Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2014 Jul;58(7):4131–4137. doi: 10.1128/AAC.02811-13

Immunomodulatory Effect of Linezolid on Methicillin-Resistant Staphylococcus aureus Supernatant-Induced MUC5AC Overexpression in Human Airway Epithelial Cells

Norihito Kaku a,b, Katsunori Yanagihara a,b,, Yoshitomo Morinaga a,b, Koichi Yamada a,b, Yosuke Harada a, Yohei Migiyama a, Kentaro Nagaoka a, Shigeki Nakamura b, Koichi Izumikawa b, Shigeru Kohno b
PMCID: PMC4068536  PMID: 24820080

Abstract

Linezolid is the first member of the oxazolidinones and is active against drug-resistant Gram-positive pathogens, such as methicillin-resistant Staphylococcus aureus (MRSA). Additionally, linezolid shows an immunomodulatory effect, such as inhibition of inflammatory cytokine production. In this study, we examined the effect of linezolid on MRSA-induced MUC5AC overexpression in airway epithelial cells. In this study, an MRSA supernatant was used to avoid the direct effect of linezolid on MRSA. MUC5AC protein production was significantly increased with a 40-fold dilution of MRSA supernatant. At the mRNA level, MUC5AC gene expression was significantly increased 6 and 9 h after stimulation. In an inhibition study, linezolid significantly reduced MRSA-induced MUC5AC protein and mRNA overexpression at concentrations of 5 and 20 μg/ml, which were the same as the trough and peak concentrations in human epithelial lining fluid. In an analysis of cell signaling, among the mitogen-activated protein kinase inhibitors, only the extracellular signal-regulated protein kinase 1/2 (ERK1/2) inhibitor reduced the MUC5AC protein production to the same level as that of the control; on Western blot analysis, only ERK1/2 was phosphorylated by the MRSA supernatant. In addition, the ERK1/2 phosphorylation was inhibited by linezolid. MUC5AC and MUC5B are the major barrier that traps inhaled microbial organisms, particulates, and foreign irritants. However, in patients with chronic respiratory diseases, pathogen-induced MUC5AC overexpression causes many problems, and control of the overexpression is important. Thus, this study revealed that linezolid showed a direct immunomodulatory effect in airway epithelial cells.

INTRODUCTION

Linezolid is the first member of the oxazolidinones, a new class of antimicrobial agents. It acts by inhibiting the initiation of bacterial protein biosynthesis and is active against drug-resistant Gram-positive pathogens, such as methicillin-resistant Staphylococcus aureus (MRSA) and vancomycin-resistant enterococci, and it is one of the recommended antibiotics for patients with MRSA pneumonia in the guidelines for the management of hospital-acquired pneumonia (1) Linezolid also reduces production of bacterial toxin (24). In addition, linezolid has been shown to have direct immunomodulatory effects on inflammatory cells to inhibit the production of inflammatory cytokines, such as interleukin-1β (IL-1β), IL-6, IL-8, and tumor necrosis factor alpha (57). The direct immunomodulatory effects of antimicrobial agents have been well elucidated with macrolides. Macrolides affect host cells by downregulating inflammation, reducing production of reactive oxygen, inhibiting neutrophil activation and mobilization, accelerating neutrophil apoptosis, and blocking activation of nuclear transcription factors (8). In addition, one of the immunomodulatory effects of the macrolides on human airway epithelial cells is inhibition of pathogen-induced MUC5AC overexpression (914).

MUC5AC and MUC5B are gel-forming mucins that are strongly expressed in the lung (15). Mucin is the major barrier that traps inhaled microbial organisms, particulates, and foreign irritants in airway epithelium. In particular, MUC5B may play important roles in an airway defense, because loss of the Muc5b gene reduced survival by causing bacterial infection in a murine model (16). In contrast, MUC5AC overexpression was observed in patients with chronic respiratory diseases, such as diffuse panbronchiolitis and asthma (17, 18). The overexpression was also observed in patients with ventilator-associated pneumonia (VAP) (19). Since mucin overexpression causes airway obstruction, atelectasis, reduction of oxygenation, and reduction of antibiotic permeability, inhibition of MUC5AC overexpression seems to be useful.

MUC5AC overexpression is induced by various pathogens, such as Pseudomonas aeruginosa, Escherichia coli, Haemophilus influenzae, Fusobacterium nucleatum, Chlamydophila pneumoniae, and Legionella pneumophila (914, 20, 21). MUC5AC overexpression also induced by peptidoglycan from S. aureus has been reported (22). Although S. aureus, especially MRSA, is an important pathogen in patients with chronic respiratory diseases and VAP, there has been no study that has reported the effect of anti-MRSA antibiotics on MUC5AC overexpression. In addition, there has been no report about a direct immunomodulatory effect of linezolid on human airway epithelial cells. The purpose of this study was to reveal the direct immunomodulatory effect of linezolid by inhibition of MRSA-induced MUC5AC overexpression.

MATERIALS AND METHODS

Materials.

Linezolid (Pfizer, Groton, CT) was dissolved in distilled water. The mouse anti-MUC5AC monoclonal antibody (clone 45M1) was purchased from Monosan (Uden, The Netherlands). The goat anti-mouse horseradish peroxidase-conjugated secondary antibody was obtained from Bio-Rad (Hercules, CA). The extracellular signal-regulated protein kinase (ERK) inhibitor (U0126) was purchased from Promega (Madison, WI). The p38 mitogen-activated protein kinase (MAPK) inhibitor (SB203580) and c-Jun N-terminal kinase (JNK) inhibitor II were purchased from Calbiochem (San Diego, CA). The anti-ERK, anti-phospho-ERK1/2, anti-p38 MAPK, anti-phospho-p38 MAPK, anti-JNK, anti-phospho-JNK, anti-IκBα, and anti-phospho-IκBα antibodies were purchased from Cell Signaling Technology (Danvers, MA). The ERK1/2 control cell extracts, p38 MAPK control cell extracts, JNK control cell extracts, and NF-κB control cell extracts were also purchased from Cell Signaling Technology (Danvers, MA).

Bacterial strain.

The MRSA strain used in this study was NUMR101, which was a clinical isolate obtained from a blood sample from a patient at the Nagasaki University Hospital (23). The bacteria were stored at −80°C in a Microbank bead-based preservation system (Pro-Lab Diagnostics, Ontario, CA) until use. The genetic characteristics of NUMR101 were identified by real-time PCR using the same method described in a previous report (24); the staphylococcal cassette chromosome mec (SCCmec) was type II, and the strain carried virulence genes, such as sec and tsst, but did not carry etb and pvl genes.

Preparation of MRSA supernatant.

To avoid the direct effect of linezolid on MRSA, we used an MRSA supernatant. The MRSA supernatant was prepared by a method modified described in our previous report (12). The NUMR101 strain was cultured on Mueller-Hinton II agar (Becton, Dickinson and Company, Sparks, MD) at 37°C with 5% CO2 in fully humidified air. After overnight incubation, the NUMR101 strain was harvested and incubated in 10 ml of Luria-Bertani (LB) broth (Mo Bio Laboratories, Carlsbad, CA) at 37°C with shaking at 250 rpm for 72 h. After incubation, the bacteria were centrifuged at 10,000 × g for 10 min at 4°C, and the supernatant was filtered using a 0.22-μm-pore Millex-GP filter (Millipore Corporation, Billerica, MA). The MRSA supernatant was stored at −80°C until use.

Cell culture.

The NCI-H292 (human airway epithelial) cell line was cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS). The cells were grown at 37°C with 5% CO2 in fully humidified air. For the MUC5AC production studies, the cells were cultured in RPMI 1640 medium supplemented without FBS for 24 h. After serum starvation, the cells were stimulated with the MRSA supernatant for the enzyme-linked immunosorbent assay (ELISA) or reverse transcription (RT)-PCR. The cells were treated with linezolid simultaneously with stimulation using the MRSA supernatant in the inhibition studies. In reference to the previous study, which reported the trough and peak concentrations of linezolid in the epithelial lining fluid (ELF) of patients with VAP (25), linezolid was used at concentrations of 5 and 20 μg/ml. Since there is the possibility that LB broth induces MUC5AC overexpression, the controls were incubated with the same amount of LB broth as the MRSA supernatant. The cells were also pretreated with signal transduction inhibitors at a concentration of 10 μM for 30 min before stimulation, and the cells in the controls were incubated with only the medium and the same amount of dimethyl sulfoxide as the inhibitors.

ELISA.

The MUC5AC protein level was measured using an enzyme-linked immunosorbent assay (ELISA) (10). The cells were cultured in 24-well plates, and after stimulation with the MRSA extracts for 24 h, the culture medium was collected as the cell supernatant. The supernatant was then incubated at 40°C in a 96-well plate until dry. After incubation, the plates were blocked with 2% FBS for 1 h at room temperature and then incubated with the anti-MUC5AC antibody diluted in phosphate-buffered saline containing 0.05% Tween 20 for 1 h. Horseradish peroxidase-conjugated anti-goat immunoglobulin G was then dispensed into each well. After 1 h, the color was developed using a 3,3′,5,5′-tetramethylbenzidine peroxidase solution, and the reaction was stopped by the addition of 1 N H2SO4. The absorbance was measured at 450 nm.

