Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
letter
. 2014 Jul;58(7):4248. doi: 10.1128/AAC.02931-14

Emergence of High-Level Azithromycin Resistance in Campylobacter jejuni Isolates from Pediatric Diarrhea Patients in Kolkata, India

Piyali Mukherjee 1, T Ramamurthy 1, Utpala Mitra 1, Asish K Mukhopadhyay 1,✉
PMCID: PMC4068546  PMID: 24777098

LETTER

Campylobacter species infection is the leading cause of bacterial enteritis worldwide. Most Campylobacter infections cause acute, self-limiting diarrheal disease. However, patients with more severe disease and immunologically compromised patients need antibiotic treatment (1). The most common antimicrobial agents used in the treatment of Campylobacter infections are fluoroquinolones and macrolides. In India, fluoroquinolone resistance has increased markedly (more than 85%) in recent years (2, 3). Resistance toward macrolides varies from place to place. In northern India, the macrolide resistance was 6.1% during 2005 (4) and reached 22.2% in 2013 (2). From 2008 to 2010, macrolide resistance was only 0.7% in eastern India (3).

One hundred sixty-six Campylobacter jejuni strains isolated from pediatric diarrhea cases (children of <5 years) at B. C. Roy Children's Hospital, Kolkata, India, from 2010 to 2012 were tested for macrolide resistance. About 4% of the isolates (6/166) were macrolide resistant by the disc diffusion method. The Etest (Biomeriux) assay with azithromycin indicated that five isolates were resistant to concentrations up to 256 μg/ml. When tested by the dilution method (5), two isolates were resistant to azithromycin at 1,000 μg/ml and three others had azithromycin MICs between 500 and 1,000 μg/ml. Macrolide resistance in Campylobacter is associated mainly with a point mutation(s) occurring within the peptidyl transferase region in domain V of the 23S rRNA gene, the target of macrolides. Sequencing analysis of a 552-bp amplicon of the V region of the 23S rRNA gene using primers F2-Campy-23S (AATTGATGGGGTTAGCATTAGC) (6) and 2420R-Campy-23S (AGAACCACCGGATCACTAAGA) revealed the presence of an A2075G transition in all the isolates (GenBank accession numbers KJ620831 to KJ620835). The PCR-amplified product of the V region of 23S rRNA from a highly resistant isolate was electroporated into azithromycin-susceptible C. jejuni strain 81-176, and transformants were selected on 10-μg/ml azithromycin plates. 23S rRNA gene sequence analysis of resistant mutant C. jejuni 81-176 (MIC, 1,000 μg/ml) identified the same mutation found in the parent strain, indicating that the A2075G mutation is responsible for the macrolide resistance in this region. In addition, we also found some colonies with a mutation at a different position (A2074C) under in vitro conditions and that may have mutated due to selection pressure. Resistance (1,000 μg/ml azithromycin) of two colonies containing the A2074C mutation matched a previous report that describes the role of selection on macrolides (7). The apparently high frequency of the A2075G mutation among Campylobacter isolates is possibly attributable to the biological features generated by this mutation such that the A2075G mutation has a survival advantage over the other mutations (8).

Azithromycin has been recently introduced in India for the treatment of various infections in both children and adults. Antibiotics are available without prescription in India. Campylobacter can transfer genes by natural transformation, and antibiotic pressure can select for mutations responsible for macrolide resistance (9). As macrolide resistance is emerging in eastern India, the study and monitoring of macrolide resistance are, in turn, becoming increasingly important. The finding of Campylobacter isolates with high levels of resistance in this region of India demonstrates the relevance of antimicrobial susceptibility surveillance that will define the proper utility of various drugs in the treatment of different infections.

ACKNOWLEDGMENTS

This study was supported by the Indian Council of Medical Research (ICMR), Government of India (intramural project identification no. IM/AKM-2/07-08/17)

P.M. acknowledges receipt of a Senior Research fellowship (no. 80/748/2012-ECD-I) from the ICMR, India.

Footnotes

Published ahead of print 28 April 2014

REFERENCES

  • 1.Blaser MJ, Engberg J. 2008. Clinical aspects of Campylobacter jejuni and Campylobacter coli infections, p 99–121 I: Nachamkin I, Szymanski CM, Blaser MJ. (ed), Campylobacter. ASM Press, Washington, DC [Google Scholar]
  • 2.Ghosh R, Uppal B, Aggarwal P, Chakravarti A, Jha AK. 2013. Increasing antimicrobial resistance of Campylobacter jejuni isolated from paediatric diarrhea cases in a tertiary care hospital of New Delhi, India. J. Clin. Diagn. Res. 7:247–249. 10.7860/JCDR/2013/5267.2738 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Mukherjee P, Ramamurthy T, Bhattacharya MK, Rajendran K, Mukhopadhyay AK. 2013. Campylobacter jejuni in hospitalized patients with diarrhea, Kolkata, India. Emerg. Infect. Dis. 19:1155–1156. 10.3201/eid1907.121278 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Jain D, Sinha S, Prasad KN, Pandey CM. 2005. Campylobacter species and drug resistance in a north Indian rural community. Trans. R. Soc. Trop. Med. Hyg. 99:207–214. 10.1016/j.trstmh.2004.09.006 [DOI] [PubMed] [Google Scholar]
  • 5.Jeong JY, Mukhopadhyay AK, Akada JK, Dailidiene D, Hoffman PS, Berg DE. 2001. Roles of FrxA and RdxA nitroreductases of Helicobacter pylori in susceptibility and resistance to metronidazole. J. Bacteriol. 183:5155–5162. 10.1128/JB.183.17.5155-5162.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Vacher S, Ménard A, Bernard E, Mégraud F. 2003. PCR-restriction fragment length polymorphism analysis for detection of point mutations associated with macrolide resistance in Campylobacter spp. Antimicrob. Agents Chemother. 47:1125–1128. 10.1128/AAC.47.3.1125-1128.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Hao H, Dai M, Wang Y, Peng D, Liu Z, Yuan Z. 2009. 23S rRNA mutation A2074C conferring high-level macrolide resistance and fitness cost in Campylobacter jejuni. Microb. Drug Resist. 15:239–244. 10.1089/mdr.2009.0008 [DOI] [PubMed] [Google Scholar]
  • 8.Gibreel A, Taylor DE. 2006. Macrolide resistance in Campylobacter jejuni and Campylobacter coli. J. Antimicrob. Chemother. 58:243–255. 10.1093/jac/dkl210 [DOI] [PubMed] [Google Scholar]
  • 9.Almofti YA, Dai M, Sun Y, Haihong H, Yuan Z. 2011. Impact of erythromycin resistance on the virulence properties and fitness of Campylobacter jejuni. Microb. Pathog. 50:336–342. 10.1016/j.micpath.2011.02.009 [DOI] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES