A high throughput RNAi screen reveals determinants of HIV-1 activity in host kinases

Abstract

Drug resistance remains a great challenge in HIV/AIDS treatment despite the recent advances in novel therapeutics. It may be a good strategy to develop drugs targeting the essential host factors to decrease the risk of drug resistance. Previous studies suggested that so many host kinases play roles in HIV life cycles. More importantly, many kinase genes are drugable targets, therefore, it is vital to figure out host kinases responsible for HIV-1 infection and replication to provide novel therapeutic regimens and to deepen our understanding to HIV-host interaction. In present work, a high throughput RNAi screen with a shRNA library against 474 kinases was applied to HEK293T cells stably expressed a HIV-1 LTR (long terminal repeat)-driven reporter plasmid. Four genes, AK1, EphB2, PRKACB and CDK5R2, were found to specifically suppress the HIV-1 LTR activity following effective knockdown. Furthermore, overexpression of AK1 and PRKACB upregulated the HIV-1 LTR activity. Therefore, AK1 and PRKACB are in positive control of HIV-1 activity. DNA microarray analysis demonstrated that overlapped genes between AK1-silenced and PRKACB-silenced cells were mainly enriched in several amino acid biosynthesis pathways, TGF-β signaling and p53 signaling pathways. These alterations may repress the viral infection by the downregulation of ERK1/2, p38MAPK and NFκB signaling pathways. Collectively, our work uncovers several host kinases involving the HIV-1 infection and may provide potential therapeutic targets for AIDS treatment in future.

Introduction

HIV-1/AIDS remains to be a global health threat despite the recent advances in novel therapeutics. Most currently approved HIV therapeutics target viral enzymes, including reverse transcriptase, protease, and integrase [1]. Despite the effectiveness of antiviral regimens, drug resistance can emerge due to the low fidelity of HIV reverse transcriptase [2]. Antiviral medicines targeting host factors required for HIV infection or replication that do not require contact with viral gene products for efficacy may provide a higher barrier to the generation of resistance [3].

The HIV-1 genome is approximately 9.8 kb in length and encodes only 15 proteins, thus HIV must exploit multiple host-encoded proteins to complete each step of its life cycle, including entry into the host cell, uncoating, reverse transcription, nuclear import, integration, transcription, translation, viral assembly, and budding. The identity of these host factors remains incompletely understood [4,5].

RNAi-based loss-of-function screen is powerful approach to identify potential cellular interaction partners of HIV-1. Several high throughput RNAi screens have been performed to uncover the host cofactors recruited by HIV-1 during its life cycle [6-8]. Some kinases were found to be closely related to HIV-1 replication in these reports, such as AKT1 and JAK1. Furthermore, DNA-dependent protein kinase (DNA-PK) [9], macrophage-specific Src kinase Hck [10], HIV-1-associated PKA [11], atypical protein kinase C (aPKC) [12], Phosphatidylinositol 3-Kinase p110α [13], PKC-delta [14] and TGF-β-activated kinase 1 (TAK1) [15] were proposed to be involved in different steps of HIV-1 life cycles, respectively. More importantly, many kinase genes are drugable targets and there are so many available drugs for kinases, therefore, it is vital to figure out host kinases responsible for HIV-1 infection and replication to provide novel therapeutic regimens and to deepen our understanding to HIV-host interaction.

To this end, a high throughput RNAi screen with a shRNA library against 474 kinases was applied to HEK293T cells stably transfected with a HIV-1 long terminal repeat (LTR)-driven reporter plasmid. The positive hits were validated and the mechanism by which these genes regulated HIV-1 function was investigated through DNA microarray.

Materials and methods

Cell culture

HEK293T cells (American Type Culture Collection, Rockville, Md.) were cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS), penicillin (100 IU/ml) and streptomycin (100 μg/ml) (Life Technologies) in a humidified atmosphere containing 5% CO₂ at 37°C. Cells in the exponential growth phase were used for all the experiments.

ShRNA library construction

474 kinase genes were subjected to shRNA primer design and eight distinct shRNA fragments for each gene were constructed into lentivirus vector (Invitrogen, BLOCK-iT™ Lentiviral RNAi Expression System, K4944-00), the eight shRNA plasmids for each gene were separated into two groups (A-D and E-H), four plasmids in each group were mixed with equal amount and the mixtures were applied to shRNA lentivirus package, the viral titers of the obtained lentivirus were examined in HEK293T cells according to the manufacturer’s protocol. The obtained two shRNA pools for each gene were used for RNAi screening. HEK293T cells were infected with shRNA lentivirus at MOI of 5 in the presence of polybrene (8 μg/ml).

Report plasmid construction

Two fragments of HIV-1 LTR were synthesized according to the 1-634 nt sequence of HIV-1 genome (Genebank No. K03455.1) with a 5’-BglII digestion end and a 3’-NheI digestion end. The two synthesized fragments were annealed, and ligated to a BglII/NheI double digested psiCHECK-2 plasmid. Then a CMV promoter-copGFP-T2A-Hygromycin cassette was inserted into the obtained plasmid at BamHI site, and the HIV-1 LTR-hRluc/HSV TK-hLuc dual reporter plasmid with copGFP/Hygromycin marker was constructed. The diagram of the reporter plasmid was drawn with the aid of ApE software.

Screen of cell line stably expressed HIV-1 LTR-hRluc/HSV TK-hLuc dual reporter plasmid

The HIV-1 LTR-hRluc/HSV TK-hLuc dual reporter plasmid was transfected into HEK293T cells. 72 h later, 50 μg/ml of Hygromycin (Sigma) was added into the culture medium and maintained for one week or so. And the survival cells were all with green fluorescence and were Hygromycin-resistant. These cells were maintained in medium with 20 μg/ml of hygromycin and cultured for subsequent experiments.

RNAi screen

HEK293T cells stably expressed HIV-1 LTR-hRluc/HSV TK-hLuc dual reporter plasmid (700 cells/well) were seeded in 100 μl of culture medium containing serum per well in a 96-well plate. 24 h later, the cells were treated with control shRNA (shCtrl) or shRNA library. Importantly, shNFκB or PF-04691502, one AKT inhibitor, was applied to the cells as positive controls. 96 h later, the cells were washed with PBS and resuspended with 50 μl of PLB buffer for 15 minutes. And then the cells were pelleted and the supernatant were subjected to detect the fluorescence intensity of hRluc and hLuc through the Dual-Luciferase Reporter Assay System (Promega, Cat. No. E1960). The relative HIV-1 LTR activity was calculated by the fluorescence intensity of hRluc divided by the fluorescence intensity of hLuc.

Four distinct shRNA species targeting each positive pool were used to revalidate hits from the secondary screen. A significance threshold of P < 0.05 (Student’s t test) was used for each individual shRNA. Validation of RNAi gene silencing was measured by quantitative PCR as described below.

Quantitative PCR (qPCR)

HEK293T cells stably expressed HIV-1 LTR-hRluc/HSV TK-hLuc dual reporter plasmid were infected with lentiviral shRNA under condition above mentioned. After 24 h, the culture medium was refreshed. RNA was extracted 72 h later and cDNA was synthesized using PrimeScript RT reagent kit with gDNA Eraser (Takara, RR074A) for RT-PCR with oligo-dT. Real-time qPCR was performed on CFX-96 (Bio-lab), with endogenous control Actb. Gene expression was calculated relative to expression of Actb endogenous control and adjusted relative to expression in shCtrl-infected cells. The primers for qPCR validation were list in Table 1.

Table 1.

Primers for qPCR

Gene	Forward	Reverse
Actb	GCATCCCCCAAAGTTCACAA	GGACTTCCTGTAACAACGCATCT
AK1	AGTTTGAGCGACGGATTGGA	CAAGAGCCGCTGGGTCAT
EphB2	TCTTCCTCATTGCTGTGGTTGT	GTGTTGCAGCTTGTCCGTGTA
PRKACB	TGGATTGGTGGGCATTAGGA	CTGAATTGGTTGGTCTGCAAAG
CDK19	CTTGGCTACTCTTCCTCGTCTCA	CCAACGGGAGCTGGTCAGT
CDK5R2	CCCCATCTGCCCTTCTTGTT	CAAGCTGACACAAGTGGAGGAA

Overexpression of AK1 and PRKACB

AK1 and PRKACB were respectively cloned from cDNA of DU145 and Hela cells and subcloned into pcDNA3.1+ with a C-terminal Flag-tag. The AK1-Flag or PRKACB-Flag or pcDNA3.1+ plasmid was transfected into HEK293T cells stably expressed HIV-1 LTR-hRluc/HSV TK-hLuc dual reporter plasmid. 48 h later, one part of the transfected cells was resuspended in 1 × SDS loading buffer, the other part of transfected cells was used for detection of the fluorescence intensity. Lysates (20 μg each lane) were applied to SDS-PAGE. Immunoblotting of Abs specific for GAPDH (Abmart, 080922) and Flag (Sigma, F1804) was detected using HRP-conjugated anti-mouse (Promega) and visualized by chemiluminescence detection system (Millipore, WBKLS0500).

Microarray analysis

HEK293T cells (8 × 10⁴) were grown in 2 ml of DMEM medium containing serum per well in a 6-well plate and then left untreated or treated with shAK1 or shPRKACB lentivirus for 96 h. Every treatment was duplicated in the same experiment. All the samples were homogenized with 1 ml Trizol (Invitrogen, Life Technologies) and total RNAs were extracted according to the manufacturer’s instruction.

500 ng total RNA was used to synthesize double-strand cDNA and in vitro transcribed to cRNA, purified 10 μg cRNA was used to synthesize 2nd-cycle cDNA and then hydrolyzed by RNase H and purified. Above steps were performed with Ambion WT Expression Kit. 5.5 μg 2nd-cycle cDNA was fragmented and the single-stranded cDNA was labeled with GeneChip2 WT Terminal Labeling Kit and Controls Kit (Affymetrix, PN 702880). About 700 ng fragmented and labeled single-stranded cDNA were hybridized to an AffymetrixGeneChip Human Gene 1.0 ST array, which was washed and stained with GeneChip2 Hybridization, Wash and Stain kit (Affymetrix).

Results

Dozens of kinases regulate transcription activity of HIV-1 LTR

To find kinases involving in regulating transcription activity of HIV-1 LTR, a high throughput RNAi screen with shRNA library against 474 kinases was applied to HEK293T stably expressed HIV-1 LTR-hRluc/HSV TK-hLuc dual reporter plasmid (Figure 1A). The relative transcription activity of HIV-1 LTR was represented with the fluorescence intensity of hRluc divided by the fluorescence intensity of hLuc. To verify the reliability of this screen system, two positive controls, NFκB and AKT1, were used in the screen either as a shRNA or specific inhibitor (Figure 1B). Knockdown of NFκB or inhibition of kinase activity of AKT1 repressed the HIV-1 LTR activity by more than 30%, suggesting the screen system was reliable. The primary screen results showed that there were 155 positive hits against 136 genes which repressed the HIV-1 LTR activity by higher than 20% (Figure 1C). And then these 155 hits were subjected to the secondary screen and 15 positive hits were obtained (Figure 1D) and list in Table 2.

Figure 1.

A high throughput RNAi screen with shRNA library against 474 kinases in HEK293T stably expressed HIV-1 LTRhRluc/HSV TK-hLuc dual reporter plasmid. (A) Construction of HIV-1 LTR-hRluc/HSV TK-hLuc dual reporter plasmid. (B) Two positive controls used for valuation the reliability of screen system. shCtrl, control shRNA; shNFκB, shRNA against NFκB; PF-04691502, one specific inhibitor for AKT1. (C) Primary screen. (D) Secondary screen. The red lines in (C) and (D) represented that the relative HIV-1 LTR activity was equal to 0.8.

Table 2.

15 candidate genes for following study from RNAi screen

Gene	Relative HIV-1 LTR activity	Gene	Relative HIV-1 LTR activity
HKDC1	0.673	BAZ1A	0.74
AK1	0.714	EPHB2	0.747
TBRG4	0.717	NEK6	0.748
PRKAR2A	0.72	PRKACB	0.748
BLK	0.724	CDK19	0.749
PRKD2	0.727	TP53RK	0.758
GIT2	0.728	CDK5R2	0.762
		ACTR2	0.776

Kinases were specifically in positive control of HIV-1 LTR activity

To assess the specificity of these 15 positive hits, the shRNA species composed of each shRNA pool were used for validation (Figure 2A). The results showed that 6 shRNA species against 5 kinases inhibited the HIV-1 LTR activity by higher than 20% (Figure 2B). The knockdown efficacy was examined by qPCR (Figure 2C). The results showed that silencing of AK1, EphB2, PRKACB and CDK5R2 specifically suppressed the HIV-1 LTR activity.

Figure 2.

Validation of positive hits in secondary screen. A: Four shRNA species of each shRNA pool of 15 positive hits were applied to the third screen. B: The list of the positive hits in the third screen. C: qPCR examination of knockdown efficacy of each positive hits in the third screen.

Overexpression of AK1 and PRKACB upregulate the HIV-1 LTR activity

To further investigate the roles of kinases on the regulation of HIV-1 LTR activity, AK1 and PRKACB were overexpressed with a C-terminal Flag-tag, as described in Materials and Methods. Western blotting experiments showed that AK1 and PRKACB were actually overexpressed in HEK293T cells stably expressed HIV-1 LTR-hRluc/HSV TK-hLuc dual reporter plasmid (Figure 3A). AK1 overexpression upregulated the HIV-1 LTR activity by 48%, while PRKACB overexpression increased the HIV-1 LTR activity by 90% (Figure 3B), suggesting that AK1 and PRKACB are really in positive control of HIV-1 LTR activity.

Figure 3.

Overexpression of AK1 or PRKACB upregulated the HIV-1 LTR activity. A: Immunoblotting assay for the AK1-Flag and PRKACB-Flag overexpression. B: The roles of AK1 and PRKACB overexpression on the HIV-1 LTR activity. “Vector” in this figure represented the expression vector, pcDNA3.1+.

DNA microarray results suggested that knockdown of AK1 or PRKACB may inhibit the HIV-1 LTR activity via NFκB signaling pathway

To uncover the underlying mechanism by which AK1 and PRKACB positively regulate the HIV-1 LTR activity, AK1 or PRKACB silenced HEK293T cells were applied to DNA microarray analysis. There were 132 and 93 dramatically expression-altered genes (expression difference was higher than 50% and P < 0.05), respectively, following AK1 and PRKACB knockdown. 69 genes overlapped between AK1 and PRKACB silenced HEK293T cells were subjected to Ingenuity Pathway Analysis (IPA). IPA results showed that several amino acid biosynthesis pathways, TGF-β signaling pathway and p53 signaling pathway were significantly altered after AK1 and PRKACB knockdown (Figure 4A). Furthermore, network analysis of IPA showed that virus infection, apoptosis and cell death of kidney cell lines were markedly repressed following AK1 and PRKACB knockdown (Figure 4B). Moreover, upstream factors analysis of IPA showed that the downregulated signaling of ERK1/2 and p38MAPK may contribute to the repression of NFκB signaling pathway (Figure 4C). Collectively, knockdown of AK1 or PRKACB may inhibit the HIV-1 LTR activity via NFκB signaling pathway, which deserves further investigation.

Figure 4.

IPA results for 69 overlapped genes between AK1-silenced and PRKACB-silenced cells. A: The significantly altered pathways following AK1 and PRKACB knockdown. B: Network analysis of IPA showed that virus infection, apoptosis and cell death of kidney cell lines were repressed. C: Upstream factors analysis of IPA showed that downregulation of ERK1/2 and p38MAPK signaling may contribute to the inhibition of NFκB and p53 signaling.

Discussion

Drug resistance remains a great challenge in HIV/AIDS treatment despite the recent advances in novel therapeutics. Most currently approved HIV therapeutics target viral enzymes. However, the high variability of HIV genome catalyzes the emergency of drug resistance. Meanwhile, the little size of HIV genome makes it vital to recruit host factors to complete its life cycle. Therefore, it is a good strategy to develop drugs targeting the essential host factors to decrease the risk of drug resistance. Previous studies suggested that so many host kinases play roles in HIV life cycles. More importantly, many kinase genes are drugable targets and there are so many available drugs for kinases, therefore, it is vital to figure out host kinases responsible for HIV-1 infection and replication to provide novel therapeutic regimens and to deepen our understanding to HIV-host interaction.

In present work, a high throughput RNAi screen with a shRNA library against 474 kinases was applied to HEK293T cells stably expressed a HIV-1 LTR-driven reporter plasmid. In our screen system, HSV-TK promoter-driven and constitutively expressed hLuc was used as an internal reference to rule out the influence of shRNA knockdown on cell viability. Meanwhile, NFκB and AKT1 were used as positive controls for the high throughput screen. As HIV-1 LTR contains NFκB motifs, numerous studies suggest that host NFκB signaling plays a critical role in activation of HIV-1 gene expression and hence is vital for HIV-1 infection and replication [15-18], NFκB inactivation inhibits HIV-1 infection and replication [19-21]. As for AKT1, previous study showed that its knockdown by siRNA decreased HIV infection activity by more than 5-fold [8]. In our results, knockdown of NFκB by shRNA and inhibition of AKT1 by specific inhibitor both downregulated the HIV-1 LTR activity by more than 30%. Collectively, the dual reporter plasmid and the two positive controls assured the reliability of our screen system.

Four genes, AK1, EphB2, PRKACB and CDK5R2, were found to specifically suppress the HIV-1 LTR activity following effective knockdown. AK1 (adenylate kinase 1) is an enzyme involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate group among adinine nucleotides. Expression of AK1 is supposed to be induced by Aβ (42) to increase abnormal tau phosphorylation via AMPK-GSK3β and contributes to tau-mediated neurodegeneration, providing a new upstream modulator of GSK3β in the pathologic phosphorylation of tau [22]. EphB2 (EPH receptor B2) protein is transmembrane receptor. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. EphB2 activity plays a pivotal role in pediatric medulloblastoma cell adhesion and invasion [23]. EphB2 was suggested to modulate the fusion cascade of paramyxovirus Nipah virus [24], and the expression of EphB2 was reported to be downregulated by HIV infection in anterior cingulate [25], these reports suggested the probability that EphB2 involves in the infection of HIV. PRKACB (the catalytic subunit beta of cAMP-dependent protein kinase) protein is a member of the Ser/Thr protein kinase family and is a catalytic subunit of cAMP-dependent protein kinase. Capalbo et al reported that PRKACB has relevance for HIV-1 pathology [26]. CDK5R2 [cyclin-dependent kinase 5, regulatory subunit 2 (p39)] protein is a neuron-specific activator of CDK5 kinase. It associates with CDK5 to form an active kinase. There is no report on the interplay between CDK5R2 and virus.

The sequent overexpression experiments showed that AK1 and PRKACB are actually in positive control of HIV-1 infection. DNA microarray analysis demonstrated that overlapped genes between AK1-silenced and PRKACB-silenced cells were mainly enriched in several amino acid biosynthesis pathways, TGF-β signaling and p53 signaling pathways. These alterations may repress the viral infection by the downregulation of ERK1/2, p38MAPK and NFκB signaling pathways. These results warrant further investigation in functional validation.

Taken together, our work uncovers several host kinases involving the HIV-1 infection and may provide potential therapeutic targets for AIDS treatment in future.

Disclosure of conflict of interest

None.