RNA extraction and real-time quantitative RT-PCR.

Total RNA was extracted from the NCI-H292 cells cultured in 6-well plates using QuickGene Mini-80 and QuickGene RNA cultured cell kits (Kurabo Industries, Osaka, Japan) according to the manufacturer's instructions. Total RNA (1 μg) was reverse transcribed into cDNA using oligo(dT) primers and SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA) and then treated with RNase H. To quantify the expression of the MUC5AC gene, PCR primers and TaqMan probes were designed and used as reported previously (forward primer, 5′-CAGCCACGTCCCCTTCAATA-3′; reverse primer, 5′-ACCGCATTTGGGCATCC-3′; TaqMan probe, 5′–6-carboxyfluorescein [6-FAM]–CCACCTCCGAGCCCGTCACTGAG–6-carboxytetramethylrhodamine [TAMRA]–3′) (11). The MUC5AC was amplified for 40 cycles (15 s at 95°C and 30 s at 60°C) using a LightCycler system (Roche Diagnostics, Basel, Switzerland). To normalize the MUC5AC expression, human porphobilinogen deaminase was also measured using specific PCR primers and TaqMan probes (forward primer, 5′-AACCAGCTCCCTGCGAAGA-3′; reverse primer, 5′-CCAGGATGATGGCACTGAACT-3′; TaqMan probe, 5′–6-FAM–ACTCCTGAACTCCAGATGCGGGAACT–TAMRA–3′) (26).

Western blot analysis.

The cells were harvested at 0, 30, 60, and 90 min after MRSA stimulation and then washed and homogenized at 4°C in lysis buffer (0.1% sodium dodecyl sulfate, 1% Igepal CA-630, 0.5% sodium deoxycholate). The cell lysates (20 to 50 μg) were resolved by electrophoresis on a 12% polyacrylamide gel and transferred to a polyvinylidene difluoride membrane. After blocking the membrane using 10% FBS and 0.1% Tween 20 in Tris-buffered saline for 1 h at room temperature, the blots were hybridized overnight at 4°C with primary antibodies. Hybridization with secondary antibodies was performed, and the immunocomplexes were visualized using the ECL enhanced chemiluminescence Western blotting detection reagent (GE Healthcare, Chalfont St. Giles, United Kingdom).

Statistical analysis.

A statistical software package (StatMate IV for Windows; ATMS Co., Ltd., Tokyo, Japan) was used for all statistical comparisons. All data are expressed as the mean ± standard deviation (SD). One-way analysis of variance was used to determine the statistically significant differences between the groups. The Tukey test was used for pairwise comparison. All tests of significance were two-tailed. The alpha level for denoting statistical significance was set at <0.05.

RESULTS

MRSA supernatant-induced MUC5AC protein production and gene overexpression.

Of the several concentrations of MRSA supernatant, only the 1/40-fold-diluted solution of MRSA supernatant significantly increased the protein level of MUC5AC after 24 h of stimulation (334.1% ± 150.3% greater than the control; P < 0.05 versus control) (Fig. 1A). To make sure that 72 h of incubation in the preparation of MRSA supernatant most increased the protein level of MUC5AC, the 6-h (mid-log phase) and 72-h incubations were compared. The protein level of MUC5AC was 6.6 times higher in MRSA supernatant obtained from 72 h of incubation than that from 6 h of incubation. Based on this result, the 1/40-fold-diluted solution of MRSA supernatant obtained from the 72-h incubation was used for further studies. Subsequently, the influence of the MRSA supernatant on MUC5AC mRNA expression was evaluated. The cells were stimulated for 3, 6, and 9 h, and the mRNA level of MUC5AC was assayed by RT-PCR. The MRSA supernatant significantly increased the mRNA level at 6 and 9 h to approximately 4 times that of the control (P < 0.01) (Fig. 1B).

FIG 1.

FIG 1

Influence of MRSA supernatant on MUC5AC protein production and gene expression. The NCI-H292 cells were stimulated with 1/80-, 1/40-, and 1/20-fold-diluted solutions of the MRSA supernatant. In the control (Ctr), cells were stimulated with the same amount of LB broth as the supernatant. (A) After 24 h of stimulation, the protein levels were measured by ELISA. The results are presented as the percentage greater than that of the control (n = 3). Of the 3 concentrations, only the 1/40-fold-diluted solution significantly increased the protein level of MUC5AC. (B) Cells were stimulated with the 1/40-fold-diluted solution of the MRSA supernatant for 3, 6, and 9 h. The mRNA level of MUC5AC was assayed by RT-PCR. The MRSA supernatant significantly increased MUC5AC mRNA expression at 6 and 9 h. Results are expressed as means ± SD. *, P < 0.05; **, P < 0.01.

