when the recombination is independent or dependent on phiC31-int. In all our experiments, we never observed attB−/LTR− clones. On the contrary, if both PCR are positive integration could result either from illegitimate recombination or from double independent recombination events (ie: phiC31-int site specific recombination and HIV integrase mediated residual integration). We collected the four clones and checked integration pattern of NILV with PCR. The PCR analysis revealed that all clones were positive for both LTR and attB PCRs (Figure 2B). Thus this result does not allow to conclude about the nature of the integration events.

Figure 3. Analysis strategies to detect the specific integrations mediated by phiC31-int.

Figure 3

A) Illustration of the three mechanisms of the phiC31-int mediated integration of a NILV containing an attB sequence. According to the type of integration, the PCR results in three different profiles: - PCRs LTR+/attB− : integration type (1), specific integration. - PCRs LTR−/attB+: integration type (2), residual integration. - PCRs LTR+/attB+: integration type (3), illegitimate integration. P1/P1′ are the primers used for attB PCR and P2/P2′ are the primers used for LTR PCR. B) Schematic representations of the inverse PCR and the adapted inverse PCR strategies used to characterize phiC31-int integration sites.

To clear up this ambiguity, genomic DNA of isolated clones was further analyzed by inverse PCR (iPCR) to isolate potential specific integration events. attB based primers (P1/P1′) were used to amplify junctions of recombination. To avoid the PCR background generated by the non-recombined attB site, an enzymatic cocktail including an enzyme which cuts only once in the vector sequence, in 5′ to the attB site (Figure 3B) was used. In this way, we were able to isolate pseudo attR junctions with iPCR, (but not the pseudo attL junction). Using this adapted strategy, a lentiviral genome integrated by phiC31-int at the human locus Xq22.1 was detected (Figure 4). Interestingly this locus had already been described as a preferential pattP site in the human genome [66]. Moreover, the core sequence is exactly in the same position, suggesting that the recombination event occurred very precisely at this locus.

Figure 4. DNA sequence of att and pattP sites.

Figure 4

A) Wild type attP and attB sites. After recombination two hybrids sites are formed: attL and attR. B) Recombination between attB site and the human locus Xq22.1 This recombination generates a pattR which has been isolated by inverse PCR. Xq22.1 had been described previously as a human pattP by MP Calos et al., who isolated the same pattR.

Although NILV integration also occurred through other means than phiC31-int recombination, our results clearly demonstrate that a NILV is a suitable substrate for phiC31-int mediated recombination in human cells. We therefore investigated whether phiC31-int could function when vectorized in a NILV.

NILVs allow adequate expression of phiC31-int to mediate recombination into a reporter system containing an attP site artificially introduced in human cells

The ability of a NILV to express phiC31-int and mediate recombination between another NILV genome carrying an attB site and a wild-type attP site artificially introduced in a human cell genome was further tested. First, a clonal Hela cell line containing the wild-type attP site inserted in its genome (HDsred line) was generated using an integrative LV (CMV-attP-DsRED2). HDsred cells were then transduced with two NILVs, one allowing expression of phiC31-int (NILV CMV-phiC31-int), and the other expressing Neo and containing the attB site (NILV attB-CMV-Neo). After cotransduction cells were grown with G418 to select integration events. The genomic DNA extracted from Neo resistant clones was analyzed by PCR to detect attL recombination junction (Figure 5A). Results showed only background signal generated by non-recombined attP site (figure 5B). To prevent this amplification, the genomic DNA was digested by a restriction enzyme that cuts both attP and attR sites but not attL site (Figure 5A) prior to PCR amplification. PCR results obtained after the enzymatic treatment revealed an attL junction in the population transduced with the highest dose of phiC31-int vector (Figure 5C). These results have been further confirmed by nested PCR (Figure 5D) and PCR product sequencing. Taken together, these results demonstrate that a NILV can deliver a functional phiC31-int capable to integrate an episomal lentiviral substrate containing an attB site into an attP site artificially introduced into the human genome.

Figure 5. Detection of recombination mediated by phiC31-int between an attB site contained into a NILV and a genomic attP site.

Figure 5

A) Scheme of the DsRed2 PCR before and after the enzymatic restriction treatment. B) PCR DsRed2 results without restriction enzyme treatment. Lanes 1 to 3: cotransduction with CMV-Neo and CMV-PhiC31 increasing vector input of 50–150–300 ng of p24. Lanes 4 to 6: cotransduction with attB-CMV-Neo and CMV-PhiC31 increasing vector input of 50–150–300 ng of p24. Lane 7: attB-CMV-Neo. Lane 8: positive control generated by triple-transfection (CMV-phiC31-int, attB-CMV-Neo and CMV-attP-DsRed2). Lane 9: negative control without vector. Lane 10: negative control of PCR. C) PCR DsRed2 results after restriction enzyme treatment. Lanes are similar to figure B. D) Nested PCR from the product isolated from lane 6 to confirm the specificity of PCR DsRed2 amplification.

Although the used PCR strategy does not allow to estimate the targeting efficiency of the attP site with the double vector system, the need of a nuclease digestion before PCR to reveal specific integration events suggests that the efficiency of the two NILVs system is low. As this assay involved the two natural recombination sites of PhiC31-int, further reduced efficiency would be expected when targeting endogenous pattP sites. Consequently, we next focused on the improvement of the two NILVs system efficiency.

Modification of the phiC31-int sequence to improve the efficiency of the NILV phiC31-int to allow target integration in pseudosites attP

It was previously shown that C-terminal addition of a nuclear localization system (NLS) to phiC31-Int improves its efficiency in eukaryotic cells [85]. We therefore tested this improved integrase in NILV vectorization strategy. To compare the two versions of phiC31-int, Hela cells were cotransduced with the following NILVs vectors: CMV-Neo with or without attB site and CMV-phiC31-int with or without NLS. Cells were grown with G418 and the resistant clones were quantified. The results from experiments in which CMV-phiC31-int was cotransduced with either CMV-Neo or attB-CMV-Neo are presented in Figure 6A. The CMV-Neo and the attB-CMV-Neo conditions did not display significant differences, indicating that no significant PhiC31-int recombinase activity occurred. In contrast, when the cells are transduced with CMV-phiC31-int-NLS instead of CMV-phiC31-Int (Figure 6B) the presence of the NLS sequence induced significant differences between the CMV-Neo and the attB-CMV-Neo conditions. These results show that addition of a C-terminal NLS to phiC31-int significantly increased its recombination efficiency with pattP sites. Indeed the phiC31-int-NLS mediated integration was 2 to 2.5 fold above the background level produced by NILV residual integration (Figure 6B).

Figure 6. Effect of NLS sequence on phiC31-int activity in NILV context.

Figure 6

A) Cotransduction of NILVs CMV-PhiC31 and CMV-Neo or attB-CMV-Neo. Four p24 doses of PhiC31 vector were used (D1: 3 ng, D2: 5 ng, D3: 10 ng, D4: 33 ng). B) Cotransduction of NILVs CMV-PhiC31-NLS and CMV-Neo or attB-CMV-Neo. Four p24 doses of PhiC31 vector were used (D1: 3 ng, D2: 5 ng, D3: 10 ng, D4: 33 ng). No significant differences are observed between sample with or without attB sequence in the vector pTRIP-CMV-Neo. Satistics: two ways ANOVA with Bonferroni posttest (Prism 5).

The use of the phiC31-int-NLS vectorized in a NILV allows to significantly increase the efficiency of recombination. We therefore further tested this hybrid lentivirus phiC31-int-NLS vector to target genomic pattP site into murine and human cells.

The two NILVs system allows site specific recombination in murine and human cells but induced aberrant chromosomal rearrangements

To target pattP site in the murine and human genome with the two vectors system, Hela cells and NIH-3T3 cells were cotransduced with the NILV attB-CMV-Neo and the hybrid lentivirus phiC31-int-NLS vector. After two weeks of selection, Neo resistant cells were collected and several clonal populations were isolated to facilitate interpretation of PCR analyses. The clones were analyzed with the LTR and attB PCRs assay (Figure 3A) to determine the proportion of specific integration events compared to NILV residual integration and illegitimate recombination events. We categorized clones in the 3 following groups: LTR+/attB− clones (group I, ie phiC31-int-NLS integration), LTR−/attB+ clones (group II, ie residual integration) and LTR+/attB+ clones (group III, ie illegitimate integration or mixed integration profile). The results are presented in Table 1.

Table 1. Repartition in 3 groups of human and murine clones according to the attB and LTR PCR results.

Group I (LTR+) Specific integration Group II (attB+) Residual integration Group III (LTR+/attB+) Unknow integration
Mouse
Clone number 8 78 22
% 7,5% 72,2% 20,3%
Human
Clone number 13 15 0
% 46,4% 53,6% 0,0%

We obtained 108 clones for murine cells and 28 for human cells. 7.5% of murine clones are in group I and 20.3% in group III (Table 1A). Consequently the integration mediated by the hybrid lentivirus phiC31-int-NLS vector is comprised between 7.5% and 27.8%. As no human clone corresponded to group III, the proportion of the hybrid lentivirus phiC31-int-NLS vector specific integration corresponds to the proportion of group I, ie 46.4% (Table 1B).

To determine which integration sites were targeted and confirm the type of integration of clonal groups I and III, we performed an analysis by iPCR as previously described (Figure 3B). The sequencing of iPCR products demonstrates that all human and murine clones tested contain in their genome an integrated vector with a recombinant pattern at the attB site. Therefore, the two vectors system that we developed allows targeting pattP sites in the murine and human genomes (Table 2).

Table 2. Mapping and description of pattP sites isolated by iPCR on human and murine cell lines.

Deletions Genomic location If intronic If intergenic, flanking gene names
Chromosome Number of junction isolated The half of att site present into the vector Chromosome Pseudo site Context gene name 5′side gene Distance (kb) 3′side gene Distance (kb)
Mouse
Groupe I 1 2 p attR : 2 bp p attL : 42 bp ND 1E4 repeat sequence
2 2 p attR : No p attL : 13 bp ND 2H3-H4 repeat sequence
7 2 (only pattR exploitable) p attR : 4 bp ND 7F2108099955 Exonic MOR204-16
Groupe III 1 1 p attR : 8 bp ND 1H1159228123 Intergenic PAPP-A2 277 AI316802 49
5 1 p attR : 16 bp ND 5B129812070 Exonic 4632413E21Rik
5 1 p attR : 21 bp ND 5C3158057809 Intronic Pcdh7
6 1 p attR : No ND 6G1135251898 Intergenic Gsg1 7 1700023A18Rik 51
7 1 p attR : 4 bp ND 7A17104238 Intergenic AIE1 90 5730403M16Rik 10
9 1 p attR : 12 bp ND 9A13001529 Intronic AC131780.5-201
13 1 p attR : No ND 13D1102691720 Intergenic AA414921 984 F630107B15 1.5
17 1 p attR : No ND 17A3.323698186 Intergenic EG622645 305 4.1B 53
X 1 p attR : 10 bp ND XA7.375331158 Intronic Cf-8
Human
Groupe I 1 2 p attR : No p attL : 20 bp 13 bp 1q32.1205953621/634 Intergenic SLC26A9 15 RAB7 28
9 1 p attR : 9 bp p attL : ND ND 9p21.133615936 Intergenic bA255A11.3 43 TCRBV20S2 1.5
17 2 p attR : No p attL : 12 bp Inversion of 4,8 kb 17q11.226164583/59669 Intronic HSD24
17 1 p attR : No p attR : ND ND 17q21.3245406611 Intronic C17orf57
17 2 p attR : 10 bp p attL : 34 bp 795 pb 17q25.382068091/886 Intergenic DUS1L 2559 FASN 11080

Twelve murine integration sites were isolated, three from group I with the two junctions (pattL and pattR) and nine from group III with only the pattR junction (Table 2). For two of the three group I clones both flanking regions were sequenced but the isolated junctions were too short to allow identification of the integration locus. Surprisingly, these two clones of group I present abnormal pattL and pattR junctions where several bases were missing, probably due to a deletion mechanism. Similarly, the sequence analysis of group III clones shows that recombination between the attB site and pattP site is not as precise as expected. Indeed, 6 out of 9 clones have missing bases in the pattR junctions. However, because we isolated only one flanking region for clones of group III, we cannot conclude about deletion events, as the missing bases could result from a gap of the attB core region involved in recombination.

Five human integration sites were isolated, all from group I. Both junctions were isolated for three sites and only the pattR junction for two sites (Table 2). As for the murine integration site analysis, missing bases in the recombined pseudo-sites were detected, including in clones for which both L and R junction could be determined. This further confirms that missing bases indeed reveal a deletion mechanism, probably occurring during the phiC31-int mediated recombination between a natural attB site and a pattP site. Furthermore, the integration site of the three sites for which the two junctions were isolated could be localized exactly (Table 2). Interestingly, for these three sites chromosomal gaps were observed between the pattR site and the pattL site. The size gaps are 13 bp, 795 pb and 4.8 kbp. The two first gaps could result from a mechanism of deletion which could occur through NHEJ pathway. Nevertheless, these hypotheses cannot explain the gap of 4.8 kbp. Indeed, in this case, the two flanking regions isolated during iPCR are in the same chromosomal orientation, which is not the case when normal recombination occurs. We hypothesize that the observed aberrant recombination results from two successive recombination events involving two pattP sites located 4.8 kb from each other that led to an inversion of the 4.8 kbp sequence (figure 7). This mechanistic model was previously proposed to explain chromosomal rearrangements in mammalian cells resulting from aberrant recombinations mediated by phiC31-int [86].

Figure 7. Hypothetical model to explain the inversion of 4.8.

Figure 7

Step 1: Integration of a NILV mediated by phiC31-int into a pattP site. Step2: Recombination mediated by phiC31-int between the pattL generated during step 1 and another patt site located at 4 kb.

In conclusion the hybrid lentivirus-phiC31-int-NLS vector that we developed allows targeted integration in pattP sites in murine and human genomes but seem to induce frequent deletions of base pairs in the attB site present into the vector or into the endogenous pattP site. Moreover, it may induce chromosomal deletions and translocations.

Conclusions

Our work establishes the ability of the hybrid lentivirus-phiC31-int-NLS to integrate a NILV substrate into attP or pattP sites in murine and human cell lines. Although the number of integration sites isolated in this study does not allow to determine preferential genome recognition sites for integration mediated by phiC31-int vectorized in NILV, a human pattP site already described could be isolated [66]. Most importantly, we demonstrated that the use of hybrid lentiviral phiC31-int-NLS vector can induce DNA damages, probably due to the activity of the recombinase. Indeed, other reports already described similar results using non-viral transfection of PhiC31-int. Anja Ehrhardt et al have shown that 15% of transgenes integrated by phiC31-int were flanked by chromosomal DNA sequence from different chromosomes [86] and Ji Liu et al have shown that phiC31-int induces DNA damages and chromosomal rearrangements in primary and adult human fibroblasts [87], [88]. In addition, Ehrard et al. have shown that phiC31-int is competent to integrate linear DNA fragments. They did not characterize the mechanisms and the consequences of this type of event are unknown, but one may hypothesize that such event would induce chromosome break. Considering that the cycle of NILVs involves linear intermediates, it would be of particular interest to further investigate the ability of phiC31-int to integrate these linear forms and the consequences of such events. Taken together, these observations limit the use of the hybrid lentiviral phiC31-int-NLS vector for clinical applications, it remains useful in transgenesis contexts where non aberrant recombination events can be selected. Alternatively, the hybrid lentiviral system may be used to vectorize other recombinases or genome editing tools with higher safety features. Indeed other serine recombinases have been shown to function in human cells [89]–[91] and could be valuable candidates for vectorization in NILVs. Moreover, the modification of recombinases and other genome editing tools by directed evolution techniques [92], [93] could be used to render them hyper-specific and hyper-efficient in order to improve their safety features. For instance, directed evolution has proven efficient to modify the efficiency and/or specify of a variety of molecular tools, including Sleeping Beauty [94] Cre recombinase [95], FLP recombinase [96], ZFNs [97] or phiC31-int [98].

Methods

Plasmids

The encapsidation plasmid expressing a functional integrase (p8.91 INWT) has been described previously [77]. The encapsidation plasmid expressing a deficient integrase (p8.91 IND64V) was derived from the plasmid p8.91 INWT and the plasmid pCMVΔR(int-)8.2 previously described [74] and kindly provided by D.B. Kohn (UCLA, Los Angeles (CA), USA). This plasmid contains a point mutation in the coding region of the integrase catalytic domain, creating a D64V change in the amino acid sequence. The plasmid p8.91 IND64V was generated by replacing the BclI-AflII fragment of p8.91 INWT by the corresponding fragment (containing the substitution) from pCMVΔR(int-)8.2.

The envelope expression plasmid pMDG(VSV) was used to express the VSV-G from the human CMV immediate early promoter [74].

The vector plasmid pTrip-CMV-phic31-int-WPRE was derived from the plasmid pTrip-CMV-GFP-WPRE previously described [77] and the plasmid pCMV-phic31-int previously described [41] and kindly provided by M.P. Calos (Stanford University, Stanford (CA), USA). The plasmid pTrip-CMV-phic31-int-WPRE was generated by replacing the BamHI-SnabI fragment (CMV-GFP) of the pTrip-CMV-GFP-WPRE by the CMV-phic31-int fragment from the plasmid pCMV-phic31-int. The vector plasmid pTrip-CMV-phic31-int-NLS-WPRE was derived from the plasmid pTrip-CMV-phic31-int-WPRE and the plasmid pCMV-phic31-int. The C-terminal region of phic31-int was amplified with a primer containing the SV40 NLS sequence (5′-CCCGTTGGCAGGAAGCACTTCCGG-3′/5′- ATTCGCGGATCCGCTAAACCTTCCTCTTCTTCTTAGGCGCCGCTACGTCTTCCGTGCCGTCC-3′) from the plasmid pCMV-phic31-int. This PCR product was subcloned into the plasmid pCMV-phic31-int in place of the C-terminal region of phic31-int by using Eco47III and BamHI restriction enzymes to generate the plasmid pCMV-phic31-int-NLS. The plasmid pTrip-CMV-phic31-int-NLS-WPRE was finally generated by replacing the SpeI-BamHI fragment (GFP) of the pTrip-CMV-phic31-int-WPRE by the corresponding fragment (phic31-int-NLS) from pCMV-phic31-int-NLS. The vector plasmid pTrip-attB-CMV-Neo-WPRE was derived from the plasmid pTrip-CMV-Neo-WPRE previously described [77] and the plasmid pattB previously described [41] and kindly provided by MP Calos. The plasmid pTrip-attB-CMV-Neo-WPRE was generated by inserting the SalI fragment of the pattB plasmid (attB sequence) into the linearized plasmid pTrip-CMV-Neo-WPRE.

The plasmid pTrip-CMV-attP-DsRed2 was derived from the plasmid pTrip-CMV-DsRed2 kindly provided by P. Ravassard. Hybridization of 2 single strands DNA fragments (5′- CCCCAACTGGGGTAACCTTTGAGTTCTCTCAGTTGGGGG-3′/5′-CCCCCAACTGAGAGAACTCAAAGGTTACCCCAGTTGGGG-3′) generated a double stranded DNA fragment corresponding to the attP sequence flanked by BamHI cohesive ends. This fragment was inserted into the linearized plasmid pTrip-CMV-attP-DsRed2 to generate the plasmid pTrip-CMV-attP-DsRed2.

Lentiviral production

Lentiviral vectors were generated by the transient transfection of 293T cells by using the calcium phosphate precipitation method previously described [77]. Briefly, cells were cotransfected with the vector plasmid (pTrip-CMV-phic31-int-WPRE, pTrip-CMV-phic31-int-NLS-WPRE, pTrip-attB-CMV-Neo-WPRE or pTrip-CMV-attP-DSred2-WPRE), the transcomplementation plasmid (p8.91 INWT for integrative vectors or p8.91 IN64 for non-integrative vectors), and the plasmid encoding the vesicular stomatitis virus envelope glycoprotein (pMD-G). Supernatant was collected 48 hours after transfection, treated with DNaseI (Roche) and filtered (0.45 µm). Viral particles were then concentrated by ultracentrifugation (90 min, 22,000 rpm, rotor SW28) and resuspended in 0.1M PBS. The HIV p24 Gag antigen was quantified for each stock by ELISA (HIV-1 P24 antigen assay; Beckman Coulter, Fullerton, CA) according to manufacturer's instructions.

Cell culture

Human epithelial HeLa, Hi16, HeLa-DsRED2 and 293T cells and murine NIH 3T3 cells were grown in Dulbecco's modified medium (Invitrogen) supplemented with antibiotics (100 U/mL penicillin and 100 mg/mL streptomycin) and 10% heat inactivated fetal calf serum (Eurobio). The cells were plated and cultured in a humidified incubator at 37°C in a 5% CO2 and 90% air atmosphere.

Genomic DNA extraction

Genomic DNA extractions were performed with a lysis buffer composed of TrisHCl 10 mM (pH 7.5), EDTA 10 mM, SDS 0.6%, RNase A (Qiagen) 100 µg/mL and proteinase K (Eurobio) 100 µg/mL. The lysates were purified by phenol/chloroform and precipitated using sodium acetate and ethanol.

Generation of a reporter cell line HeLa-DsRED2

The HeLa-DsRED2 cell line containing an attP site and expressing DsRED2 fluorescent protein was generated using the lentiviral vector CMV-attP-DsRED2. HeLa cells were transduced with LV CMV-attP-DsRED2 (unconcentrated supernatant). Cells were grown for 3 days and seeded at clonal density in 96-well plates (0.3 cell per well) to generate single cell derived colonies. Clones were analyzed for DsRED2 expression by flow cytometry and PCR amplification of the vector genome.

Transduction

Cell suspensions were incubated for 3 hours with required vectors in medium supplemented with 1 µM DEAE-dextran. After 3 hours of incubation, cells were seed at desired density in fresh medium and grown for the purpose of the experiment.

Hi16 cells (2.106 cells/mL) were transduced with NILV-phic31-int (300 ng of p24) and NILV-Neo (100 ng of p24). Cells were seeded in 10 cm plates and grown in medium supplemented with 1 mg/mL of G418 for 12 days. Cells were then seeded in 96 well plates at low density (0.3 cell per well) to generate single cell derived colonies.

HeLa DsRED2 cells (2.106 cells/mL) were transduced with NILV CMV-phic31-int (50, 150, 300 ng of p24) and NILV CMV-Neo (100 ng of p24). Cells were seeded in 10 cm plates and grown in medium supplemented with 1 mg/mL of G418 (renewed every 3 days) for 12 days before extraction and analysis of genomic DNA.

Hela and NIH-3T3 cells (5.105 cells/mL) were transduced with NILV CMV-phic31-int (300 ng of p24) and NILV CMV-Neo (100 ng of p24). Cells were seeded in 10 cm plates and grown in medium supplemented with 1 mg/mL of G418 for 12 days. Cells were then seeded in 96 well plates at low density (0.3 cell per well) to generate single cell derived colonies.

Evaluation of Recombination Frequency

HeLa were directly transduced in suspension (8.104 cells/mL) with NILV CMV-phic31-int (3, 6, 18 and 36 ng of p24) and NILV CMV-Neo (12 ng of p24) during 3 hours in 150 µL of medium supplemented with 1 µM DEAE-dextran. Cells were then seeded in 6-wells plates with 2 mL of fresh medium. The day after, medium was removed and replaced with fresh medium supplemented with 1 mg/mL of G418. The medium was replaced every 3 days. Cells were grown 12 days, until clones developed and were then fixed with PFA 4% and stained with trypan blue. Clones on each well were counted. We transduced cells in three replicate tubes for each condition, and results are expressed as the mean of three measurements.

PCR reactions

RT-PCR

To analyze phic31-int expression by RT-PCR, total RNAs were extracted from HeLa cells using the RNeasy minikit (Qiagen), according to the manufacturer's instructions. Then, RNAs were reverse transcribed using the Superscript First Strand Synthesis kit (Invitrogen), according to the manufacturer's instructions. Phic31-int cDNA was amplified using the primers 5′-GCGAAGATTCTCGACACG-3′ and 5′-TCGCAGTACAGCTTGTCC-3′ at the concentration of 10 µM.

PCR on genomic DNA

PCR performed on genomic DNA used 500 ng of DNA, 1.5 mM of MgCl2 and 10 µM of each primer. The primers were as follows: amplification of attB region: 5′-CAATTTGCTGAGGGCTATTGAG-3′ and 5′- CTGTCCCTGTAATAAACCCG-3′; amplification of the LTRs region: 5′-CTCAATAAAGCTTGCCTTGAGTGC-3′ and 5′-TCAGATCTGGTCTAACCAGAGAGACC-3′; amplification of the DsRed2 region: 5′-AGGCCAGACAATTATTGTCTGG-3′ and 5′-ATGGTCTTCTTCTGCATCACG-3′; amplification of DsRED2 (nested primers) 5′- AAGAATCCTGGCTGTGGAAAG-3′ and 5′-AACTCGGTGATGACGTTCTCG-3′

Inverse PCR

Genomic DNA (10 µg) was primarily submitted to enzymatic restriction. The enzymatic cocktail used was: XbaI (100 U), StuI (100 U) BsrGI (30 U) and BstXI (30 U). After 16 hours incubation, the enzymes were heat inactived at 65°C for 30 minutes. Cohesive ends were filled in with Klenow (15 U) and dNTPs (2 mM) at 25°C for 20 minutes. Klenow was inactived with 1 mM EDTA. The products of digestion were purified by phenol/chloroform and precipitated using sodium acetate and ethanol. The ligation of the digestion products was performed by ligase (1.000 U, NEB) within ligation buffer supplemented with ATP (1 mM). The products of ligation were purified by phenol/chloroform and precipitated using sodium acetate and ethanol. PCR was performed with 100 ng of DNA with primers allowing the amplification of the attB region.

Adapted inverse PCR was performed using the same protocol with the addition of BmtI (30 U) in the enzymatic restriction cocktail.

The products of inverse PCR were visualized on 0.8% agarose gel with ethidium bromide staining. These products were extracted and purified using the Wizard SV Gel and PCR Clean-up System (Promega) according to the manufacturer's instructions, then cloned in a plasmid using pGEM-T Easy Vector System I according to the manufacturer's instructions. Next, inverse PCR products were sequenced using T7 and/or Sp6 primers.

Sequence analysis

All sequencing was performed by Eurofins genomics. Sequences were aligned with vector and genomic DNA, and recombination junctions were identified by sequence matching to attB. Human and murine blasts were performed using the NCBI and ensembl genome databases. The chromosomal localization of pseudosites attP has been performed using the Genebank GRCm38.p2 C57BL/6J assembly in mouse and the Primary Assembly GRCh38 for Human.

Acknowledgments

We thank Professor Michele P. Calos for providing us the pCMV-phiC31 (pCMVint). We also would like to thank Dr. Marie-José Lecomte for critical reading of the manuscript, Delphine Muller and Aurore Berthier for the technical support.

Funding Statement

This work was supported by grants from European FP6 (INTEGRA NEST-Adventure contract #29025), AFM (Association Française contre les Myopathies), and Rétina France. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Co-authors NG, DA, SP, SU and HP are employed by NewVectys SAS. NewVectys SAS provided support in the form of salaries for authors NG, DA, SP, SU and HP, but did not have any additional role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. The specific roles of these authors are articulated in the ‘author contributions’ section.

References

  • 1. Hacein-Bey-Abina S, Von Kalle C, Schmidt M, McCormack MP, Wulffraat N, et al. (2003) LMO2-associated clonal T cell proliferation in two patients after gene therapy for SCID-X1. Science 302: 415–419 10.1126/science.1088547 [DOI] [PubMed] [Google Scholar]
  • 2. Urnov FD, Miller JC, Lee Y-L, Beausejour CM, Rock JM, et al. (2005) Highly efficient endogenous human gene correction using designed zinc-finger nucleases. Nature 435: 646–651 10.1038/nature03556 [DOI] [PubMed] [Google Scholar]
  • 3. Geurts AM, Cost GJ, Freyvert Y, Zeitler B, Miller JC, et al. (2009) Knockout rats via embryo microinjection of zinc-finger nucleases. Science 325: 433 10.1126/science.1172447 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Morton J, Davis MW, Jorgensen EM, Carroll D (2006) Induction and repair of zinc-finger nuclease-targeted double-strand breaks in Caenorhabditis elegans somatic cells. Proc Natl Acad Sci U S A 103: 16370–16375 10.1073/pnas.0605633103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Bozas A, Beumer KJ, Trautman JK, Carroll D (2009) Genetic analysis of zinc-finger nuclease-induced gene targeting in Drosophila. Genetics 182: 641–651 10.1534/genetics.109.101329 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Hockemeyer D, Soldner F, Beard C, Gao Q, Mitalipova M, et al. (2009) Efficient targeting of expressed and silent genes in human ESCs and iPSCs using zinc-finger nucleases. Nat Biotechnol 27: 851–857 10.1038/nbt.1562 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Gaj T, Guo J, Kato Y, Sirk SJ, Barbas CF 3rd (2012) Targeted gene knockout by direct delivery of zinc-finger nuclease proteins. Nat Methods 9: 805–807 10.1038/nmeth.2030 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Boch J, Scholze H, Schornack S, Landgraf A, Hahn S, et al. (2009) Breaking the code of DNA binding specificity of TAL-type III effectors. Science 326: 1509–1512 10.1126/science.1178811 [DOI] [PubMed] [Google Scholar]
  • 9. Moscou MJ, Bogdanove AJ (2009) A simple cipher governs DNA recognition by TAL effectors. Science 326: 1501 10.1126/science.1178817 [DOI] [PubMed] [Google Scholar]
  • 10. Tesson L, Usal C, Ménoret S, Leung E, Niles BJ, et al. (2011) Knockout rats generated by embryo microinjection of TALENs. Nat Biotechnol 29: 695–696 10.1038/nbt.1940 [DOI] [PubMed] [Google Scholar]
  • 11. Carlson DF, Tan W, Lillico SG, Stverakova D, Proudfoot C, et al. (2012) Efficient TALEN-mediated gene knockout in livestock. Proc Natl Acad Sci U S A 109: 17382–17387 10.1073/pnas.1211446109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Sander JD, Cade L, Khayter C, Reyon D, Peterson RT, et al. (2011) Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nat Biotechnol 29: 697–698 10.1038/nbt.1934 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Hockemeyer D, Wang H, Kiani S, Lai CS, Gao Q, et al. (2011) Genetic engineering of human pluripotent cells using TALE nucleases. Nat Biotechnol 29: 731–734 10.1038/nbt.1927 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Cho SW, Kim S, Kim JM, Kim J-S (2013) Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. Nat Biotechnol 31: 230–232 10.1038/nbt.2507 [DOI] [PubMed] [Google Scholar]
  • 15. Mali P, Yang L, Esvelt KM, Aach J, Guell M, et al. (2013) RNA-guided human genome engineering via Cas9. Science 339: 823–826 10.1126/science.1232033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Friedland AE, Tzur YB, Esvelt KM, Colaiácovo MP, Church GM, et al. (2013) Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Nat Methods 10.1038/nmeth.2532 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Hwang WY, Fu Y, Reyon D, Maeder ML, Tsai SQ, et al. (2013) Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol 31: 227–229 10.1038/nbt.2501 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Bitinaite J, Wah DA, Aggarwal AK, Schildkraut I (1998) FokI dimerization is required for DNA cleavage. Proc Natl Acad Sci U S A 95: 10570–10575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Wah DA, Bitinaite J, Schildkraut I, Aggarwal AK (1998) Structure of FokI has implications for DNA cleavage. Proc Natl Acad Sci U S A 95: 10564–10569. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Smith J, Bibikova M, Whitby FG, Reddy AR, Chandrasegaran S, et al. (2000) Requirements for double-strand cleavage by chimeric restriction enzymes with zinc finger DNA-recognition domains. Nucleic Acids Res 28: 3361–3369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Pruett-Miller SM, Reading DW, Porter SN, Porteus MH (2009) Attenuation of zinc finger nuclease toxicity by small-molecule regulation of protein levels. PLoS Genet 5: e1000376 10.1371/journal.pgen.1000376 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Cornu TI, Cathomen T (2010) Quantification of zinc finger nuclease-associated toxicity. Methods Mol Biol Clifton NJ 649: 237–245 10.1007/978-1-60761-753-214 [DOI] [PubMed] [Google Scholar]
  • 23. Ramalingam S, Kandavelou K, Rajenderan R, Chandrasegaran S (2011) Creating designed zinc-finger nucleases with minimal cytotoxicity. J Mol Biol 405: 630–641 10.1016/j.jmb.2010.10.043 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Holkers M, Maggio I, Liu J, Janssen JM, Miselli F, et al. (2013) Differential integrity of TALE nuclease genes following adenoviral and lentiviral vector gene transfer into human cells. Nucleic Acids Res 41: e63 10.1093/nar/gks1446 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Jore MM, Lundgren M, van Duijn E, Bultema JB, Westra ER, et al. (2011) Structural basis for CRISPR RNA-guided DNA recognition by Cascade. Nat Struct Mol Biol 18: 529–536 10.1038/nsmb.2019 [DOI] [PubMed] [Google Scholar]
  • 26. Druskovic M, Suput D, Milisav I (2006) Overexpression of caspase-9 triggers its activation and apoptosis in vitro. Croat Med J 47: 832–840. [PMC free article] [PubMed] [Google Scholar]
  • 27. Orban PC, Chui D, Marth JD (1992) Tissue- and site-specific DNA recombination in transgenic mice. Proc Natl Acad Sci U S A 89: 6861–6865. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Smith AJ, De Sousa MA, Kwabi-Addo B, Heppell-Parton A, Impey H, et al. (1995) A site-directed chromosomal translocation induced in embryonic stem cells by Cre-loxP recombination. Nat Genet 9: 376–385 10.1038/ng0495-376 [DOI] [PubMed] [Google Scholar]
  • 29. Tsien JZ, Chen DF, Gerber D, Tom C, Mercer EH, et al. (1996) Subregion- and cell type-restricted gene knockout in mouse brain. Cell 87: 1317–1326. [DOI] [PubMed] [Google Scholar]
  • 30. Rohlmann A, Gotthardt M, Willnow TE, Hammer RE, Herz J (1996) Sustained somatic gene inactivation by viral transfer of Cre recombinase. Nat Biotechnol 14: 1562–1565 10.1038/nbt1196-1562 [DOI] [PubMed] [Google Scholar]
  • 31. Pfeifer A, Brandon EP, Kootstra N, Gage FH, Verma IM (2001) Delivery of the Cre recombinase by a self-deleting lentiviral vector: efficient gene targeting in vivo. Proc Natl Acad Sci U S A 98: 11450–11455 10.1073/pnas.201415498 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Marumoto T, Tashiro A, Friedmann-Morvinski D, Scadeng M, Soda Y, et al. (2009) Development of a novel mouse glioma model using lentiviral vectors. Nat Med 15: 110–116 10.1038/nm.1863 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. DuPage M, Dooley AL, Jacks T (2009) Conditional mouse lung cancer models using adenoviral or lentiviral delivery of Cre recombinase. Nat Protoc 4: 1064–1072 10.1038/nprot.2009.95 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Anton M, Graham FL (1995) Site-specific recombination mediated by an adenovirus vector expressing the Cre recombinase protein: a molecular switch for control of gene expression. J Virol 69: 4600–4606. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. O'Gorman S, Fox DT, Wahl GM (1991) Recombinase-mediated gene activation and site-specific integration in mammalian cells. Science 251: 1351–1355. [DOI] [PubMed] [Google Scholar]
  • 36. Moldt B, Staunstrup NH, Jakobsen M, Yáñez-Muñoz RJ, Mikkelsen JG (2008) Genomic insertion of lentiviral DNA circles directed by the yeast Flp recombinase. BMC Biotechnol 8: 60 10.1186/1472-6750-8-60 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Nakano M, Odaka K, Ishimura M, Kondo S, Tachikawa N, et al. (2001) Efficient gene activation in cultured mammalian cells mediated by FLP recombinase-expressing recombinant adenovirus. Nucleic Acids Res 29: E40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Kondo S, Takata Y, Nakano M, Saito I, Kanegae Y (2009) Activities of various FLP recombinases expressed by adenovirus vectors in mammalian cells. J Mol Biol 390: 221–230 10.1016/j.jmb.2009.04.057 [DOI] [PubMed] [Google Scholar]
  • 39. Smith MCM, Brown WRA, McEwan AR, Rowley PA (2010) Site-specific recombination by phiC31 integrase and other large serine recombinases. Biochem Soc Trans 38: 388–394 10.1042/BST0380388 [DOI] [PubMed] [Google Scholar]
  • 40. Thorpe HM, Smith MC (1998) In vitro site-specific integration of bacteriophage DNA catalyzed by a recombinase of the resolvase/invertase family. Proc Natl Acad Sci U S A 95: 5505–5510. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Groth AC, Olivares EC, Thyagarajan B, Calos MP (2000) A phage integrase directs efficient site-specific integration in human cells. Proc Natl Acad Sci U S A 97: 5995–6000 10.1073/pnas.090527097 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Thyagarajan B, Olivares EC, Hollis RP, Ginsburg DS, Calos MP (2001) Site-specific genomic integration in mammalian cells mediated by phage phiC31 integrase. Mol Cell Biol 21: 3926–3934 10.1128/MCB.21.12.3926-3934.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Belteki G, Gertsenstein M, Ow DW, Nagy A (2003) Site-specific cassette exchange and germline transmission with mouse ES cells expressing phiC31 integrase. Nat Biotechnol 21: 321–324 10.1038/nbt787 [DOI] [PubMed] [Google Scholar]
  • 44. Nakayama G, Kawaguchi Y, Koga K, Kusakabe T (2006) Site-specific gene integration in cultured silkworm cells mediated by phiC31 integrase. Mol Genet Genomics MGG 275: 1–8 10.1007/s00438-005-0026-3 [DOI] [PubMed] [Google Scholar]
  • 45. Ishikawa Y, Tanaka N, Murakami K, Uchiyama T, Kumaki S, et al. (2006) Phage phiC31 integrase-mediated genomic integration of the common cytokine receptor gamma chain in human T-cell lines. J Gene Med 8: 646–653 10.1002/jgm.891 [DOI] [PubMed] [Google Scholar]
  • 46. Ma Q, Sheng H, Yan J, Cheng S, Huang Y, et al. (2006) Identification of pseudo attP sites for phage phiC31 integrase in bovine genome. Biochem Biophys Res Commun 345: 984–988 10.1016/j.bbrc.2006.04.145 [DOI] [PubMed] [Google Scholar]
  • 47. Thyagarajan B, Liu Y, Shin S, Lakshmipathy U, Scheyhing K, et al. (2008) Creation of engineered human embryonic stem cell lines using phiC31 integrase. Stem Cells Dayt Ohio 26: 119–126 10.1634/stemcells.2007-0283 [DOI] [PubMed] [Google Scholar]
  • 48. Lister JA (2011) Use of phage φC31 integrase as a tool for zebrafish genome manipulation. Methods Cell Biol 104: 195–208 10.1016/B978-0-12-374814-0.00011-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Groth AC, Fish M, Nusse R, Calos MP (2004) Construction of transgenic Drosophila by using the site-specific integrase from phage phiC31. Genetics 166: 1775–1782. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Allen BG, Weeks DL (2005) Transgenic Xenopus laevis embryos can be generated using phiC31 integrase. Nat Methods 2: 975–979 10.1038/nmeth814 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Allen BG, Weeks DL (2006) Using phiC31 integrase to make transgenic Xenopus laevis embryos. Nat Protoc 1: 1248–1257 10.1038/nprot.2006.183 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Meredith JM, Underhill A, McArthur CC, Eggleston P (2013) Next-generation site-directed transgenesis in the malaria vector mosquito Anopheles gambiae: self-docking strains expressing germline-specific phiC31 integrase. PloS One 8: e59264 10.1371/journal.pone.0059264 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Fish MP, Groth AC, Calos MP, Nusse R (2007) Creating transgenic Drosophila by microinjecting the site-specific phiC31 integrase mRNA and a transgene-containing donor plasmid. Nat Protoc 2: 2325–2331 10.1038/nprot.2007.328 [DOI] [PubMed] [Google Scholar]
  • 54. Bischof J, Maeda RK, Hediger M, Karch F, Basler K (2007) An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc Natl Acad Sci U S A 104: 3312–3317 10.1073/pnas.0611511104 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Hollis RP, Stoll SM, Sclimenti CR, Lin J, Chen-Tsai Y, et al. (2003) Phage integrases for the construction and manipulation of transgenic mammals. Reprod Biol Endocrinol RBE 1: 79 10.1186/1477-7827-1-79 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Bertoni C, Jarrahian S, Wheeler TM, Li Y, Olivares EC, et al. (2006) Enhancement of plasmid-mediated gene therapy for muscular dystrophy by directed plasmid integration. Proc Natl Acad Sci U S A 103: 419–424 10.1073/pnas.0504505102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Ortiz-Urda S, Thyagarajan B, Keene DR, Lin Q, Calos MP, et al. (2003) PhiC31 integrase-mediated nonviral genetic correction of junctional epidermolysis bullosa. Hum Gene Ther 14: 923–928 10.1089/104303403765701204 [DOI] [PubMed] [Google Scholar]
  • 58. Olivares EC, Hollis RP, Chalberg TW, Meuse L, Kay MA, et al. (2002) Site-specific genomic integration produces therapeutic Factor IX levels in mice. Nat Biotechnol 20: 1124–1128 10.1038/nbt753 [DOI] [PubMed] [Google Scholar]
  • 59. Bauer JW, Laimer M (2004) Gene therapy of epidermolysis bullosa. Expert Opin Biol Ther 4: 1435–1443 10.1517/14712598.4.9.1435 [DOI] [PubMed] [Google Scholar]
  • 60. Held PK, Olivares EC, Aguilar CP, Finegold M, Calos MP, et al. (2005) In vivo correction of murine hereditary tyrosinemia type I by phiC31 integrase-mediated gene delivery. Mol Ther J Am Soc Gene Ther 11: 399–408 10.1016/j.ymthe.2004.11.001 [DOI] [PubMed] [Google Scholar]
  • 61. Chalberg TW, Genise HL, Vollrath D, Calos MP (2005) phiC31 integrase confers genomic integration and long-term transgene expression in rat retina. Invest Ophthalmol Vis Sci 46: 2140–2146 10.1167/iovs.04-1252 [DOI] [PubMed] [Google Scholar]
  • 62. Chavez CL, Keravala A, Chu JN, Farruggio AP, Cuéllar VE, et al. (2012) Long-term expression of human coagulation factor VIII in a tolerant mouse model using the φC31 integrase system. Hum Gene Ther 23: 390–398 10.1089/hum.2011.110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. Keravala A, Portlock JL, Nash JA, Vitrant DG, Robbins PD, et al. (2006) PhiC31 integrase mediates integration in cultured synovial cells and enhances gene expression in rabbit joints. J Gene Med 8: 1008–1017 10.1002/jgm.928 [DOI] [PubMed] [Google Scholar]
  • 64. Portlock JL, Keravala A, Bertoni C, Lee S, Rando TA, et al. (2006) Long-term increase in mVEGF164 in mouse hindlimb muscle mediated by phage phiC31 integrase after nonviral DNA delivery. Hum Gene Ther 17: 871–876 10.1089/hum.2006.17.871 [DOI] [PubMed] [Google Scholar]
  • 65. Keravala A, Chavez CL, Hu G, Woodard LE, Monahan PE, et al. (2011) Long-term phenotypic correction in factor IX knockout mice by using ΦC31 integrase-mediated gene therapy. Gene Ther 18: 842–848 10.1038/gt.2011.31 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66. Chalberg TW, Portlock JL, Olivares EC, Thyagarajan B, Kirby PJ, et al. (2006) Integration specificity of phage phiC31 integrase in the human genome. J Mol Biol 357: 28–48 10.1016/j.jmb.2005.11.098 [DOI] [PubMed] [Google Scholar]
  • 67. Wilson JH (2003) Pointing fingers at the limiting step in gene targeting. Nat Biotechnol 21: 759–760 10.1038/nbt0703-759 [DOI] [PubMed] [Google Scholar]
  • 68. Ehrhardt A, Yant SR, Giering JC, Xu H, Engler JA, et al. (2007) Somatic integration from an adenoviral hybrid vector into a hot spot in mouse liver results in persistent transgene expression levels in vivo. Mol Ther J Am Soc Gene Ther 15: 146–156 10.1038/sj.mt.6300011 [DOI] [PubMed] [Google Scholar]
  • 69. Robert M-A, Zeng Y, Raymond B, Desfossé L, Mairey E, et al. (2012) Efficacy and site-specificity of adenoviral vector integration mediated by the phage φC31 integrase. Hum Gene Ther Methods 23: 393–407 10.1089/hgtb.2012.122 [DOI] [PubMed] [Google Scholar]
  • 70. Raper SE, Chirmule N, Lee FS, Wivel NA, Bagg A, et al. (2003) Fatal systemic inflammatory response syndrome in a ornithine transcarbamylase deficient patient following adenoviral gene transfer. Mol Genet Metab 80: 148–158. [DOI] [PubMed] [Google Scholar]
  • 71. Schnell MA, Zhang Y, Tazelaar J, Gao GP, Yu QC, et al. (2001) Activation of innate immunity in nonhuman primates following intraportal administration of adenoviral vectors. Mol Ther J Am Soc Gene Ther 3: 708–722 10.1006/mthe.2001.0330 [DOI] [PubMed] [Google Scholar]
  • 72. Byrnes AP, Rusby JE, Wood MJ, Charlton HM (1995) Adenovirus gene transfer causes inflammation in the brain. Neuroscience 66: 1015–1024. [DOI] [PubMed] [Google Scholar]
  • 73. Kafri T, Blömer U, Peterson DA, Gage FH, Verma IM (1997) Sustained expression of genes delivered directly into liver and muscle by lentiviral vectors. Nat Genet 17: 314–317 10.1038/ng1197-314 [DOI] [PubMed] [Google Scholar]
  • 74. Naldini L, Blömer U, Gallay P, Ory D, Mulligan R, et al. (1996) In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272: 263–267. [DOI] [PubMed] [Google Scholar]
  • 75. Cronin J, Zhang X-Y, Reiser J (2005) Altering the tropism of lentiviral vectors through pseudotyping. Curr Gene Ther 5: 387–398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76. Yáñez-Muñoz RJ, Balaggan KS, MacNeil A, Howe SJ, Schmidt M, et al. (2006) Effective gene therapy with nonintegrating lentiviral vectors. Nat Med 12: 348–353 10.1038/nm1365 [DOI] [PubMed] [Google Scholar]
  • 77. Philippe S, Sarkis C, Barkats M, Mammeri H, Ladroue C, et al. (2006) Lentiviral vectors with a defective integrase allow efficient and sustained transgene expression in vitro and in vivo. Proc Natl Acad Sci U S A 103: 17684–17689 10.1073/pnas.0606197103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78. Grandchamp N, Henriot D, Philippe S, Amar L, Ursulet S, et al. (2011) Influence of insulators on transgene expression from integrating and non-integrating lentiviral vectors. Genet Vaccines Ther 9: 1 10.1186/1479-0556-9-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79. Vink CA, Gaspar HB, Gabriel R, Schmidt M, McIvor RS, et al. (2009) Sleeping beauty transposition from nonintegrating lentivirus. Mol Ther J Am Soc Gene Ther 17: 1197–1204 10.1038/mt.2009.94 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80. Staunstrup NH, Moldt B, Mátés L, Villesen P, Jakobsen M, et al. (2009) Hybrid lentivirus-transposon vectors with a random integration profile in human cells. Mol Ther J Am Soc Gene Ther 17: 1205–1214 10.1038/mt.2009.10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81. Moldt B, Staunstrup NH, Jakobsen M, Yáñez-Muñoz RJ, Mikkelsen JG (2008) Genomic insertion of lentiviral DNA circles directed by the yeast Flp recombinase. BMC Biotechnol 8: 60 10.1186/1472-6750-8-60 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82. Cornu TI, Cathomen T (2007) Targeted genome modifications using integrase-deficient lentiviral vectors. Mol Ther J Am Soc Gene Ther 15: 2107–2113 10.1038/sj.mt.6300345 [DOI] [PubMed] [Google Scholar]
  • 83. Lombardo A, Genovese P, Beausejour CM, Colleoni S, Lee Y-L, et al. (2007) Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery. Nat Biotechnol 25: 1298–1306 10.1038/nbt1353 [DOI] [PubMed] [Google Scholar]
  • 84. Sarkis C, Philippe S, Mallet J, Serguera C (2008) Non-integrating lentiviral vectors. Curr Gene Ther 8: 430–437. [DOI] [PubMed] [Google Scholar]
  • 85. Andreas S, Schwenk F, Küter-Luks B, Faust N, Kühn R (2002) Enhanced efficiency through nuclear localization signal fusion on phage PhiC31-integrase: activity comparison with Cre and FLPe recombinase in mammalian cells. Nucleic Acids Res 30: 2299–2306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86. Ehrhardt A, Engler JA, Xu H, Cherry AM, Kay MA (2006) Molecular analysis of chromosomal rearrangements in mammalian cells after phiC31-mediated integration. Hum Gene Ther 17: 1077–1094 10.1089/hum.2006.17.1077 [DOI] [PubMed] [Google Scholar]
  • 87. Liu J, Skjørringe T, Gjetting T, Jensen TG (2009) PhiC31 integrase induces a DNA damage response and chromosomal rearrangements in human adult fibroblasts. BMC Biotechnol 9: 31 10.1186/1472-6750-9-31 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88. Liu J, Jeppesen I, Nielsen K, Jensen TG (2006) Phi c31 integrase induces chromosomal aberrations in primary human fibroblasts. Gene Ther 13: 1188–1190 10.1038/sj.gt.3302789 [DOI] [PubMed] [Google Scholar]
  • 89. Gregory MA, Till R, Smith MCM (2003) Integration site for Streptomyces phage phiBT1 and development of site-specific integrating vectors. J Bacteriol 185: 5320–5323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90. Kolot M, Meroz A, Yagil E (2003) Site-specific recombination in human cells catalyzed by the wild-type integrase protein of coliphage HK022. Biotechnol Bioeng 84: 56–60 10.1002/bit.10747 [DOI] [PubMed] [Google Scholar]
  • 91. Olivares EC, Hollis RP, Calos MP (2001) Phage R4 integrase mediates site-specific integration in human cells. Gene 278: 167–176. [DOI] [PubMed] [Google Scholar]
  • 92. Miller OJ, Bernath K, Agresti JJ, Amitai G, Kelly BT, et al. (2006) Directed evolution by in vitro compartmentalization. Nat Methods 3: 561–570 10.1038/nmeth897 [DOI] [PubMed] [Google Scholar]
  • 93. Tay Y, Ho C, Droge P, Ghadessy FJ (2010) Selection of bacteriophage lambda integrases with altered recombination specificity by in vitro compartmentalization. Nucleic Acids Res 38: e25 10.1093/nar/gkp1089 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 94. Zayed H, Izsvák Z, Walisko O, Ivics Z (2004) Development of hyperactive sleeping beauty transposon vectors by mutational analysis. Mol Ther J Am Soc Gene Ther 9: 292–304 10.1016/j.ymthe.2003.11.024 [DOI] [PubMed] [Google Scholar]
  • 95. Santoro SW, Schultz PG (2002) Directed evolution of the site specificity of Cre recombinase. Proc Natl Acad Sci U S A 99: 4185–4190 10.1073/pnas.022039799 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 96. Bolusani S, Ma C-H, Paek A, Konieczka JH, Jayaram M, et al. (2006) Evolution of variants of yeast site-specific recombinase Flp that utilize native genomic sequences as recombination target sites. Nucleic Acids Res 34: 5259–5269 10.1093/nar/gkl548 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 97. Guo J, Gaj T, Barbas III CF (2010) Directed Evolution of an Enhanced and Highly Efficient FokI Cleavage Domain for Zinc Finger Nucleases. J Mol Biol 400: 96–107 10.1016/j.jmb.2010.04.060 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98. Sclimenti CR, Thyagarajan B, Calos MP (2001) Directed evolution of a recombinase for improved genomic integration at a native human sequence. Nucleic Acids Res 29: 5044–5051. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES