Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Jul 15.
Published in final edited form as: Dev Biol. 2014 Apr 26;391(2):158–169. doi: 10.1016/j.ydbio.2014.04.014

Foxi3 is necessary for the induction of the chick otic placode in response to FGF signaling

Safia B Khatri 1, Renee K Edlund 3, Andrew K Groves 1,2,3,*
PMCID: PMC4070591  NIHMSID: NIHMS591212  PMID: 24780628

Abstract

Vertebrate cranial sensory organs are derived from region at the border of the anterior neural plate called the pre-placodal region (PPR). The otic placode, the anlagen of the inner ear, is induced from PPR ectoderm by FGF signaling. We have previously shown that competence of embryonic ectoderm to respond to FGF signaling during otic placode induction correlates with the expression of PPR genes, but the molecular basis of this competence is poorly understood. Here, we characterize the function of a transcription factor, Foxi3 that is expressed at very early stages in the non-neural ectoderm and later in the PPR of chick embryos. Ablation experiments showed that the underlying hypoblast is necessary for the initiation of Foxi3 expression. Mis-expression of Foxi3 was sufficient to induce markers of non-neural ectoderm such as Dlx5, and the PPR such as Six1 and Eya2. Electroporation of Dlx5, or Six1 together with Eya1 also induced Foxi3, suggesting direct or indirect positive regulation between non-neural ectoderm genes and PPR genes. Knockdown of Foxi3 in chick embryos prevented the induction of otic placode markers, and was able to prevent competent cranial ectoderm from expressing otic markers in response to FGF2. In contrast, Foxi3 expression alone was not sufficient to confer competence to respond to FGF on embryonic ectoderm. Our analysis of PPR and FGF-responsive genes after Foxi3 knockdown at gastrula stages suggests it is not necessary for the expression of PPR genes at these stages, nor for the transduction of FGF signals. The early expression but late requirement for Foxi3 in ear induction suggests it may have some of the properties associated with pioneer transcription factors.

Keywords: Otic placode, FGF, Pre-placodal region, Foxi3, induction, competence

INTRODUCTION

All craniofacial sensory organs derive from transient ectodermal thickenings adjacent to the anterior neural plate, termed sensory placodes (Baker and Bronner-Fraser, 2001; D’Amico-Martel and Noden, 1983; Noden, 1993; Schlosser, 2006, 2010; Streit, 2007). The precursors of different sensory placodes are initially intermingled and derive from a common domain called the pre-placodal region (PPR) (Baker and Bronner-Fraser, 2001; Ohyama et al., 2007; Schlosser, 2005; Streit, 2004, 2007). The PPR is defined by expression of several molecular markers including members of the Six and Eya gene families (Grocott et al., 2012; Kwon et al., 2010; Schlosser, 2005, 2006, 2007, 2008; Streit, 2007). PPR marker genes are induced by FGF signals from underlying cranial paraxial mesoderm, and by BMP and Wnt antagonists from paraxial mesoderm and the neural plate (Ahrens and Schlosser, 2005; Brugmann et al., 2004; Grocott et al., 2012; Litsiou et al., 2005). A number of genes that are initially expressed broadly in non-neural ectoderm, such as members of the Dlx, Gata, and Foxi gene families later become restricted to the PPR prior to overt placode differentiation (Bhat et al., 2013; Grocott et al., 2012; Groves and Labonne, 2013; Khatri and Groves, 2013; Kwon et al., 2010; Litsiou et al., 2005; McLarren et al., 2003; Ohyama and Groves, 2004; Saint-Jeannet and Moody, 2014; Schlosser, 2006; Streit, 2007).

It is now well-established that members of the Fibroblast Growth Factor (FGF) family play an important role in otic placode induction (Ladher et al., 2010; Ohyama et al., 2007; Schimmang, 2007). Several FGF family members are expressed in the primordium of the hindbrain or cranial mesoderm prior to otic placode formation. FGF signaling is both necessary and sufficient to induce a number of early otic placode markers (Leger and Brand, 2002; Liu et al., 2003; Maroon et al., 2002; Mendonsa and Riley, 1999; Nechiporuk et al., 2007; Nikaido et al., 2007; Phillips et al., 2001). The identity and localization of FGF family members involved in ear induction vary considerably between vertebrate groups – for example, zebrafish fgf3 and fgf8 are expressed in the hindbrain (Leger and Brand, 2002; Liu et al., 2003; Maroon et al., 2002; Phillips et al., 2001), chick Fgf3 and Fgf19 are expressed in both the hindbrain and cranial paraxial mesoderm (Ladher et al., 2000; Vendrell et al., 2000), and mouse Fgf3 and Fgf10 are expressed respectively in hindbrain and cranial mesoderm (Wright and Mansour, 2003). FGF signaling first induces a broad otic-epibranchial placode domain, marked by Pax2/8 genes, and subsequent Wnt and Notch signaling then divides this territory into the otic placode proper and an adjacent territory that gives rise to epidermis and epibranchial placodes (Freter et al., 2008; Jayasena et al., 2008; Ladher et al., 2000; Ladher et al., 2010).

In our previous work, we showed that competence to induce early otic genes in response to FGF signaling correlates with the expression PPR genes (Martin and Groves, 2006; Yang et al., 2013). In these experiments, we found that culture of chicken PPR ectoderm in the presence of FGF2 induces early placode markers such as Pax2, whereas more lateral cranial ectoderm from embryos of a similar age, or early anterior epiblast from gastrulating embryos does not respond to FGF2 in this manner (Martin and Groves, 2006; Yang et al., 2013). However, the molecular basis of this differential competence to respond to FGF signaling is not clear. For example, mis-expression of the PPR genes Six1 and Eya2 in non-neural ectoderm is not sufficient to allow such ectoderm to respond to FGF signals by expressing otic markers (Christophorou et al., 2009).

The zebrafish foxi1 gene is expressed early in non-neural ectoderm and eventually localizes to the PPR (Solomon et al., 2003). Zebrafish foxi1 mutants have severe inner ear defects, with the otic vesicle either greatly reduced or completely absent (Nissen et al., 2003; Solomon et al., 2003). Early markers of the zebrafish otic placode such as pax8, pax2a and dlx3b are also either absent or greatly reduced (Nissen et al., 2003; Solomon et al., 2003), and combined mis-expression of fgf8, foxi1 and dlx3b in medaka fish leads to the induction of some early otic genes and otic vesicle formation in non-neural ectoderm (Aghaallaei et al., 2007). Several Forkhead transcription factors have been proposed to act as competence factors in the development of the liver, pancreas and lens (Kenyon et al., 1999; Lee et al., 2005b; Zaret, 1999), in which FGF signaling has also been implicated (Lee et al., 2005a; Lee et al., 2005b; Wandzioch and Zaret, 2009). In particular, Foxa1 and Foxa2 may provide competence by acting as pioneer factors that occupy and open silent regions of chromatin in advance of transcriptional activation by lineage-specific developmental signals (Zaret and Carroll, 2011; Zaret et al., 2008). It is therefore possible that foxi1 plays a role in the competence of the PPR to respond to FGF signaling in otic placode induction (Yan et al., 2006).

We have previously described Foxi3 expression in non-neural ectoderm and the PPR in both mouse and chick embryos (Khatri and Groves, 2013; Ohyama and Groves, 2004), suggesting it may play an analogous role in amniotes to that of foxi1 in zebrafish. We now show that Foxi3 can regulate both non-neural ectoderm genes such as Dlx5, and genes that define the pre-placodal region such as members of the Six and Eya gene families. Morpholino knockdown of Foxi3 at gastrula stages leads to a failure of otic placode induction. However, we show that despite its early expression in non-neural ectoderm and the PPR, Foxi3 knockdown at gastrula stages does not affect the expression of PPR genes or the reception of FGF signaling. Moreover, ectopic expression of Foxi3 is not sufficient to confer competence on non-PPR ectoderm to respond to FGF signals. Our data are consistent with Foxi factors acting as pioneer factors in the induction of the inner ear.

EXPERIMENTAL PROCEDURES

Chicken Embryos

Fertilized chicken eggs were purchased from Ideal Poultry Breeding Farms (Cameron, TX), and stored at 13°C. Eggs were placed in a humidified incubator at 37.8°C to develop. Embryos were staged either using Hamburger and Hamilton (HH) stages (Hamburger and Hamilton, 1992), or by counting the number of somites (ss).

Hypoblast and Mesendoderm Ablation Experiments

Chick embryos were cultured using the “EC” filter paper carrier method developed by Chapman and colleagues (Chapman et al., 2001) as previously described (Martin and Groves, 2006). HH stage 3–5 embryos were dissected out and incubated in 0.15% trypsin in Howard’s Ringer solution for 30 seconds at room temperature to enable easier ablation of underlying tissue. Embryos were allowed to recover for 1 minute in complete medium (10% fetal bovine serum in L15 medium). Hypoblast or mesendoderm tissue was then ablated with a 30G needle. Embryos were placed on 35mm albumen agar plates (Chapman et al., 2001) and incubated at 37°C for 3–14 hrs, fixed in 4% paraformaldehyde and analyzed by in situ hybridization.

Collagen gel cultures

Ectoderm explants of trigeminal, lateral or anterior epiblast were obtained by treating embryos with 1 mg/ml dispase (Roche) in Howard’s Ringer solution for 10 minutes on ice, and then for 5 minutes at room temperature. The dispase was neutralized with 10% FBS in DMEM for 15 minutes on ice. Embryos were washed with cold Ringer’s solution and the desired tissue was dissected out and freed from underlying layers with 30G needles in cold Ringer’s solution and stored in DMEM-BS (a modification of the chemically defined medium of Bottenstein and Sato, 1979; Martin and Groves, 2006) on ice. Collagen gels were prepared as previously described (Selleck and Bronner-Fraser, 1995). Briefly, 9 parts collagen solution (Advanced BioMatrix) were combined with 1 part 10xMEM (Invitrogen) and brought to neutral pH with a few drops (approximately 1/20th total volume) of 7.5% sodium bicarbonate (Invitrogen). 5–8 explants were suspended in 150μl gel per well of 4-well plate and then the gel was allowed to set at 37°C. The cultures were grown in DMEM-BS at 37°C and 5% CO2 for 24 hours in the presence or absence of 50ng/ml FGF2. Cultures were fixed in 4% paraformaldehyde for 2 hours, washed with PBS and embedded in 7.5% gelatin and 15% sucrose in PBS, and sectioned at 18μm.

RNA in situ probes

A species-specific cDNA probe for the 3′ untranslated regions of chicken Foxi3 was obtained from the UMIST Chick EST Repository (chEST50h20; Khatri and Groves, 2013). Other cDNA probes were kindly provided as follows: Dlx5 (Michael Kessel), Gata3 (Doug Engel), Sox3 (Berta Alsina), Six1 (Guillermo Oliver), Six4 (Paola Bovolenta), Eya2 (Guillermo Oliver), Pax2 (Domingos Henrique), Pea3 (Annette Neubüser). A 981 chick Foxg1 riboprobe was made by amplifying chick genomic DNA with the following primers: F: GTTCAGCTACAACGCGCTCATCAT and R: GGATCCTAATACGACTCACTATAGGGAGTCATCATTTACAACGCGAACGTGTG. An 875bp chick Sox8 riboprobe was made by amplifying chick genomic DNA with the following primers: F: CACGCCGCCCACGA and R: GGATCCTAATACGACTCACTATAGGGAGTTGGAGAGTTTCAAAGCAAGGG. In both cases, the reverse primer incorporated a T7 polymerase site (GGATCCTAATACGACTCACTATAGGGAG) for in vitro transcription of the amplified PCR product (Yang et al., 2013).

DNA Constructs

Expression constructs for mouse Gata3 (IMAGE# 6826352), AP2α (IMAGE# 3983850) were obtained from Invitrogen. Expression constructs for chick Dlx5, Eya2 and Six1 were kindly provided by Andrea Streit (Christophorou et al., 2009; McLarren et al., 2003). A full-length mouse Foxi3 cDNA was amplified from a mouse BAC containing the Foxi3 locus (RPCI-23-315G17; Ohyama and Groves, 2004). We first verified the transcriptional start site of mouse Foxi3 by 5′ RACE (Invitrogen) using mRNA from E14.5 mouse epidermis. Primers for 5′ RACE were predicted based on mFoxi3 sequences in NBCI and Ensembl. Exons 1 and 2 of mouse Foxi3 were amplified separately and cloned together into pCMV-SPORT6 to yield the full length mouse Foxi3 cDNA. Detailed methods are available on request.

Chick Embryo Electroporation

For targeted mis-expression of full length mouse Foxi3 or morpholinos against Foxi3, embryos in EC culture were electroporated as described before (McLarren et al., 2003) at the desired stages. Morpholinos were purchased from Gene Tools with the following sequences: Chick Foxi3-Splice: 5′-TTCCGGCGGAAAATAGGAGAAGCA-3′; Chick Foxi3-5′UTR: 5′-TGCAGTACACCGGCCATTCTTGGG-3′; Control morpholino: 5′-CCTCTTACCTCAGTTACAATTTATA-3′. The best results were obtained when the two blocking morpholinos were electroporated together. 300μM concentration of each morpholino was electroporated along with 1μg of a pCIG expression plasmid containing GFP. For electroporation, embryos of the desired stage were placed in a Petri dish-style electroporation chamber (CUY701-P2E, Protech) above a positive platinum electrode and immersed in Ringer’s solution. The negative electrode (CUY701-P2L), Protech) was positioned above the region to be transfected with DNA or morpholinos. Approximately 1–2 μg/μl of DNA vector or 300nM of morpholino was mixed with a little Fast Green and applied to the targeted region between the vitelline membrane and ectoderm using a mouth micropipette. Embryos were electroporated with 5 pulses (10V, 50-ms duration) at 1 second interval delivered from a CUY-21SC electroporator (Protech). Electroporated embryos were cultured on agar-albumen plates (Chapman et al., 2001) at 38°C for the desired time before being fixed and processed for analysis.

Whole mount in situ hybridization

Chick embryos were fixed in 4% paraformaldehyde in PBS, pH 7.2 overnight at 4°C or for two hours at room temperature. Embryos were then washed in PBS and hydrated and rehydrated in a series from methanol to phosphate-buffered saline (PBS, pH 7.4) containing 0.1% Tween-20 (PBST). Embryos were treated with 10μg/ml proteinase K for 10–30 min (depending on the stage of the embryo), washed gently and re-fixed in 4% paraformaldehyde/0.1% glutaraldehyde. After further washing in PBST, the embryos were pre-hybridized at 65°C in 50% formamide containing 1.3xSSC (buffered to pH 4.5 with citric acid), 50μg/ml yeast tRNA, 100 μg/ml heparin, 0.2% Tween-20, 0.5% CHAPS and 5 mM EDTA. After 1 hour, probe was added to the embryos to a final concentration of 1 μg/ml and incubated overnight. The embryos were washed three times with hybridization buffer for 1 h each at 65°C and then washed three times for 1 hour each at room temperature in MABT buffer (100 mM maleic acid pH 7.5, 150 mM NaCl, 0.1% Tween-20). The embryos were then incubated for 1 hour in MABT containing 20% sheep serum and 2% Roche Blocking Reagent. Sheep anti-digoxygenin antibody coupled to alkaline phosphatase (Roche) was added at a concentration of 1:2000 and the embryos incubated overnight. After washing, color development was carried out in alkaline phosphatase buffer (100mM Tris pH9.5, 50mM MgCl2, 100mM NaCl, 0.1% Tween-20) with NBT (338μg/ml) and BCIP (175μg/ml). After color development, stained embryos were re-fixed, washed for 10 minutes in methanol, 30 minutes in 0.1% Tween-20 in PBS, photographed and where necessary, embedded in 7.5% gelatin (300 Bloom) and 15% sucrose in PBS, and sectioned at 18μm.

Immunocytochemistry

Fixed embryos were equilibrated in PBS containing 15% sucrose and embedded in 7.5% gelatin (300 Bloom, Sigma) and 15% sucrose as previously described (Sechrist and Marcelle, 1996). 18μm sections were collected on Superfrost Plus slides (Fisher) and stored at −20°C. Sections were blocked in PBS containing 0.1% Tween-20 and 5% goat serum. Primary antibodies were diluted in blocking solution and applied overnight at 4°C. Secondary antibodies were diluted in blocking solution and applied for 1 hour at room temperature. Slides were washed in PBS containing 0.1% Tween-20 several times after each application of antibody, and were rinsed in distilled water before being mounted in Fluoromount-G (Southern Biotechnology). The following antibodies were used in this study: A rabbit polyclonal antibody to Pax2 (Zymed; 1:200) and chicken polyclonal antibody to GFP (Abcam; 1:400). Secondary fluorescent antibodies were conjugated to Alexa-488 and Alexa-579 (Invitrogen). In some cases, sections were counterstained with DAPI (10μg/ml).

RESULTS

Foxi3 is a non-neural ectodermal gene that becomes restricted to the pre-placodal region

We previously described Foxi3 as one of the earliest genes expressed in the PPR (Khatri and Groves, 2013; Ohyama and Groves, 2004). To determine the precise timing of its expression with respect to neural induction and PPR induction, we compared Foxi3 expression with the non-neural ectodermal genes Dlx5 and Gata3 (Pera and Kessel, 1999; Sheng and Stern, 1999), the pre-neural marker gene Sox3 (Collignon et al., 1996; Rex et al., 1997; Rogers et al., 2013; Uwanogho et al., 1995) and the PPR genes Six1 and Eya2 (Christophorou et al., 2009; Schlosser, 2007; Zou et al., 2004) between developmental stages HH2-HH7 in chick (Fig. 1). Gata3 could be detected in non-neural ectoderm at HH stage 2, with Dlx5 appearing in non-neural ectoderm at HH stage 3 (Fig 1A). Foxi3 also begins to be expressed very faintly in this region at HH stage 3, but its expression was far weaker than either Dlx5 or Gata3 (Fig. 1A). By HH4, the definitive neural plate is marked by the expression of Sox2 (Streit et al., 2000). At this stage, expression of Foxi3, Dlx5 and Gata3 is restricted to the border of neural and non-neural ectoderm (Fig. 1B; Sheng and Stern, 1999). We observed a second domain of Foxi3 in the anterior neural plate that disappeared by HH6-7 (Fig. 1B). By HH5, Dlx5 and Foxi3 expression at the neural plate border overlapped with two definitive markers of the PPR, Six1 and Eya2. These two genes were expressed faintly in the neural plate border and mesoderm underlying the neural plate at HH5, but were more strongly expressed in the PPR at HH6 and continued to overlap with the expression of Foxi3 and Dlx5. By the head fold stage (HH7), the expression of Dlx5 and Foxi3 began to become mutually exclusive within the PPR, with the anterior PPR down-regulating Foxi3 and the posterior PPR down-regulating Dlx5 (Fig. 1B). In contrast, Six1 and Eya2 continue to be expressed throughout the entire PPR (Fig. 1B). A summary of the appearance of Foxi3 in non-neural ectoderm and its refinement to the PPR is shown in Fig. 1C.

Figure 1. Expression of Foxi3 during neural and pre-placodal region induction.

Figure 1

Open in a new tab

(A): The timing of chick Foxi3 expression was compared with non-neural ectoderm genes (Dlx5 and Gata3) and a pre-neural gene (Sox3) at pre-gastrula to mid-gastrula stages (HH 2 and 3). (B): Expression of Foxi3 was compared to the pre-placodal region genes Six1 and Eya2, and the non-neural ectoderm gene Dlx5 that localizes to the PPR from stage HH4 –HH7. (C): Schematic representation of Foxi3 expression during induction of the pre-placodal region. By HH3 Gata3 and Dlx5 are expressed in non-neural ectoderm (blue). By HH4, a boundary region is established between neural and non-neural domains that expresses Dlx5, Foxi3 and Gata3 (blue). Fainter expression of Dlx5 and Gata3 remains in parts of the non-neural ectoderm. By HH6, the expression of Dlx5, Gata3 and Foxi3 is accompanied by definitive markers of the pre-placodal region, Six1 and Eya2.

Signals from hypoblast but not mesoderm are necessary for Foxi3 induction

We next asked what signals regulate the early expression of Foxi3 in non-neural ectoderm and its maintenance in the PPR. Foxi3 expression can be detected in the epiblast at a stage when it is in contact with hypoblast, prior to the emergence and migration of mesendoderm. We ablated the hypoblast at HH3 or mesendoderm at HH4-5 (Fig. 2A) and let the embryos develop for 3–5 hours. Ablation of the hypoblast in HH3 embryos caused a rapid down-regulation of Foxi3 in non-neural ectoderm within hours (n=15/17) whereas ablation of mesendoderm in HH4-5 embryos did not visibly affect Foxi3 expression (n=0/15; Fig. 2B). Streit and colleagues have previously shown that signals from cranial mesendoderm are necessary for induction of PPR genes such as Six1, Six4, Eya1 and Eya2 from HH5 onwards (Litsiou et al., 2005). We therefore tested whether mesendoderm was required for the maintenance of Foxi3 in the PPR at these stages. We ablated cranial mesendoderm in HH4-5 embryos and cultured them for 12–14 hours (Fig. 2A). Mesendoderm ablation down-regulated the definitive PPR genes Six1 (n=5/5) and Eya2 (n=8/11) on the operated but not un-operated sides of the embryos (Fig. 2C). However, mesendoderm ablation did not down-regulate Foxi3 (n=0/15), nor Dlx5 (n=0/6; Fig. 2C). These results suggest that Foxi3 is regulated in a similar fashion to other non-neural ectoderm genes: although it becomes localized to the PPR after gastrulation, it is regulated by signals in the hypoblast that are distinct from those in the mesoderm that regulate definitive PPR gene expression. (Fig. 2B).

Figure 2. Regulation of Foxi3 in non-neural ectoderm.

Figure 2

Open in a new tab

(A): Diagram showing hypoblast and mesendoderm ablation at different stages. (B): Ablation of hypoblast at HH3 down-regulated Foxi3 expression within 3–5 hrs (red arrow), however mesendoderm ablation at HH4/5 did not affect Foxi3 expression (black or white arrows). The HH stage in each panel refers to the stage of ablation. (C): Mesoderm ablation at HH stages 4–5 down-regulated the PPR genes Six1 and Eya2 (red arrows) after 12–14 hours without affecting expression of the non-neural ectoderm genes Dlx5 and Foxi3 (black arrows).

Regulation of Foxi3 by non-neural ectoderm and PPR genes

Since Foxi3 expression in non-neural ectoderm is preceded by Dlx5, we next tested whether Dlx5 could regulate Foxi3 expression. We electroporated full-length Dlx5 into HH3-5 embryos together with a GFP expression construct and analyzed Foxi3 expression (Figure 3A, B). We observed ectopic induction of Foxi3 in embryos electroporated with Dlx5 (n=9/10; Fig. 3B) but not GFP alone (n=0/14; Fig. 3D). In a complementary experiment, we electroporated full-length Foxi3 into HH3-5 embryos and analyzed Dlx5 expression at HH7-8. Electroporation of Foxi3 induced Dlx5 expression (n=7/12; Fig. 3C) but GFP alone had no effect (n=0/7; Fig. 3D). Ectopic expression of Foxi3 was seen in the majority of GFP+ cells electroporated with Dlx5 and vice versa; however, ectopic expression of both Dlx5 or Foxi3 was also sometimes seen in cells expressing little or no GFP. These results suggest that Dlx5 and Foxi3 can both regulate each other’s expression in non-neural ectoderm, but that that some of this induction may occur by non-cell autonomous mechanisms.

Figure 3. Mutual positive regulation of the non-neural ectoderm genes Foxi3 and Dlx5, and the pre-placodal genes Six1 and Eya2.

Figure 3

Open in a new tab

(A): Diagram showing the approximate region of the embryo targeted by electroporation at stages HH3-5 to express genes in lateral embryonic ectoderm. (B): Mis-expression of Dlx5 or Six1 together with Eya2 resulted in ectopic induction of Foxi3. (C): Mis-expression of Foxi3 resulted in ectopic induction of the non-neural ectoderm gene Dlx5 and the pre-placodal genes Six1 and Eya2. In all cases, a GFP expression vector was co-electroporated to indicate reveal electroporated cells. Negative controls using the GFP expression vector alone are shown in (D). For all electroporations, embryos were sectioned with the dotted line shows the approximate plane of section. Both low power and high power images (dotted boxes) are shown to indicate the overlap between each gene and GFP-electroporated cells.

Dlx5 has been previously reported to regulate the expression of definitive PPR genes such as Six1 and Eya2 (McLarren et al., 2003; Sato et al., 2010). To test whether Foxi3 can also induce PPR genes, we mis-expressed it lateral to the PPR and analyzed expression of Six1 and Eya2 (Fig. 3C). Electroporation of Foxi3 but not GFP alone in primitive streak stage (HH3-5) embryos resulted in the ectopic induction of Six1 (Foxi3+GFP, n=21/34; GFP, n=0/7) and Eya2 (Foxi3+GFP, n=10/16; GFP, n=0/6; Fig. 3C, D). Once again, although most cells expressing Six1 or Eya2 had been electroporated on the basis of GFP expression, some ectopic Six1 or Eya2-expressing cells were not positive for GFP. The ability of Foxi3 to induce PPR genes was limited to regions anterior and lateral to the PPR, with no induction seen in the posterior neural plate or ectoderm posterior to the PPR (data not shown). A number of non-neural ectoderm and PPR transcription factors maintain their expression through the use of feedback and feed-forward loops (Bhat et al., 2013). To test whether PPR genes can also act together to induce Foxi3 expression, we co-electroporated Six1 together with the Eya2 transcriptional co-regulator into HH3-5 chick embryos. Mis-expression of Six1 and Eya2 induced Foxi3 within 6–8 hrs (n=10/11; Fig. 3B). We also confirmed previous results from Streit and colleagues that PPR genes are able to regulate Dlx5 expression (Christophorou et al., 2009): mis-expression of Six1 and Eya2 induced ectopic Dlx5 in lateral ectoderm (n=5/8; not shown).

These results suggest that Dlx5, Foxi3, and Six1/Eya2 are able to regulate one another’s expression in non-neural ectoderm. Although much of these inductive interactions appear to be direct, the presence of some areas of ectopic expression of these genes outside electroporated (GFP+) regions suggest the possibility of indirect, non-cell-autonomous induction as well, as has been shown to be the case for Dlx3 in Xenopus (Woda et al., 2003) and Dlx5 in chick (McLarren et al., 2003).

Foxi3 is necessary for otic placode induction in response to FGF signaling

The zebrafish foxi1 gene is expressed in non-neural and pre-placodal ectoderm in a similar pattern to chick and mouse Foxi3 (Khatri and Groves, 2013; Nissen et al., 2003; Ohyama and Groves, 2004; Solomon et al., 2003). Mutation or knockdown of foxi1 either blocks or greatly reduces the induction of otic placode gene sin zebrafish (Nissen et al., 2003; Solomon et al., 2003; Hans et al., 2007). To test whether chick Foxi3 was necessary for otic placode induction, we electroporated a combination of translation- and splice-blocking Foxi3 morpholinos into the presumptive otic placode region of HH5-7 embryos and analyzed expression of early otic placode markers and otic placode formation (Fig. 4A). Expression of Pax2 and Foxg1 were both significantly down-regulated after morpholino electroporation (Pax2=7/11, Foxg1=5/8; Fig. 4B) 8–10 hours after electroporation but not in embryos electroporated with control morpholinos (Pax2=0/6, Foxg1=0/10; Fig. 4B). We also found that Foxi3 morpholinos were not able to inhibit Pax2 induction when electroporated at HH stage 8 or older; by these ages, specification of the Pax2+ domain had already commenced (data not shown; Groves and Bronner-Fraser, 2000). These results suggest that Foxi3 is necessary for the induction of early otic markers but not for their maintenance once they have been specified.

Figure 4. Foxi3 is necessary for otic placode induction in response to FGF signaling.

Figure 4

Open in a new tab

(A): Diagram showing the approximate position of electroporation of Foxi3 morpholinos to target the otic placode region (B): Morpholino knockdown of Foxi3 down-regulated the otic markers Foxg1 and Pax2 in the otic placode region (asterisks). Control morpholinos had no effect on the expression of these markers in the otic placode (arrows)

In our previous work, we showed that the PPR region is uniquely able to respond to FGF signaling by inducing otic placode markers (Martin and Groves, 2006). Moreover, other ectoderm populations can acquire the ability to express otic markers in response to FGF signals if they are grafted into the PPR and allowed to express PPR markers (Martin and Groves, 2006). To test whether Foxi3 is necessary for otic induction in the presence of FGF signaling, we electroporated the presumptive trigeminal region of HH5-7 chick embryos with Foxi3 or control morpholinos together with a GFP reporter (Fig. 5A). We used presumptive trigeminal ectoderm since it readily induces Pax2 when cultured in FGF2 but does not express Pax2 in the absence of FGF2 (Martin and Groves 2006, Yang et al., 2013). We then dissected and cultured the electroporated ectoderm in the presence or absence of FGF2 overnight (Fig. 5A) and counted the proportion of electroporated cells (shown by GFP expression) that co-expressed Pax2. Even at saturating doses of FGF2, typically only 70–75% of trigeminal explants express Pax2 (Martin and Groves, 2006), We therefore only examined explants in which at least some Pax2+ cells could be detected in unelectroporated, GFP-ve regions. Moreover, since only a subset of cells in presumptive trigeminal ectoderm explants express Pax2 in response to FGF signaling (Martin and Groves, 2006), this reduced the probability of co-electroporation of Foxi3 morpholinos into these responsive cells in our experiments. Consequently, only a minority - 17.2% - of GFP+ cells in trigeminal explants receiving control morpholinos and cultured in FGF2 expressed Pax2 (Fig. 5B, C). However, only 2.1% of GFP+ cells in explants receiving Foxi3 morpholinos and FGF2 expressed Pax2 (Fig. 5B, C, p<0.05), suggesting that knockdown of Foxi3 expression can significantly attenuate the response of pre-placodal ectoderm to FGF signals.

Figure 5. Foxi3 is necessary for induction of Pax2 in FGF-responsive ectoderm.

Figure 5

Open in a new tab

(A): Pre-placodal ectoderm was electroporated with morpholinos and a GFP vector at stages HH5-7. After a brief period of culture, GFP+ ectoderm was dissected and cultured in the presence or absence of 50ng/ml FGF2 for 24 hours. (B): Explants were sectioned and stained with antibodies for Pax2, GFP and counterstained with DAPI. Significantly fewer GFP+ cells receiving Foxi3 morpholinos express the otic marker Pax2 (red) compared with control morpholinos. (C): Sectioned explants that contained Pax2+ cells were identified and then quantified by examining the proportion of GFP+ cells that also expressed Pax2 in the presence of control or Foxi3 morpholinos. 20 explants were counted per condition in three separate experiments. The mean and standard error are shown for each condition (***=p<0.05)

We previously showed that both anterior epiblast and lateral ectoderm are competent to express otic placode markers when grafted into the pre-placodal region and allowed to up-regulate PPR genes, but neither population can induce otic markers when cultured in FGF2 without prior up-regulation of PPR genes (Martin and Groves, 2006). To test if Foxi3 is sufficient to provide competence to respond to FGF, we mis-expressed Foxi3 and a GFP reporter construct in the anterior epiblast at HH3-4 or lateral to the presumptive otic placode at HH 6–7, and then incubated the embryos for 6–8 hours to identify the electroporated ectoderm by its GFP fluorescence (Fig. 6A; B). We then dissected the electroporated, GFP+ ectoderm, cultured it for 24 hours in the presence or absence of FGF2 and assayed for Pax2 expression (Fig. 6A). As a positive control, we cultured presumptive trigeminal ectoderm from HH7-8 stage embryos in FGF2 (Fig. 6A), and as previously reported, we saw significant up-regulation of Pax2 in about 70–75% of these control cultures (Fig. 6C; Martin and Groves, 2006; Yang et al., 2013). However, we observed no Pax2 expression in either anterior epiblast or lateral ectoderm that had been electroporated with a Foxi3 construct and cultured in FGF2 for 24 hours (Fig. 6D; based on three independent experiments).

Figure 6. Foxi3 is not sufficient to confer competence to respond to FGF signaling on non-neural ectoderm.

Figure 6

Open in a new tab

(A): Diagram showing electroporation of anterior epiblast (stage HH3-4 embryos) or lateral ectoderm (stage HH5-7 embryos) with Foxi3 expression constructs. After a brief period of culture, GFP+ ectoderm was dissected and cultured +/− FGF2 for 24 hours. Presumptive trigeminal ectoderm from HH7-8 embryos was used as a positive control (B): Examples of electroporated, GFP+ anterior epiblast or lateral ectoderm before and after dissection. (C): Pax2 (red) is readily induced in presumptive trigeminal ectoderm when cultured in the presence, but not absence of FGF2. (D): Pax2 is not induced in GFP+ anterior epiblast or lateral ectoderm expressing Foxi3 and cultured with FGF2. Pax2 is shown in red, GFP in green and DAPI nuclei in blue.

It is possible that Foxi3 is not sufficient to confer competence on ectoderm to respond to FGF signaling, but that it may do so in concert with other genes expressed in the pre-placodal region (Litsiou et al., 2005; Christophorou et al., 2009). To test this, we repeated our experiments but now co-electroporated Dlx5, Six1 and Eya2 constructs into anterior epiblast together with Foxi3 (Supplementary Fig. 1A). However, we did not detect any Pax2 expression in electroporated ectoderm after 24 hours culture in FGF2 (Supplementary Fig. 1B). Previous studies in zebrafish have also shown that foxi1 can act together with gata3 and ap2α to promote induction of PPR genes in non-neural ectoderm (Bhat et al., 2013; Kwon et al., 2010). We therefore co-electroporated expression constructs for Foxi3, Gata3 and Ap2α into anterior epiblast and cultured the electroporated tissue with FGF2 for 24 hours. However, we were again unable to detect Pax2 expression in any of the electroporated cells (Supplementary Fig. 1C).

Foxi3 is only necessary for the final steps of otic placode induction

Our results suggest that Foxi3 is necessary to allow PPR tissue to express otic placode markers in response to FGF signaling (Fig. 4), but that it is not sufficient to provide competence to respond to FGF signaling, either by itself or with a series of other genes expressed in the PPR (Fig. 6 and Supplementary Fig. 1). To determine what steps in otic placode induction required Foxi3 function, we electroporated Foxi3 morpholinos into HH3-5 stage embryos (Fig. 7A) and assayed for expression of the PPR genes Six1 and Eya2. We observed no difference in the expression of either gene in embryos receiving Foxi3 morpholinos versus GFP controls (Fig. 7B; Six1: n=12; Eya1: n=14). Similar results were seen with the non-neural gene Gata3, which localizes to the pre-placodal region (Fig. 7B; n=6) We finally examined whether the FGF signaling pathway was activated in PPR ectoderm in the absence of Foxi3. The Ets transcription factor family member Pea3 (Etv4) is expressed in otic ectoderm in response to FGF inducing signals (Hans et al., 2007; Urness et al., 2010; Yang et al., 2013), and in presumptive trigeminal explants treated with FGF2 (Supplementary Fig. 2). We electroporated Foxi3 morpholinos into HH3-5 stage embryos and assayed for the expression of Pea3. We observed no difference in the intensity of Pea3 expression in PPR ectoderm receiving Foxi3 morpholinos compared to the un-electroporated control side of the embryos and GFP controls (Fig. 7B; n=25). Since a similar treatment with Foxi3 morpholinos is able to efficiently block the induction of Pax2 and Foxg1 (Fig. 4B), these results suggest that Foxi3 function is not required at gastrula stages for PPR gene expression, nor for PPR ectoderm to respond to FGF signaling. However, Foxi3 function is necessary for the induction of the earliest otic marker Pax2, and this function is required at stages after the reception of FGF signaling.

Figure 7. Foxi3 acts after induction of the PPR and reception of FGF signals.

Figure 7

Open in a new tab

(A): Diagram showing the approximate position of electroporation of morpholinos to target the pre-placodal region (B): No effect was seen on the expression of PPR marker genes Six1 and Eya2, nor the non-neural ectoderm marker Gata3 when Foxi3 knocked down with morpholinos. Similarly, no effect was seen in the expression pattern of Pea3, a downstream target of FGF signaling molecule when Foxi3 was knocked down by morpholinos. The presence of all four markers in electroporated ectoderm was confirmed by examination of sectioned material (the approximate plane of section indicated with dotted lines). Electroporated cells are revealed by GFP fluorescence from the GFP expression vector introduced with the Foxi3 morpholinos.

DISCUSSION

Foxi3 and the transition from non-neural to pre-placodal ectoderm

The early development of the central and peripheral nervous systems is driven by a series of inductive events occurring both before and after gastrulation. The first evidence of nervous system development is the appearance of pre-neural markers such as Sox3, bounded by non-neural ectodermal markers such as Dlx5, Foxd3 and Gata3 (Grocott et al., 2012; Groves and Labonne, 2013; Saint-Jeannet and Moody, 2014; Streit, 2007; Streit et al., 2000). The boundary between neural and non-neural ectoderm will later resolve into two progenitor populations, the pre-placodal region and the presumptive neural crest (Grocott et al., 2012; Groves and Labonne, 2013; Patthey and Gunhaga, 2011, 2013; Streit, 2007). Many studies suggest that these two progenitor populations are induced by opposing sets of signals – for example neural crest induction requires both BMP and Wnt signaling (Litsiou et al., 2005), but induction of the PPR requires inhibition of both BMP and Wnt signals (Ahrens and Schlosser, 2005; Brugmann et al., 2004; Kwon et al., 2010; Leung et al., 2013; Litsiou et al., 2005). Here, we show that Foxi3 is initially expressed in non-neural ectoderm after the induction of Dlx5, but before induction of definitive pre-placodal genes such as Six1 and Eya2 (Fig. 1). Although both Dlx5 and Foxi3 become restricted to the PPR at later stages of development, the signals required for their initial induction and maintenance in non-neural ectoderm come from the hypoblast (Fig. 2B and (Pera et al., 1999), rather than the mesodermal signals that are required for induction of PPR genes such as Six1 and Eya2 (Litsiou et al., 2005; Fig. 2C). BMP and FGF signaling have been reported to induce zebrafish foxi1 in non-neural ectoderm (Bhat et al., 2013; Hans and Westerfield, 2007; Phillips et al., 2004), and it is likely that FGFs from the hypoblast and BMPs from early embryonic ectoderm may similarly induce Foxi3 in chick.

A number of studies suggest that one mechanism for the individuation of neural crest and pre-placodal tissue at the neural plate border region is the presence of positive and negative transcriptional feedback loops. Thus, PPR-specific transcription factors positively regulate each other and repress neural crest transcription factors, and neural crest transcription factors similarly positively regulate one another and repress PPR genes (Bhat et al., 2013; Brugmann et al., 2004; Christophorou et al., 2009; Hong and Saint-Jeannet, 2007; Kwon et al., 2010; Pieper et al., 2012). Our data suggest that Foxi3 may participate in such positive inductive loops: ectopic expression of Foxi3 can induce Dlx5, Six1 and Eya2, and expression of Dlx5 or Six1 together with Eya2 can also induce expression of Foxi3 (Fig. 2E, 3B, D). Although it is assumed that this positive or negative regulation between transcription factors in the neural plate border region is direct, there are currently only a few examples of binding sites for transcription factors of the PPR, non-neural ectoderm or neural crest occurring in defined promoter or enhancer regions for other genes in these families. For example, Six1 expression in the neural plate border region can be regulated by a conserved regulatory enhancer downstream of Six1 that contains binding sites for the non-neural ectoderm protein Dlx5 and the neural crest-specific protein Msx1 (Sato et al., 2010). However, it is also possible that cross-regulation of non-neural ectoderm and PPR genes may occur by indirect, non-cell-autonomous mechanisms in addition to direct, cell-autonomous binding of one transcription factor to the enhancers of other neural plate border genes. This has been reported previously for Dlx3 in zebrafish and Dlx5 in chick (McLarren et al., 2003; Woda et al., 2003). Indeed, in the present study, we observed ectopic expression of Dlx5, Foxi3, Six1 or Eya2 in patches of ectoderm that did not express GFP and were thus not likely to have been electroporated. Although the signals responsible for the non-cell-autonomous functions of genes like Dlx5 have yet to be identified (McLarren et al., 2003), it is likely that BMP, Wnt and FGF signals, or factors that modulate the activity of these signals may be responsible for propagating these non-autonomous effects.

Our morpholino knockdown experiments also suggest once the pre-placodal region has become established, Foxi3 is dispensable for the maintenance of pre-placodal markers (Fig. 7B). Taken together, our results suggest that the induction of the pre-placodal region is regulated by the combined action of a cohort of different transcription factors, each of which may be sufficient to directly or indirectly induce other members, but which may be individually redundant once the PPR has formed.

Foxi3 and the response to FGF in otic placode induction

We have previously shown that competence to respond to FGF signaling by expressing otic placode genes is restricted to pre-placodal ectoderm (Martin and Groves, 2006). PPR ectoderm can express otic placode markers after culturing in FGF2, whereas other populations of ectoderm from embryos of the same age cannot. Furthermore, non-competent ectoderm can acquire competence to respond to FGF2 in these culture assays if first grafted into the PPR for a sufficient period of time to up-regulate PPR genes (Martin and Groves, 2006). To date, however, the molecular basis of such competence is not clear. Co-expression of Six1 and Eya2 in non-neural ectoderm cannot confer competence to express Pax2 in response to FGF2 (Christophorou et al., 2009). Zebrafish foxi1 has been reported to confer competence for otic placode induction in response to FGF signaling (Hans et al., 2007; Hans and Westerfield, 2007), but this effect was only seen following treatment with retinoic acid, and was not seen reproducibly in untreated ectoderm alone (Hans et al., 2007; Hans and Westerfield, 2007).

In the present study, ectopic expression of Foxi3 in either anterior epiblast or ectoderm lateral to the PPR was not sufficient to confer competence on this ectoderm to respond to FGF by inducing early otic markers such as Pax2 (Fig. 6). We also found that Foxi3 was unable to confer competence in this assay when co-expressed with the definitive PPR transcription factors Six1 and Eya2 and the non-neural ectoderm gene Dlx5 (Supplementary Fig. 1). Recent work in zebrafish suggests that foxi1 can act together with gata3, tfap2a and tfap2c to promote formation of pre-placodal ectoderm (Kwon et al., 2010; Bhat et al., 2013). However, co-expression of Foxi3 with Gata3 and Ap2α was again unable to confer competence to respond to FGF2 in our culture assay (Supplementary Fig. 2). It is therefore likely that other factors are required in addition to the current repertoire of transcription factors known to be expressed in the PPR.

Despite the fact that activation of Foxi3 alone or with other PPR factors cannot confer competence to respond to FGF2 in our otic induction assays, we have shown that morpholino knockdown of Foxi3 is able to block the induction of the early otic markers Pax2 and Foxg1 in intact embryos (Fig. 4B). Moreover, knockdown of Foxi3 in PPR ectoderm isolated from the presumptive trigeminal region can significantly reduce the induction of Pax2 in these explants when cultured in FGF2 (Fig. 5B, C). Chick Foxi3, like zebrafish foxi1 (Nissen et al., 2003; Solomon et al., 2003) is thus necessary for otic induction. However, based on its expression pattern, Foxi3 could act at several stages in otic induction: the specification of non-neural ectoderm, the induction of PPR ectoderm, mediating the FGF signaling cascade or in the induction of otic markers after reception of the FGF signal. Our morpholino results suggest that Foxi3 is necessary for the induction of otic placode genes in PPR ectoderm at a time after exposure to FGF (Figure 4), but that it is not necessary for the expression of PPR genes per se, nor for the reception or transmission of FGF signals in PPR ectoderm (Figure 7). However, we would caution that since these chick knockdown experiments were performed coincident with, or slightly after the initial induction of Foxi3 in early gastrula ectoderm rather than from the very start of development, it is formally possible that we introduced Foxi3 morpholinos into embryonic ectoderm too late to affect the induction of the PPR. We are currently characterizing Foxi3 mutant mice generated in our lab, and these null mice will allow us to determine if the PPR still develops in the complete absence of Foxi3.

At present, we do not know whether Foxi3 functions directly in concert with factors downstream of FGF signaling to induce otic placode genes, or is acting independently of FGF signaling. Binding motifs for the FGF-responsive Ets transcription factor family have been identified in a small number of otic enhancers (Betancur et al., 2011), but further studies are required to determine whether Foxi3 participates in the formation of FGF-dependent transcriptional complexes at otic gene enhancers. An alternative possibility is raised by the observation that a number of Forkhead family transcription factors such as Foxa1, Foxa2, and Foxd3, bind to target sites in chromatin at early developmental stages, remain bound to DNA during division, and remodel chromatin to prepare for the activation of lineage-specific genes later in development. Such factors have been described as “pioneer factors” (Caravaca et al., 2013; Ram and Meshorer, 2009; Zaret and Carroll, 2011; Zaret et al., 2008). Since Foxi3 is expressed from an early stage in non-neural ectoderm and pre-placodal ectoderm in amniotes, but is not genetically necessary for otic placode formation until a time after the transduction of FGF signals, it is possible that it can act as a pioneer factor. Indeed, zebrafish foxi1 has been shown to bind widely to chromatin in cultured cells, to remain bound to DNA throughout the cell cycle and to regulate chromatin accessibility to DNAseI (Yan et al., 2006). While suggestive of a potential role for Foxi genes as pioneer factors during development, further experiments will nevertheless be necessary to determine whether Foxi1 and Foxi3 act as early pioneer factors for the otic lineage during inner ear induction.

Supplementary Material

01. Supplementary Figure 1. Co-expression of Foxi3 along with neural plate border genes is not sufficient to confer competence to respond to FGF signaling in non-neural ectoderm.

(A): Diagram showing electroporation of anterior epiblast (stage HH3-4 embryos) with Foxi3+Six1+Eya2+Dlx5 or Foxi3+GATA3+Ap2 expression constructs. After a brief period of culture, GFP+ ectoderm was dissected and cultured +/− FGF2 for 24 hours. The explants were then stained with antibodies to GFP (shown in green), Pax2 (shown in red) and counterstained with DAPI (blue) (B): Pax2 is not induced in anterior epiblast expressing Foxi3+Six1+Eya2+Dlx5 and treated with FGF2. (C): Pax2 is not induced in anterior epiblast expressing Foxi3+GATA3+Ap2 and treated with FGF2. Pax2 is shown in red, GFP in green and DAPI nuclei in blue.

02. Supplementary Figure 2. The FGF-responsive transcription factor Pea3 is up-regulated in presumptive trigeminal ectoderm cultured in FGF2.

Pieces of presumptive trigeminal ectoderm from 0–4ss stage embryos were cultured in the presence or absence of 50ng/ml FGF2 for 24 hours and processed for in situ hybridization with probes for Pea3. FGF2 treatment up-regulated Pea3 expression (lower panel) compared to untreated controls (upper panel).

Highlights.

  • Foxi3 is an early marker of non-neural ectoderm and the pre-placodal domain

  • Foxi3 can regulate non-neural ectoderm and pre-placodal transcription factors.

  • Foxi3 is necessary for otic placode induction in response to FGF

  • Foxi3 is not sufficient to confer competence to respond to FGF signaling

Acknowledgments

We thank Michael Kessel, Doug Engel, Berta Alsina, Guillermo Oliver, Paola Bovolenta, Domingos Henrique, Annette Neubüser and Andrea Streit for gifts of probes and cDNA expression constructs. We thank Onur Birol, Huiling Li and Hongyuan Zhang for excellent technical assistance. This work was funded by RO1 DC004675 (A.K.G.), RO1 DC013072 (A.K.G.) and F32 DC011672 (S.B.K.). R.K.E. was supported in part by T32 HD055200.

Abbreviations

HH

Embryonic stage according to the series of Hamburger and Hamilton (1992)

ss

number of pairs of somites

Footnotes

AUTHOR CONTRIBUTIONS

A.K.G. conceived the project; A.K.G and S.B.K. designed the experiments. S.B.K. carried out all experiments, generated the figures and wrote the manuscript. R.K.E. constructed full length mFoxi3 used in Figures 2, 3 and 5. A.K.G. edited the manuscript.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Aghaallaei N, Bajoghli B, Czerny T. Distinct roles of Fgf8, Foxi1, Dlx3b and Pax8/2 during otic vesicle induction and maintenance in medaka. Dev Biol. 2007;307:408–420. doi: 10.1016/j.ydbio.2007.04.022. [DOI] [PubMed] [Google Scholar]
  2. Ahrens K, Schlosser G. Tissues and signals involved in the induction of placodal Six1 expression in Xenopus laevis. Dev Biol. 2005;288:40–59. doi: 10.1016/j.ydbio.2005.07.022. [DOI] [PubMed] [Google Scholar]
  3. Baker CV, Bronner-Fraser M. Vertebrate cranial placodes I. Embryonic induction. Dev Biol. 2001;232:1–61. doi: 10.1006/dbio.2001.0156. [DOI] [PubMed] [Google Scholar]
  4. Betancur P, Sauka-Spengler T, Bronner M. A Sox10 enhancer element common to the otic placode and neural crest is activated by tissue-specific paralogs. Development. 2011;138:3689–3698. doi: 10.1242/dev.057836. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bhat N, Kwon HJ, Riley BB. A gene network that coordinates preplacodal competence and neural crest specification in zebrafish. Dev Biol. 2013;373:107–117. doi: 10.1016/j.ydbio.2012.10.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bottenstein JE, Sato GH. Growth of a rat neuroblastoma cell line in serum-free supplemented medium. Proc Natl Acad Sci U S A. 1979;76:514–517. doi: 10.1073/pnas.76.1.514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Brugmann SA, Pandur PD, Kenyon KL, Pignoni F, Moody SA. Six1 promotes a placodal fate within the lateral neurogenic ectoderm by functioning as both a transcriptional activator and repressor. Development. 2004;131:5871–5881. doi: 10.1242/dev.01516. [DOI] [PubMed] [Google Scholar]
  8. Caravaca JM, Donahue G, Becker JS, He X, Vinson C, Zaret KS. Bookmarking by specific and nonspecific binding of FoxA1 pioneer factor to mitotic chromosomes. Genes Dev. 2013;27:251–260. doi: 10.1101/gad.206458.112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chapman SC, Collignon J, Schoenwolf GC, Lumsden A. Improved method for chick whole-embryo culture using a filter paper carrier. Dev Dyn. 2001;220:284–289. doi: 10.1002/1097-0177(20010301)220:3<284::AID-DVDY1102>3.0.CO;2-5. [DOI] [PubMed] [Google Scholar]
  10. Christophorou NAD, Bailey AP, Hanson S, Streit A. Activation of Six1 target genes is required for sensory placode formation. Dev Biol. 2009;336:327–336. doi: 10.1016/j.ydbio.2009.09.025. [DOI] [PubMed] [Google Scholar]
  11. Collignon J, Sockanathan S, Hacker A, Cohen-Tannoudji M, Norris D, Rastan S, Stevanovic M, Goodfellow PN, Lovell-Badge R. A comparison of the properties of Sox-3 with Sry and two related genes, Sox-1 and Sox-2. Development. 1996;122:509–520. doi: 10.1242/dev.122.2.509. [DOI] [PubMed] [Google Scholar]
  12. D’Amico-Martel A, Noden DM. Contributions of placodal and neural crest cells to avian cranial peripheral ganglia. Am J Anat. 1983;166:445–468. doi: 10.1002/aja.1001660406. [DOI] [PubMed] [Google Scholar]
  13. Freter S, Muta Y, Mak SS, Rinkwitz S, Ladher RK. Progressive restriction of otic fate: the role of FGF and Wnt in resolving inner ear potential. Development. 2008;135:3415–3424. doi: 10.1242/dev.026674. [DOI] [PubMed] [Google Scholar]
  14. Grocott T, Tambalo M, Streit A. The peripheral sensory nervous system in the vertebrate head: a gene regulatory perspective. Dev Biol. 2012;370:3–23. doi: 10.1016/j.ydbio.2012.06.028. [DOI] [PubMed] [Google Scholar]
  15. Groves AK, Bronner-Fraser M. Competence, specification and commitment in otic placode induction. Development. 2000;127:3489–3499. doi: 10.1242/dev.127.16.3489. [DOI] [PubMed] [Google Scholar]
  16. Groves AK, Labonne C. Setting appropriate boundaries: Fate, patterning and competence at the neural plate border. Dev Biol. 2013 doi: 10.1016/j.ydbio.2013.11.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hamburger V, Hamilton HL. A series of normal stages in the development of the chick embryo 1951. Dev Dyn. 1992;195:231–272. doi: 10.1002/aja.1001950404. [DOI] [PubMed] [Google Scholar]
  18. Hans S, Christison J, Liu D, Westerfield M. Fgf-dependent otic induction requires competence provided by Foxi1 and Dlx3b. BMC Dev Biol. 2007;7:5. doi: 10.1186/1471-213X-7-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hans S, Westerfield M. Changes in retinoic acid signaling alter otic patterning. Development. 2007;134:2449–2458. doi: 10.1242/dev.000448. [DOI] [PubMed] [Google Scholar]
  20. Hong CS, Saint-Jeannet JP. The activity of Pax3 and Zic1 regulates three distinct cell fates at the neural plate border. Mol Biol Cell. 2007;18:2192–2202. doi: 10.1091/mbc.E06-11-1047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Jayasena CS, Ohyama T, Segil N, Groves AK. Notch signaling augments the canonical Wnt pathway to specify the size of the otic placode. Development. 2008;135:2251–2261. doi: 10.1242/dev.017905. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kenyon KL, Moody SA, Jamrich M. A novel fork head gene mediates early steps during Xenopus lens formation. Development. 1999;126:5107–5116. doi: 10.1242/dev.126.22.5107. [DOI] [PubMed] [Google Scholar]
  23. Khatri SB, Groves AK. Expression of the Foxi2 and Foxi3 transcription factors during development of chicken sensory placodes and pharyngeal arches. Gene Expr Patterns. 2013;13:38–42. doi: 10.1016/j.gep.2012.10.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kwon HJ, Bhat N, Sweet EM, Cornell RA, Riley BB. Identification of early requirements for preplacodal ectoderm and sensory organ development. PLoS Genet. 2010;6 doi: 10.1371/journal.pgen.1001133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Ladher RK, Anakwe KU, Gurney AL, Schoenwolf GC, Francis-West PH. Identification of synergistic signals initiating inner ear development. Science. 2000;290:1965–1967. doi: 10.1126/science.290.5498.1965. [DOI] [PubMed] [Google Scholar]
  26. Ladher RK, O’Neill P, Begbie J. From shared lineage to distinct functions: the development of the inner ear and epibranchial placodes. Development. 2010;137:1777–1785. doi: 10.1242/dev.040055. [DOI] [PubMed] [Google Scholar]
  27. Lee CS, Friedman JR, Fulmer JT, Kaestner KH. The initiation of liver development is dependent on Foxa transcription factors. Nature. 2005a;435:944–947. doi: 10.1038/nature03649. [DOI] [PubMed] [Google Scholar]
  28. Lee CS, Sund NJ, Behr R, Herrera PL, Kaestner KH. Foxa2 is required for the differentiation of pancreatic alpha-cells. Dev Biol. 2005b;278:484–495. doi: 10.1016/j.ydbio.2004.10.012. [DOI] [PubMed] [Google Scholar]
  29. Leger S, Brand M. Fgf8 and Fgf3 are required for zebrafish ear placode induction, maintenance and inner ear patterning. Mech Dev. 2002;119:91–108. doi: 10.1016/s0925-4773(02)00343-x. [DOI] [PubMed] [Google Scholar]
  30. Leung AW, Kent Morest D, Li JY. Differential BMP signaling controls formation and differentiation of multipotent preplacodal ectoderm progenitors from human embryonic stem cells. Dev Biol. 2013;379:208–220. doi: 10.1016/j.ydbio.2013.04.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Litsiou A, Hanson S, Streit A. A balance of FGF, BMP and WNT signalling positions the future placode territory in the head. Development. 2005;132:4051–4062. doi: 10.1242/dev.01964. [DOI] [PubMed] [Google Scholar]
  32. Liu D, Chu H, Maves L, Yan YL, Morcos PA, Postlethwait JH, Westerfield M. Fgf3 and Fgf8 dependent and independent transcription factors are required for otic placode specification. Development. 2003;130:2213–2224. doi: 10.1242/dev.00445. [DOI] [PubMed] [Google Scholar]
  33. Maroon H, Walshe J, Mahmood R, Kiefer P, Dickson C, Mason I. Fgf3 and Fgf8 are required together for formation of the otic placode and vesicle. Development. 2002;129:2099–2108. doi: 10.1242/dev.129.9.2099. [DOI] [PubMed] [Google Scholar]
  34. Martin K, Groves AK. Competence of cranial ectoderm to respond to Fgf signaling suggests a two-step model of otic placode induction. Development. 2006;133:877–887. doi: 10.1242/dev.02267. [DOI] [PubMed] [Google Scholar]
  35. McLarren KW, Litsiou A, Streit A. DLX5 positions the neural crest and preplacode region at the border of the neural plate. Dev Biol. 2003;259:34–47. doi: 10.1016/s0012-1606(03)00177-5. [DOI] [PubMed] [Google Scholar]
  36. Mendonsa ES, Riley BB. Genetic analysis of tissue interactions required for otic placode induction in the zebrafish. Dev Biol. 1999;206:100–112. doi: 10.1006/dbio.1998.9134. [DOI] [PubMed] [Google Scholar]
  37. Nechiporuk A, Linbo T, Poss KD, Raible DW. Specification of epibranchial placodes in zebrafish. Development. 2007;134:611–623. doi: 10.1242/dev.02749. [DOI] [PubMed] [Google Scholar]
  38. Nikaido M, Doi K, Shimizu T, Hibi M, Kikuchi Y, Yamasu K. Initial specification of the epibranchial placode in zebrafish embryos depends on the fibroblast growth factor signal. Dev Dyn. 2007;236:564–571. doi: 10.1002/dvdy.21050. [DOI] [PubMed] [Google Scholar]
  39. Nissen RM, Yan J, Amsterdam A, Hopkins N, Burgess SM. Zebrafish foxi one modulates cellular responses to Fgf signaling required for the integrity of ear and jaw patterning. Development. 2003;130:2543–2554. doi: 10.1242/dev.00455. [DOI] [PubMed] [Google Scholar]
  40. Noden DM. Spatial integration among cells forming the cranial peripheral nervous system. J Neurobiol. 1993;24:248–261. doi: 10.1002/neu.480240210. [DOI] [PubMed] [Google Scholar]
  41. Ohyama T, Groves AK. Expression of mouse Foxi class genes in early craniofacial development. Dev Dyn. 2004;231:640–646. doi: 10.1002/dvdy.20160. [DOI] [PubMed] [Google Scholar]
  42. Ohyama T, Groves AK, Martin K. The first steps towards hearing: mechanisms of otic placode induction. Int J Dev Biol. 2007;51:463–472. doi: 10.1387/ijdb.072320to. [DOI] [PubMed] [Google Scholar]
  43. Patthey C, Gunhaga L. Specification and regionalisation of the neural plate border. Eur J Neurosci. 2011;34:1516–1528. doi: 10.1111/j.1460-9568.2011.07871.x. [DOI] [PubMed] [Google Scholar]
  44. Patthey C, Gunhaga L. Signaling pathways regulating ectodermal cell fate choices. Exp Cell Res. 2013 doi: 10.1016/j.yexcr.2013.08.002. [DOI] [PubMed] [Google Scholar]
  45. Pera E, Kessel M. Expression of DLX3 in chick embryos. Mech Dev. 1999;89:189–193. doi: 10.1016/s0925-4773(99)00207-5. [DOI] [PubMed] [Google Scholar]
  46. Pera E, Stein S, Kessel M. Ectodermal patterning in the avian embryo: epidermis versus neural plate. Development. 1999;126:63–73. doi: 10.1242/dev.126.1.63. [DOI] [PubMed] [Google Scholar]
  47. Phillips BT, Bolding K, Riley BB. Zebrafish fgf3 and fgf8 encode redundant functions required for otic placode induction. Dev Biol. 2001;235:351–365. doi: 10.1006/dbio.2001.0297. [DOI] [PubMed] [Google Scholar]
  48. Phillips BT, Storch EM, Lekven AC, Riley BB. A direct role for Fgf but not Wnt in otic placode induction. Development. 2004;131:923–931. doi: 10.1242/dev.00978. [DOI] [PubMed] [Google Scholar]
  49. Pieper M, Ahrens K, Rink E, Peter A, Schlosser G. Differential distribution of competence for panplacodal and neural crest induction to non-neural and neural ectoderm. Development. 2012;139:1175–1187. doi: 10.1242/dev.074468. [DOI] [PubMed] [Google Scholar]
  50. Ram EV, Meshorer E. Transcriptional competence in pluripotency. Genes Dev. 2009;23:2793–2798. doi: 10.1101/gad.1881609. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Rex M, Orme A, Uwanogho D, Tointon K, Wigmore PM, Sharpe PT, Scotting PJ. Dynamic expression of chicken Sox2 and Sox3 genes in ectoderm induced to form neural tissue. Dev Dyn. 1997;209:323–332. doi: 10.1002/(SICI)1097-0177(199707)209:3<323::AID-AJA7>3.0.CO;2-K. [DOI] [PubMed] [Google Scholar]
  52. Rogers N, Cheah PS, Szarek E, Banerjee K, Schwartz J, Thomas P. Expression of the murine transcription factor SOX3 during embryonic and adult neurogenesis. Gene Expr Patterns. 2013;13:240–248. doi: 10.1016/j.gep.2013.04.004. [DOI] [PubMed] [Google Scholar]
  53. Saint-Jeannet JP, Moody SA. Establishing the pre-placodal region and breaking it into placodes with distinct identities. Dev Biol. 2014 doi: 10.1016/j.ydbio.2014.02.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Sato S, Ikeda K, Shioi G, Ochi H, Ogino H, Yajima H, Kawakami K. Conserved expression of mouse Six1 in the pre-placodal region (PPR) and identification of an enhancer for the rostral PPR. Dev Biol. 2010;344:158–171. doi: 10.1016/j.ydbio.2010.04.029. [DOI] [PubMed] [Google Scholar]
  55. Schimmang T. Expression and functions of FGF ligands during early otic development. Int J Dev Biol. 2007;51:473–481. doi: 10.1387/ijdb.072334ts. [DOI] [PubMed] [Google Scholar]
  56. Schlosser G. Evolutionary origins of vertebrate placodes: insights from developmental studies and from comparisons with other deuterostomes. J Exp Zool B Mol Dev Evol. 2005;304:347–399. doi: 10.1002/jez.b.21055. [DOI] [PubMed] [Google Scholar]
  57. Schlosser G. Induction and specification of cranial placodes. Dev Biol. 2006;294:303–351. doi: 10.1016/j.ydbio.2006.03.009. [DOI] [PubMed] [Google Scholar]
  58. Schlosser G. How old genes make a new head: redeployment of Six and Eya genes during the evolution of vertebrate cranial placodes. Integr Comp Biol. 2007;47:343–359. doi: 10.1093/icb/icm031. [DOI] [PubMed] [Google Scholar]
  59. Schlosser G. Do vertebrate neural crest and cranial placodes have a common evolutionary origin? Bioessays. 2008;30:659–672. doi: 10.1002/bies.20775. [DOI] [PubMed] [Google Scholar]
  60. Schlosser G. Making senses development of vertebrate cranial placodes. Int Rev Cell Mol Biol. 2010;283:129–234. doi: 10.1016/S1937-6448(10)83004-7. [DOI] [PubMed] [Google Scholar]
  61. Sechrist J, Marcelle C. Cell division and differentiation in avian embryos: techniques for study of early neurogenesis and myogenesis. Methods Cell Biol. 1996;51:301–329. doi: 10.1016/s0091-679x(08)60635-4. [DOI] [PubMed] [Google Scholar]
  62. Selleck MA, Bronner-Fraser M. Origins of the avian neural crest: the role of neural plate-epidermal interactions. Development. 1995;121:525–538. doi: 10.1242/dev.121.2.525. [DOI] [PubMed] [Google Scholar]
  63. Sheng G, Stern CD. Gata2 and Gata3: novel markers for early embryonic polarity and for non-neural ectoderm in the chick embryo. Mech Dev. 1999;87:213–216. doi: 10.1016/s0925-4773(99)00150-1. [DOI] [PubMed] [Google Scholar]
  64. Solomon KS, Kudoh T, Dawid IB, Fritz A. Zebrafish foxi1 mediates otic placode formation and jaw development. Development. 2003;130:929–940. doi: 10.1242/dev.00308. [DOI] [PubMed] [Google Scholar]
  65. Streit A. Early development of the cranial sensory nervous system: from a common field to individual placodes. Dev Biol. 2004;276:1–15. doi: 10.1016/j.ydbio.2004.08.037. [DOI] [PubMed] [Google Scholar]
  66. Streit A. The preplacodal region: an ectodermal domain with multipotential progenitors that contribute to sense organs and cranial sensory ganglia. Int J Dev Biol. 2007;51:447–461. doi: 10.1387/ijdb.072327as. [DOI] [PubMed] [Google Scholar]
  67. Streit A, Berliner AJ, Papanayotou C, Sirulnik A, Stern CD. Initiation of neural induction by FGF signalling before gastrulation. Nature. 2000;406:74–78. doi: 10.1038/35017617. [DOI] [PubMed] [Google Scholar]
  68. Urness LD, Paxton CN, Wang X, Schoenwolf GC, Mansour SL. FGF signaling regulates otic placode induction and refinement by controlling both ectodermal target genes and hindbrain Wnt8a. Dev Biol. 2010;340:595–604. doi: 10.1016/j.ydbio.2010.02.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Uwanogho D, Rex M, Cartwright EJ, Pearl G, Healy C, Scotting PJ, Sharpe PT. Embryonic expression of the chicken Sox2, Sox3 and Sox11 genes suggests an interactive role in neuronal development. Mech Dev. 1995;49:23–36. doi: 10.1016/0925-4773(94)00299-3. [DOI] [PubMed] [Google Scholar]
  70. Vendrell V, Carnicero E, Giraldez F, Alonso MT, Schimmang T. Induction of inner ear fate by FGF3. Development. 2000;127:2011–2019. doi: 10.1242/dev.127.10.2011. [DOI] [PubMed] [Google Scholar]
  71. Wandzioch E, Zaret KS. Dynamic signaling network for the specification of embryonic pancreas and liver progenitors. Science. 2009;324:1707–1710. doi: 10.1126/science.1174497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Woda JM, Pastagia J, Mercola M, Artinger KB. Dlx proteins position the neural plate border and determine adjacent cell fates. Development. 2003;130:331–342. doi: 10.1242/dev.00212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Wright TJ, Mansour SL. Fgf3 and Fgf10 are required for mouse otic placode induction. Development. 2003;130:3379–3390. doi: 10.1242/dev.00555. [DOI] [PubMed] [Google Scholar]
  74. Yan J, Xu L, Crawford G, Wang Z, Burgess SM. The forkhead transcription factor FoxI1 remains bound to condensed mitotic chromosomes and stably remodels chromatin structure. Mol Cell Biol. 2006;26:155–168. doi: 10.1128/MCB.26.1.155-168.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Yang L, O’Neill P, Martin K, Maass JC, Vassilev V, Ladher R, Groves AK. Analysis of FGF-dependent and FGF-independent pathways in otic placode induction. PLoS One. 2013;8:e55011. doi: 10.1371/journal.pone.0055011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Zaret K. Developmental competence of the gut endoderm: genetic potentiation by GATA and HNF3/fork head proteins. Dev Biol. 1999;209:1–10. doi: 10.1006/dbio.1999.9228. [DOI] [PubMed] [Google Scholar]
  77. Zaret KS, Carroll JS. Pioneer transcription factors: establishing competence for gene expression. Genes Dev. 2011;25:2227–2241. doi: 10.1101/gad.176826.111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Zaret KS, Watts J, Xu J, Wandzioch E, Smale ST, Sekiya T. Pioneer factors, genetic competence, and inductive signaling: programming liver and pancreas progenitors from the endoderm. Cold Spring Harb Symp Quant Biol. 2008;73:119–126. doi: 10.1101/sqb.2008.73.040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Zou D, Silvius D, Fritzsch B, Xu PX. Eya1 and Six1 are essential for early steps of sensory neurogenesis in mammalian cranial placodes. Development. 2004;131:5561–5572. doi: 10.1242/dev.01437. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01. Supplementary Figure 1. Co-expression of Foxi3 along with neural plate border genes is not sufficient to confer competence to respond to FGF signaling in non-neural ectoderm.

(A): Diagram showing electroporation of anterior epiblast (stage HH3-4 embryos) with Foxi3+Six1+Eya2+Dlx5 or Foxi3+GATA3+Ap2 expression constructs. After a brief period of culture, GFP+ ectoderm was dissected and cultured +/− FGF2 for 24 hours. The explants were then stained with antibodies to GFP (shown in green), Pax2 (shown in red) and counterstained with DAPI (blue) (B): Pax2 is not induced in anterior epiblast expressing Foxi3+Six1+Eya2+Dlx5 and treated with FGF2. (C): Pax2 is not induced in anterior epiblast expressing Foxi3+GATA3+Ap2 and treated with FGF2. Pax2 is shown in red, GFP in green and DAPI nuclei in blue.

NIHMS591212-supplement-01.tif (2MB, tif)
02. Supplementary Figure 2. The FGF-responsive transcription factor Pea3 is up-regulated in presumptive trigeminal ectoderm cultured in FGF2.

Pieces of presumptive trigeminal ectoderm from 0–4ss stage embryos were cultured in the presence or absence of 50ng/ml FGF2 for 24 hours and processed for in situ hybridization with probes for Pea3. FGF2 treatment up-regulated Pea3 expression (lower panel) compared to untreated controls (upper panel).

NIHMS591212-supplement-02.tif (2.3MB, tif)

RESOURCES