Linezolid inhibited MRSA supernatant-induced MUC5AC protein production and gene expression.

We then examined the effect of linezolid on MRSA supernatant-induced MUC5AC protein production and gene expression. Compared with the stimulation group, linezolid significantly reduced MRSA supernatant-induced MUC5AC protein production at concentrations of 5 and 20 μg/ml (373.6% ± 77.8% versus 14.0% ± 68.8% greater than that of the control [P < 0.001] and 373.6% ± 77.8% versus 12.8% ± 13.8% greater than that of the control [P < 0.001], respectively). However, this did not occur in a dose-dependent manner. At the mRNA level, linezolid significantly reduced MRSA supernatant-induced MUC5AC mRNA expression at both concentrations compared with the stimulation group (16.1 ± 8.2 versus 6.9 ± 1.8 [P < 0.001] and 16.1 ± 8.2 versus 8.6 ± 3.2 [P < 0.001], respectively) (Fig. 2B).

FIG 2.

FIG 2

Effect of linezolid on MRSA supernatant-induced MUC5AC protein and gene overexpression. The NCI-H292 cells were treated with linezolid (5 μg/ml and 20 μg/ml). In the control, the cells were treated with culture medium only. (A) After 24 h of treatment, the protein levels were measured by ELISA. The results are presented as the percentage greater than that of the control (Ctr) (n = 3). Linezolid significantly reduced the MRSA supernatant-induced protein production at both concentrations. (B) The cells were treated with linezolid for 6 h, and the mRNA level of MUC5AC was assayed by RT-PCR. Linezolid inhibited MRSA supernatant-induced MUC5AC mRNA expression at both concentrations. Results are expressed as means ± SD. *, P < 0.001 compared with the stimulation group.

Effect of MAPK inhibitors on MRSA supernatant-induced MUC5AC protein production.

To reveal MRSA-induced activation of cell signaling, we examined the MAPK pathway that concerned MUC5AC protein production. The cells were treated with or without MAPK inhibitors (ERK inhibitor, p38 MAPK inhibitor, or JNK inhibitor), and the protein level of MUC5AC was evaluated by ELISA. Compared with the stimulation group, the ERK inhibitor significantly reduced MRSA-induced protein production to the same protein level as that in the control at a concentration of 10 μM (88.7% ± 22.9% versus 3.5% ± 37.1% greater than that in the control; P < 0.01) (Fig. 3). The effect of ERK inhibitor was observed at a concentration of 2 μM but not at 0.4 μM (141.9% ± 11.2% [stimulation group] versus −1.2% ± 5.3% greater than that in the control [P < 0.01] and 159.3% ± 4.0% greater than that in the control [not significant difference], respectively). In contrast, the p38 MAPK inhibitor and JNK inhibitor did not reduce protein production at a concentration of 10 μM (Fig. 3).

FIG 3.

FIG 3

Effect of MAPK inhibitors on MUC5AC protein overexpression. The cells were treated with an ERK inhibitor, p38 MAPK inhibitor, or JNK inhibitor at concentration of 10 μM. After 24 h, the protein levels were evaluated by ELISA. Only the ERK inhibitor significantly reduced MRSA-induced MUC5AC protein production compared with the stimulation group. Ctr, control. Results are expressed as means ± SD. *, P < 0.01 compared with the stimulation group.

Linezolid inhibited the phosphorylation of ERK in MRSA supernatant–activated NCI-H292 cells.

To demonstrate the effect of linezolid on the MAPK pathway, we examined the phosphorylation of MAPKs. As shown in Fig. 4A, the MRSA supernatant increased the phosphorylation of ERK1/2, which was inhibited by linezolid at a concentration of 5 μg/ml (Fig. 4A). In contrast, there was no significant change in the expression of p38 MAPK and JNK. The inhibitory effect of linezolid on the phosphorylation of ERK1/2 was also observed at a concentration of 20 μg/ml (Fig. 4B). Additionally, we examined the activation of the MAPK pathway at 360 and 540 min, during which MUC5AC mRNA overexpression was observed. At these times, only phosphorylation of ERK1/2 was observed (Fig. 5A). The anti-phospho-p38 MAPK and anti-phospho-JNK antibodies worked with positive-control cell extracts (Fig. 5B). Then, an influence of MRSA supernatant on the NF-κB pathway was examined. As shown in Fig. 6, phosphorylation of IκBα was not observed in the Western blot analysis.

FIG 4.

FIG 4

Effect of linezolid on the MAPK pathway. The NCI-H292 cells were treated with or without linezolid for 0, 30, 60, or 90 min, and the cells were harvested after treatment and evaluated by Western blotting. (A) The MRSA supernatant increased only phosphorylation of ERK1/2. The phosphorylation of ERK1/2 was inhibited by linezolid at a concentration of 5 μg/ml. There were no significant changes in other MAPKs, such as p38 MAPK and JNK. (B) The inhibitory effect of linezolid on the phosphorylation of ERK1/2 was observed at concentrations of 5 and 20 μg/ml at 60 and 90 min.

FIG 5.

FIG 5

Influence of MRSA supernatant on the MAPK pathway. The NCI-H292 cells were stimulated with MRSA supernatant for 0, 180, 360, or 540 min, and the cells were harvested after treatment and evaluated by Western blotting. (A) The MRSA supernatant increased only phosphorylation of ERK1/2 at 180, 360, and 540 min. In contrast, there were no significant changes in p38 MAPK and JNK. (B) The anti-phospho-p38 MAPK and anti-phospho-JNK antibodies worked with positive-control cell extracts.

FIG 6.

FIG 6

Influence of MRSA supernatant on the NF-κB. The NCI-H292 cells were stimulated with MRSA supernatant, and the cells were harvested after treatment and evaluated by Western blotting. (A) The MRSA supernatant did not activate the NF-κB pathway at 30, 60, and 90 min. (B) The MRSA supernatant did not activate the NF-κB pathway at 360, 540, and 720 min. (C) The anti-phospho-IkBa MAPK antibody worked with positive-control cell extracts.

DISCUSSION

In this study, the MRSA-induced MUC5AC overexpression was inhibited by linezolid. The inhibitory effect on pathogen-induced MUC5AC overexpression has been reported as one of the immunomodulatory effects of macrolides (912, 14). MUC5AC, as well as MUC5B, is a gel-forming mucin that is strongly expressed in the lung (15). These mucins are the major barrier that traps inhaled microbial organisms, particulates, and foreign irritants in the airway epithelium. In particular, MUC5B may play important roles in airway defense, because a loss of the Muc5b gene reduced survival by causing bacterial infection in a murine model (16). In contrast, the survival of mice was unaffected by loss of the Muc5ac gene. However, MUC5AC overexpression was observed in the Muc5b−/− mice, and it caused abnormal breathing and hypoxemia by impaired mucociliary clearance (16). In patients with chronic respiratory diseases, such as diffuse panbronchiolitis and asthma, MUC5AC overexpression was also observed (17, 18). In these diseases, mucin overexpression would cause airway obstruction, atelectasis, reduction of oxygenation, and reduction of antibiotic permeability. The overexpression is induced by various pathogens, such as Pseudomonas aeruginosa, Escherichia coli, Haemophilus influenzae, Fusobacterium nucleatum, Chlamydophila pneumoniae, and Legionella pneumophila (914, 20, 21). Therefore, it is very important to control pathogen-induced MUC5AC overexpression in patients with respiratory infectious diseases, and the inhibition of the overexpression was considered to be the immunomodulatory effect of linezolid.

The immunomodulatory effect of linezolid was reported in several studies. Some studies have shown that linezolid reduces the level of lipopolysaccharide-induced production of inflammatory cytokines in whole blood (57). Additionally, in the previous studies with methicillin-sensitive S. aureus and MRSA, linezolid has been shown to have an inhibitory effect on the pathogen-induced production of inflammatory cytokines (24). However, in these studies, bacteria were cocultured with linezolid, and linezolid also reduced the levels of toxin production (24). As a result, it was concluded that the inhibitory effect of linezolid on the production of cytokines is associated with a reduction in toxin production. In this study, we used a supernatant of MRSA culture without linezolid to avoid the direct effect of linezolid on MRSA, including the effect on toxin production. Accordingly, our results showed the direct immunomodulatory effect of linezolid on airway epithelial cells.

Although S. aureus is one of the important pathogens causing respiratory tract infection or pneumonia, there have been few reports regarding the influence of S. aureus on MUC5AC production: one study used an S. aureus supernatant (20), and another used peptidoglycan from S. aureus (22). In this study, we revealed the mechanism of the overexpression. The mechanisms of MUC5AC overexpression in airway epithelial cell lines due to activation of members of the MAPK pathway, such as p38 MAPK and ERK1/2, have been reported for various stimulants (27), and the previous study using peptidoglycan from S. aureus reported that peptidoglycan-induced MUC5AC expression was activated through the ERK1/2 pathway (22). This finding was similar to our results; in this study, only the ERK1/2 inhibitor reduced MUC5AC overexpression at the protein level. In Western blot analysis, ERK1/2 was phosphorylated and p38 MAPK and JNK were not phosphorylated. Thus, activation of the ERK1/2 pathway seems to be specific to S. aureus-induced MUC5AC overexpression. Furthermore, we showed the mechanism of the effect of linezolid: linezolid inhibited the phosphorylation of ERK1/2 in Western blot analysis. The upstream factors of ERK1/2, which was affected by MRSA and linezolid, were not investigated in this study, but the findings about the inhibitory effect of linezolid in the MAPK pathway could suggest a direct effect of linezolid on airway epithelial cells.

There are some limitations in this study. We used only 1 MRSA strain, which is a clinical isolate obtained from our hospital, and there is some possibility that the MUC5AC overexpression was strain specific. We did not compare the effect of linezolid with those of the other anti-MRSA agents, and it was not recognized whether the effect is a specific superior characteristic. However, we think that our results show a possibility that the immunomodulatory effect of linezolid could help with treatment of critically ill patients. In this study, linezolid showed the inhibition effect at a trough concentration in the ELF of patients with VAP (25). In patients with VAP, MRSA is the most common pathogen, and the mortality rate is as high as 32.2% (28). Additionally, mucin overexpression was also observed in the patients, and the overexpression contributes to impending mucociliary clearance and favors the colonization of Pseudomonas aeruginosa, which is also the common pathogen in VAP (19). Consequently, the control of mucin overexpression seemed to be important in such patients, and linezolid might have the potential to inhibit the overexpression.

In conclusion, our study showed that the MRSA supernatant induced MUC5AC expression via activation of the ERK1/2 pathway and that linezolid inhibits MUC5AC overexpression. The inhibition effect was considered a direct immunomodulatory effect on airway epithelial cells, and this effect has the possibility to help with the treatment of patients with VAP caused by MRSA.

Footnotes

Published ahead of print 12 May 2014

REFERENCES

  • 1.American Thoracic Society, Infectious Diseases Society of America. 2005. Guidelines for the management of adults with hospital-acquired, ventilator-associated, and healthcare-associated pneumonia. Am. J. Respir. Crit. Care Med. 171:388–416. 10.1164/rccm.200405-644ST [DOI] [PubMed] [Google Scholar]
  • 2.Bernardo K, Pakulat N, Fleer S, Schnaith A, Utermöhlen O, Krut O, Müller S, Krönke M. 2004. Subinhibitory concentrations of linezolid reduce Staphylococcus aureus virulence factor expression. Antimicrob. Agents Chemother. 48:546–555. 10.1128/AAC.48.2.546-555.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Yoshizawa S, Tateda K, Saga T, Ishii Y, Yamaguchi K. 2012. Virulence-suppressing effects of linezolid on methicillin-resistant Staphylococcus aureus: possible contribution to early defervescence. Antimicrob. Agents Chemother. 56:1744–1748. 10.1128/AAC.05430-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sharma-Kuinkel BK, Zhang Y, Yan Q, Ahn SH, Fowler VG., Jr 2013. Host gene expression profiling and in vivo cytokine studies to characterize the role of linezolid and vancomycin in methicillin-resistant Staphylococcus aureus (MRSA) murine sepsis model. PLoS One 8:e60463. 10.1371/journal.pone.0060463 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Garcia-Roca P, Mancilla-Ramirez J, Santos-Segura A, Fernández-Avilés M, Calderon-Jaimes E. 2006. Linezolid diminishes inflammatory cytokine production from human peripheral blood mononuclear cells. Arch. Med. Res. 37:31–35. 10.1016/j.arcmed.2005.05.022 [DOI] [PubMed] [Google Scholar]
  • 6.Lambers C, Burian B, Binder P, Ankersmit HJ, Wagner C, Müller M, Zeitlinger M. 2010. Early immunomodulatory effects of linezolid in a human whole blood endotoxin model. Int. J. Clin. Pharmacol. Ther. 48:419–424. 10.5414/CPP48419 [DOI] [PubMed] [Google Scholar]
  • 7.Takahashi G, Sato N, Yaegashi Y, Kojika M, Matsumoto N, Kikkawa T, Shozushima T, Akitomi S, Aoki K, Ito N, Hoshikawa K, Suzuki Y, Inoue Y, Wakabayashi G, Endo S. 2010. Effect of linezolid on cytokine production capacity and plasma endotoxin levels in response to lipopolysaccharide stimulation of whole blood. J. Infect. Chemother. 16:94–99. 10.1007/s10156-009-0012-5 [DOI] [PubMed] [Google Scholar]
  • 8.Zarogoulidis P, Papanas N, Kloumis I, Chatzaki E, Maltezos E, Zarogoulidis K. 2012. Macrolides: from in vitro anti-inflammatory and immunomodulatory properties to clinical practice in respiratory diseases. Eur. J. Clin. Pharmacol. 68:479–503. 10.1007/s00228-011-1161-x [DOI] [PubMed] [Google Scholar]
  • 9.Kaneko Y, Yanagihara K, Seki M, Kuroki M, Miyazaki Y, Hirakata Y, Mukae H, Tomono K, Kadota J, Kohno S. 2003. Clarithromycin inhibits overproduction of muc5ac core protein in murine model of diffuse panbronchiolitis. Am. J. Physiol. Lung Cell. Mol. Physiol. 285:L847–L853. 10.1152/ajplung.00216.2002 [DOI] [PubMed] [Google Scholar]
  • 10.Imamura Y, Yanagihara K, Mizuta Y, Seki M, Ohno H, Higashiyama Y, Miyazaki Y, Tsukamoto K, Hirakata Y, Tomono K, Kadota J, Kohno S. 2004. Azithromycin inhibits MUC5AC production induced by the Pseudomonas aeruginosa autoinducer N-(3-oxododecanoyl) homoserine lactone in NCI-H292 cells. Antimicrob. Agents Chemother. 48:3457–3461. 10.1128/AAC.48.9.3457-3461.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Morinaga Y, Yanagihara K, Miyashita N, Seki M, Izumikawa K, Kakeya H, Yamamoto Y, Mukae H, Yamada Y, Kohno S, Kamihira S. 2009. Azithromycin, clarithromycin and telithromycin inhibit MUC5AC induction by Chlamydophila pneumoniae in airway epithelial cells. Pulm. Pharmacol. Ther. 22:580–586. 10.1016/j.pupt.2009.08.004 [DOI] [PubMed] [Google Scholar]
  • 12.Araki N, Yanagihara K, Morinaga Y, Yamada K, Nakamura S, Yamada Y, Kohno S, Kamihira S. 2010. Azithromycin inhibits nontypeable Haemophilus influenzae-induced MUC5AC expression and secretion via inhibition of activator protein-1 in human airway epithelial cells. Eur. J. Pharmacol. 644:209–214. 10.1016/j.ejphar.2010.06.056 [DOI] [PubMed] [Google Scholar]
  • 13.Nakamura S, Yanagihara K, Araki N, Yamada K, Morinaga Y, Izumikawa K, Seki M, Kakeya H, Yamamoto Y, Kamihira S, Kohno S. 2011. High-dose tobramycin inhibits lipopolysaccharide-induced MUC5AC production in human lung epithelial cells. Eur. J. Pharmacol. 659:67–71. 10.1016/j.ejphar.2011.03.002 [DOI] [PubMed] [Google Scholar]
  • 14.Nagaoka K, Yanagihara K, Harada Y, Yamada K, Migiyama Y, Morinaga Y, Hasegawa H, Izumikawa K, Kakeya H, Nishimura M, Kohno S. 2013. Macrolides inhibit Fusobacterium nucleatum-induced MUC5AC production in human airway epithelial cells. Antimicrob. Agents Chemother. 57:1844–1849. 10.1128/AAC.02466-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kirkham S, Sheehan JK, Knight D, Richardson PS, Thornton DJ. 2002. Heterogeneity of airways mucus: variations in the amounts and glycoforms of the major oligomeric mucins MUC5AC and MUC5B. Biochem. J. 361:537–546. 10.1042/0264-6021:3610537 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Roy MG, Livraghi-Butrico A, Fletcher AA, McElwee MM, Evans SE, Boerner RM, Alexander SN, Bellinghausen LK, Song AS, Petrova YM, Tuvim MJ, Adachi R, Romo I, Bordt AS, Bowden MG, Sisson JH, Woodruff PG, Thornton DJ, Rousseau K, De la Garza MM, Moghaddam SJ, Karmouty-Quintana H, Blackburn MR, Drouin SM, Davis CW, Terrell KA, Grubb BR, O'Neal WK, Flores SC, Cota-Gomez A, Lozupone CA, Donnelly JM, Watson AM, Hennessy CE, Keith RC, Yang IV, Barthel L, Henson PM, Janssen WJ, Schwartz DA, Boucher RC, Dickey BF, Evans CM. 2014. Muc5b is required for airway defence. Nature 505:412–416. 10.1038/nature12807 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Williams OW, Sharafkhaneh A, Kim V, Dickey BF, Evans CM. 2006. Airway mucus: from production to secretion. Am. J. Respir. Cell Mol. Biol. 34:527–536. 10.1165/rcmb.2005-0436SF [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Kaneko Y, Yanagihara K, Miyazaki Y, Hirakata Y, Mukae H, Tomono K, Okada Y, Kadota J, Kohno S. 2003. Overproduction of MUC5AC core protein in patients with diffuse panbronchiolitis. Respiration 70:475–478. 10.1159/000074202 [DOI] [PubMed] [Google Scholar]
  • 19.Dennesen P, Veeman E, van Nieuw Amerongen A, Jacobs J, Kessels A, van der Keybus P, Ramsay G, van der Ven A. 2003. High levels of sulfated mucins in bronchoalveolar lavage fluid of ICU patients with ventilator-associated pneumonia. Intensive Care Med. 29:715–719. 10.1007/s00134-003-1701-7 [DOI] [PubMed] [Google Scholar]
  • 20.Dohrman A, Miyata S, Gallup M, Li JD, Chapelin C, Coste A, Escudier E, Nadel J, Basbaum C. 1998. Mucin gene (MUC 2 and MUC 5AC) upregulated by Gram-positive and Gram-negative bacteria. Biochim. Biophys. Acta 1406:251–259. 10.1016/S0925-4439(98)00010-6 [DOI] [PubMed] [Google Scholar]
  • 21.Morinaga Y, Yanagihara K, Araki N, Migiyama Y, Nagaoka K, Harada Y, Yamada K, Hasegawa H, Nishino T, Izumikawa K, Kakeya H, Yamamoto Y, Kohno S, Kamihira S. 2012. Live Legionella pneumophila induces MUC5AC production by airway epithelial cells independently of intracellular invasion. Can. J. Microbiol. 58:151–157. 10.1139/w11-123 [DOI] [PubMed] [Google Scholar]
  • 22.Kim YO, Jung MJ, Choi JK, Ahn DW, Song KS. 2011. Peptidoglycan from Staphylococcus aureus increases MUC5AC gene expression via RSK1-CREB pathway in human airway epithelial cells. Mol. Cells 32:359–365. 10.1007/s10059-011-0118-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Yanagihara K, Morinaga Y, Nakamura S, Seki M, Izumikawa K, Kakeya H, Yamamoto Y, Yamada Y, Kamihira S, Kohno S. 2008. Subinhibitory concentrations of telithromycin, clarithromycin and azithromycin reduce methicillin-resistant Staphylococcus aureus coagulase in vitro and in vivo. J. Antimicrob. Chemother. 61:647–650. 10.1093/jac/dkm507 [DOI] [PubMed] [Google Scholar]
  • 24.Motoshima M, Yanagihara K, Morinaga Y, Matsuda J, Sugahara K, Yamada Y, Kohno S, Kamihira S. 2010. Genetic diagnosis of community-acquired MRSA: a multiplex real-time PCR method for staphylococcal cassette chromosome mec typing and detecting toxin genes. Tohoku J. Exp. Med. 220:165–170. 10.1620/tjem.220.165 [DOI] [PubMed] [Google Scholar]
  • 25.Boselli E, Breilh D, Rimmelé T, Djabarouti S, Toutain J, Chassard D, Saux MC, Allaouchiche B. 2005. Pharmacokinetics and intrapulmonary concentrations of linezolid administered to critically ill patients with ventilator-associated pneumonia. Crit. Care Med. 33:1529–1533. 10.1097/01.CCM.0000168206.59873.80 [DOI] [PubMed] [Google Scholar]
  • 26.Sasaki D, Imaizumi Y, Hasegawa H, Osaka A, Tsukasaki K, Choi YL, Mano H, Marquez VE, Hayashi T, Yanagihara K, Moriwaki Y, Miyazaki Y, Kamihira S, Yamada Y. 2011. Overexpression of enhancer of zeste homolog 2 with trimethylation of lysine 27 on histone H3 in adult T-cell leukemia/lymphoma as a target for epigenetic therapy. Haematologica 96:712–719. 10.3324/haematol.2010.028605 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Thai P, Loukoianov A, Wachi S, Wu R. 2008. Regulation of airway mucin gene expression. Annu. Rev. Physiol. 70:405–429. 10.1146/annurev.physiol.70.113006.100441 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Kollef MH, Morrow LE, Niederman MS, Leeper KV, Anzueto A, Benz-Scott L, Rodino FJ. 2006. Clinical characteristics and treatment patterns among patients with ventilator-associated pneumonia. Chest 129:1210–1208. 10.1378/chest.129.5.1210 [DOI] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES