To facilitate development of therapies that target leukemic stem/progenitor cells (LPCs), in vitro ways to enhance the survival and immunogenicity of a patient's CD34+ acute myeloid leukemia (AML) cells were explored. RepSox was identified as a candidate cell-engineering tool because it slows in vitro decay of CD34+ AML cells (which often contain LPCs) and accelerates loss of the immune checkpoint receptor T cell immunoglobulin mucin-3 (Tim-3).
Keywords: Acute myeloid leukemia, Cancer stem cells, Immunotherapy, Immunogenicity, Tim-3, CD34+
Abstract
Despite initial response to therapy, most acute myeloid leukemia (AML) patients relapse. To eliminate relapse-causing leukemic stem/progenitor cells (LPCs), patient-specific immune therapies may be required. In vitro cellular engineering may require increasing the “stemness” or immunogenicity of tumor cells and activating or restoring cancer-impaired immune-effector and antigen-presenting cells. Leukapheresis samples provide the cells needed to engineer therapies: LPCs to be targeted, normal hematopoietic stem cells to be spared, and cancer-impaired immune cells to be repaired and activated. This study sought to advance development of LPC-targeted therapies by exploring nongenetic ways to slow the decay and to increase the immunogenicity of primary CD34+ AML cells. CD34+ AML cells generally displayed more colony-forming and aldehyde dehydrogenase activity than CD34− AML cells. Along with exposure to bone marrow stromal cells and low (1%–5%) oxygen, culture with RepSox (a reprogramming tool and inhibitor of transforming growth factor-β receptor 1) consistently slowed decline of CD34+ AML and myelodysplastic syndrome (MDS) cells. RepSox-treated AML cells displayed higher CD34, CXCL12, and MYC mRNA levels than dimethyl sulfoxide-treated controls. RepSox also accelerated loss of T cell immunoglobulin mucin-3 (Tim-3), an immune checkpoint receptor that impairs antitumor immunity, from the surface of AML and MDS cells. Our results suggest RepSox may reduce Tim-3 expression by inhibiting transforming growth factor-β signaling and slow decay of CD34+ AML cells by increasing CXCL12 and MYC, two factors that inhibit AML cell differentiation. By prolonging survival of CD34+ AML cells and reducing Tim-3, RepSox may promote in vitro immune cell activation and advance development of LPC-targeted therapies.
Introduction
Leukemic stem/progenitor cells (LPCs) are believed to sustain disease, to persist after chemotherapy and radiation, and to contribute to post-treatment relapses. In any given acute myeloid leukemia (AML) patient, these disease-causing cells may encompass a distribution of diverse immunophenotypes that evolves as disease progresses. Over time, leukemia disrupts the bone marrow (BM), suppresses the immune system, and evolves new “immune-escape” and “growth-advantaged” variants [1, 2]. AML LPCs are often distinctive at the molecular level because of high levels of T cell immunoglobulin mucin-3 (Tim-3) [3, 4] and antiapoptotic factors [5] and low immunogenicity [6]. In the setting of minimal residual disease (MRD), immunotherapy may be needed to eliminate quiescent LPCs spared by conventional therapies. Prompt treatment [7] with antibodies, inhibitors of antiapoptotic factors, and/or immune cells that target LPCs while sparing normal hematopoietic stem cells (HSCs) should improve AML patient survival, especially when combined with immune-modulating strategies and chemotherapies that cause immunogenic tumor cell death.
Regarding development of patient-specific LPC-targeted therapies, recent technical advances are encouraging. Notably, immune cell activity, which is impaired by leukemic disease states, can be restored in patients after their immune cells have been manipulated in vitro [8, 9]. When treated with their own custom-engineered T cells, leukemia patients rapidly entered remission and remain disease-free because of the generation of long-lived memory T cells [8, 9]. Because their T cells were genetically engineered against all CD19+ cells, both normal and leukemic B cells were eliminated. Although tumor cells initially trigger an immune response [10], they suppress immune cell activity by engaging coinhibitory receptors including Tim-3, programmed cell death protein 1 (PD-1), and cytotoxic T-lymphocyte-associated antigen 4 (CTLA4) and by secreting immunosuppressive factors such as transforming growth factor-β (TGF-β) [11]. Fortunately, cancer-impaired immune cells can be repaired and activated in vitro [12] and in vivo, without genetic engineering, as demonstrated by potent stimulation of tumor-reactive T cells in metastatic melanoma patients treated with ipilimumab to block CTLA4 [13].
In the setting of AML, Glaser and colleagues [14] have shown that in vitro manipulation of AML cells provides relevant insights and predicts promising therapeutic effects in vivo. Furthermore, Noh and colleagues [15] greatly improved survival of mice with colon cancer using a two-pronged immune strategy inspired by in vitro study of tumor cells that were not conventional cancer stem cells (CSCs) but stem-like surrogates. By sensitizing tumor cells to immune-mediated death, adding a Nanog inhibitor to antigen-specific cytotoxic T cell therapy markedly improved efficacy [15]. In the future, in vitro studies of a patient’s tumor and immune cells may help predict the effectiveness of candidate therapies if the diversity of AML subtypes requires patient-specific treatments.
Although LPC surface antigens such as CD123 [16], CD47 [17], and Tim-3 [3, 4] are shared by subsets of AML patients, each patient’s LPCs are genetically unique, and no universal LPC markers have been identified. Thus, patient-specific therapies may be necessary, and some have saved the lives of leukemia patients with no other options [8, 9]. Engineering patient-specific immune therapies may require insight into how similar the primary cells cultured in vitro must be to the LPCs evolving in vivo to serve as relevant therapeutic targets. Presumably, when engineering antibodies and/or activated antigen-specific immune cells, the greater the similarity, the greater the likelihood of efficacy. Although LPCs are continually evolving in vivo, working with stem-like tumor cells (instead of true LPCs) in vitro may be adequate for developing immune therapies because of immunologic cross-reactivity.
Unfortunately, the same LPCs that are hard to eliminate in vivo (MRD cells) are difficult to maintain in vitro. In culture, LPCs tend to rapidly die or differentiate into more mature, less relevant cells with phenotypes that may differ from tumor cells that sustain disease and trigger relapse. For the culture of primitive cancer cells, prior technical advances provide guidance. Physiologic BM oxygen levels (1%–5% O2) [18], hematopoietic cytokines, and BM stromal cells improve survival of AML progenitors [19]. In mammosphere [20] and neurosphere [21] assays, three-dimensional (3-D) architecture helps maintain and expand CSCs, illustrating the diversity of signals that influence CSCs.
To address the challenge of maintaining LPCs in vitro, we initially screened nongenetic factors that might slow decay of CD34+ AML cells. In general, a patient’s CD34+ AML cells may include bona fide disease-causing LPCs [22], primitive AML cells that are similar enough to LPCs to be useful for engineering immune therapies, or AML cells that need to be reprogrammed toward a more stem-like phenotype to serve as relevant therapeutic targets [15, 23]. Unfortunately, a patient’s most recently evolved and lethal disease-causing LPCs may be impossible to identify. Despite an evolving therapeutic target, engineering of patient-specific immune therapies will likely advance by extending in vitro survival of primitive AML cells as well as normal immune cells and HSCs. Prolonging in vitro survival will facilitate exploring how to increase LPC immunogenicity, repair and activate immune cells, improve antigen presentation, and engineer LPC-targeted therapies. Fortunately, prior studies show that in vitro results can predict in vivo effects despite the differences in these environments [13, 14].
To better maintain primary CD34+ AML cells, we screened factors including low O2; coculture with BM stromal cells; and compounds that agglutinate cells, affect TGF-β, or promote stem cell maintenance. Along with low O2 and coculture with BM stromal cells, RepSox, a chemical reprogramming tool [24] and ATP-competitive inhibitor of TGF-β receptor 1 (TGF-βR1) kinase [25], attracted our attention because it slowed decline of CD34+ AML and myelodysplastic syndrome (MDS) cells in culture. Of clinical relevance, CD34+ AML cells often contain disease-causing LPCs that may trigger relapse [22].
Materials and Methods
Human White Blood Cells
Deidentified leukapheresis specimens were obtained from patients treated at the West Virginia University (WVU) Mary Babb Randolph Cancer Center, in accordance with institutional review board guidelines. Human white blood cells (WBCs) were isolated by Ficoll-Paque Plus (Amersham Biosciences, Uppsala, Sweden, http://www.amersham.com) density gradient separation and cryopreserved (5 × 106 cells per ml) in equal volumes of RPMI 1640 medium (Mediatech, Manassas, VA, http://www.cellgro.com)/10% fetal bovine serum (FBS) (Hyclone, Logan, UT, http://www.hyclone.com) and freezing solution (80% FBS/20% dimethyl sulfoxide [DMSO]; Sigma-Aldrich, St. Louis, MO, http://www.sigmaaldrich.com). CD34+ cells isolated from the mobilized peripheral blood of healthy donors were purchased from AllCells (Emeryville, CA, http://www.allcells.com).
Cell Culture
WBCs were cultured in RPMI 1640 medium (Mediatech, Manassas, VA, http://www.cellgro.com) containing 2 mM l-glutamine (Mediatech), 100 U/ml penicillin, 0.1 mg/ml streptomycin (Sigma-Aldrich), and 10% FBS (Hyclone) or serum replacement 1 (Sigma-Aldrich) (also referred to as “serum-free”), as indicated. Cocultures included BM stromal cells, adherent cells isolated from the BM of patients without evidence of hematologic disease. BM stromal cells constitutively express VCAM1, fibronectin, and diverse cytokines that support hematopoietic progenitors, including interleukin-7-dependent pro-B cells [26]. Cells were cultured at 37°C in 6% CO2 and 1%–5% or 21% O2, as noted.
TGF-β Inhibition and Neutralization
TGF-β inhibitors RepSox (E-616452 or SJN 2511; Sigma-Aldrich), SB 431542 (Sigma-Aldrich), LY 364947, and GW 788388 (Tocris Bioscience, Ellisville, MO, http://www.tocris.com) were dissolved in DMSO and added once at initiation of culture. TGF-β neutralizing antibody (anti-TGF-β1, 2, or 3) or matched mouse IgG1 isotype control antibody (R&D Systems Inc., Minneapolis, MN, http://www.rndsystems.com) were reconstituted in phosphate-buffered saline (PBS). Antibodies (10 μg/ml) were added at initiation of culture and subsequently every 3 days.
Surface Immunostaining
WBCs were suspended in 100 μl PBS/1% bovine serum albumin (BSA). Samples were blocked with 1 μg human IgG (R&D Systems Inc.) for 20 minutes at 4°C and incubated with specific or isotype control antibodies for 20 minutes at 4°C in the dark. Samples were rinsed three times with PBS/1% BSA and analyzed by flow cytometry within 4 hours of staining. Specific and matched isotype control antibodies directed against the following human antigens were used: CD34-peridinin chlorophyll protein (PerCP) (Becton, Dickinson and Company, San Jose, CA, http://www.bd.com) and mouse IgG1-PerCP (Dako, Carpinteria, CA, http://www.dako.com); human leukocyte antigens A, B, and C (HLA-ABC)-phycoerythrin (PE) and mouse IgG1, κ-PE; CD47-fluorescein and mouse IgG1, κ-FITC, and CD227/MUC1-FITC and mouse IgG1, κ-FITC (BD Biosciences, San Jose, CA, http://www.bdbiosciences.com); and Tim-3-PE and mouse IgG1, κ-PE (BioLegend, San Diego, CA, http://www.biolegend.com). Of note, Aldefluor-stained cells were immunostained in Aldefluor assay buffer, which contains ATP-binding cassette transport inhibitors, to prevent dye efflux.
Isolation of RNA and Reverse Transcription-Polymerase Chain Reaction
RNA was isolated from AML cells using the RNeasy Mini Kit with on-column DNase I digestion (Qiagen, Valencia, CA, http://www.qiagen.com). One-step reverse transcription-polymerase chain reactions (RT-PCRs) were performed in triplicate using 50 ng of RNA per reaction with the QuantiTect SYBR Green RT-PCR kit (Qiagen) on an Applied Biosystems 7500 thermocycler (Foster City, CA, http://www.appliedbiosystems.com). GUSB served as a loading control. Primers for human CD34, CXCL12, MYC, and HAVCR2 (encoding Tim-3) were purchased from Qiagen. GUSB primers (forward: AAACGATTGCAGGGTTTCAC, reverse: CTCTCGTCGGTGACTGTTCA) were synthesized by Invitrogen (Carlsbad, CA, http://www.invitrogen.com). Fold changes in relative gene expression were calculated using the 2−ΔΔCT method [27].
Carboxyfluorescein Succinimidyl Ester Staining
WBCs were labeled using the CellTrace carboxyfluorescein succinimidyl ester (CFSE) cell proliferation kit (Molecular Probes, Eugene, OR, http://probes.invitrogen.com), according to the manufacturer’s instructions. Briefly, WBCs were incubated with 1 μM CFSE for 10 minutes at 37°C. Staining was quenched using ice-cold media, and cells were rinsed and placed in culture. After 6 days, cells were analyzed by flow cytometry.
Aldefluor Assay
Aldehyde dehydrogenase (ALDH) activity was measured using the Aldefluor assay, according to manufacturer’s instructions (StemCell Technologies, Vancouver, BC, Canada, http://www.stemcell.com). WBCs were suspended in Aldefluor assay buffer and incubated with Aldefluor reagent, a fluorescent substrate of ALDH. An aliquot of each sample was immediately mixed with diethylaminobenzaldehyde (DEAB), a specific inhibitor of ALDH, to serve as a negative control. ALDH+ regions were drawn to exclude >99% of DEAB-treated cells. Samples were incubated for 40 minutes at 37°C and analyzed by flow cytometry within 3 hours of labeling.
Flow Cytometric Analysis
Samples were analyzed by fluorescence-activated cell sorting (FACS) using a Becton, Dickinson and Company FACSCalibur. Data were analyzed using FCS Express software (De Novo Software, Los Angeles, CA, http://www.denovosoftware.com). Dead cells, identified by propidium iodide uptake, were excluded from analysis. The Overton histogram subtraction method was used to calculate the percentage of stained (i.e., CD34+) cells relative to matched isotype controls [28]. Normalized median fluorescence intensity (MFI) was calculated by subtracting the MFI of isotype control antibody-stained cells from the MFI of specific antibody-stained cells.
Immunomagnetic Sorting of CD34+ WBCs
WBCs were cocultured with BM stromal cells under 5% O2 for 4–8 hours after thawing. Following recovery, WBCs were labeled with magnetic beads conjugated to anti-CD34 antibody recognizing the QBEND/10 epitope (Miltenyi Biotec, Bergisch Gladbach, Germany, http://www.miltenyibiotec.com). WBCs were separated using a Miltenyi Biotec autoMACS, according to the manufacturer’s instructions. Purity of cellular fractions was evaluated by flow cytometry following immunostaining with anti-CD34 antibody recognizing the HPCA-2 epitope (Becton, Dickinson and Company).
FACS of Tim-3+ WBCs
WBCs were cocultured with BM stromal cells under 5% O2 for 4–8 hours after thawing. Following recovery, WBCs were stained with anti-Tim-3-PE antibody (BioLegend) and sorted into Tim-3+ and Tim-3− fractions (>88% pure) using a Becton, Dickinson and Company FACSAria and FACSDiva 6.2 software. Tim-3+ cells were gated against matched isotype control antibody-stained cells. Purity of sorted fractions was evaluated by flow cytometry.
Colony-Forming Assays
WBCs were cultured in methylcellulose containing recombinant human stem cell factor (SCF), granulocyte-macrophage colony-stimulating factor, granulocyte colony-stimulating factor (G-CSF), interleukin-3 (IL-3), and erythropoietin (MethoCult Optimum; StemCell Technologies, Vancouver, BC, Canada, http://www.stemcell.com), according to the manufacturer’s instructions. Colony assays, performed in duplicate, were incubated at 37°C in 6% CO2 and 21% O2. Colonies were counted by light microscopy after 14–18 days of culture.
Diff-Quik Staining
To evaluate morphology, WBCs were stained using the Diff-Quik Stain Set (Siemens, Newark, DE, http://www.medical.siemens.com), according to the manufacturer’s instructions. Briefly, slides were sequentially dipped in methanol fixative, a solution of eosin Y, and a solution containing methylene blue and Azure A. Slides were rinsed with deionized water, allowed to dry, and imaged by light microscopy under oil immersion.
Fluorescence In Situ Hybridization
The WVU Hospital Cytogenetics Laboratory analyzed 100–150 interphase cells for t(8;21), t(15;17), inv(16), del(6q23), and 11q23 chromosomal abnormalities by fluorescence in situ hybridization (FISH). Probes were designed by Abbott Molecular (Des Plaines, IL, https://www.abbottmolecular.com).
Statistical Analysis
Differences between groups were compared using paired Student t tests (two-tailed) and considered statistically significant when p < .05. Values are displayed as the mean ± SE. With the exception of FISH, all data are representative of two or more independent experiments.
Results
CD34+ AML/MDS Cells Have Higher Colony-Forming and ALDH Activity Than CD34− Cells
Leukapheresis specimens (supplemental online Table 1) from AML/MDS patients (P1–P8) displayed variable CD34 expression (Fig. 1A). To identify LPC-enriched fractions, we compared the morphology, colony-forming potential, and ALDH activity of CD34+ and CD34− cells. Following immunomagnetic sorting, CD34+ fractions were 75%–99% pure (supplemental online Fig. 1) and shown to be 99%–100% leukemic by FISH (Fig. 1E). CD34+ AML cells (P1) exhibited rounder nuclei and a higher nuclear-to-cytoplasmic ratio than CD34− AML cells (Fig. 1B). CD34+ AML/MDS cells generated 35- to 65-fold more colonies (Fig. 1C) and generally displayed higher ALDH activity (Fig. 1D; supplemental online Fig. 2) than CD34− cells. Of interest, the relapsed AML patient (P2) had the highest proportion (85%) of CD34+ cells with ALDH activity. Colonies generated by CD34+ cells were confirmed to be of leukemic origin by FISH (Fig. 1F). In culture, CD34+ AML/MDS cells gave rise to CD34− cells, whereas CD34− cells remained CD34− (supplemental online Fig. 3). CD34+ cells also expanded by self-renewal on stimulation with SCF, G-CSF, and IL-3 (supplemental online Fig. 4A). In summary, AML/MDS progenitors are enriched within CD34+ fractions of leukapheresis specimens.
Figure 1.
Enrichment of colony-forming and ALDH+ acute myeloid leukemia and myelodysplastic syndrome cells within CD34+ fractions of leukapheresis specimens. (A): Flow cytometric analysis of CD34 surface expression (open histograms) on white blood cells isolated from leukapheresis specimens. Solid histograms display isotype controls. (B): Diff-Quik staining of CD34+ and CD34− cells (P1). (C): Colony-forming activity of CD34+ and CD34− cells (mean ± high and low counts from duplicate assays). ∗p < .05, 108 ± 29 and 3 ± 1, mean colonies generated by CD34+ and CD34− cells (P1–P4). †Denotes colonies per 1,250 cells. (D): Summary of the ALDH activity of CD34+ and CD34− cells from the representative experiment shown in supplemental online Figure 2 (mean difference was not significant). (E, F): Fluorescence in situ hybridization for leukemic alterations in CD34+ and CD34− cells isolated from leukapheresis specimens as well as colonies generated by CD34+ cells. Abbreviations: ALDH+, aldehyde dehydrogenase-positive; P1–P8, patients 1–8.
RepSox, Low O2, and Coculture With BM Stromal Cells Maintain CD34+ AML Cells
Serum-free medium (Fig. 2A), coculture with BM stromal cells (Fig. 2B), and low (1%–5%) O2 (Fig. 2C) more effectively maintained CD34+ AML cells than serum-containing medium, culture without BM stromal cells, and high (21%) O2. These conditions mimic in vitro assays designed to support LPCs [19] and the BM niche where LPCs reside in vivo [18, 29]. To generate 3-D spheroids, leukemic cells were cocultured with BM stromal cells or osteoblasts on low-attachment plates (supplemental online Fig. 5).
Figure 2.
RepSox, low O2, and coculture with bone marrow (BM) stromal cells maintain CD34+ acute myeloid leukemia (AML) cells. Flow cytometric analysis of CD34 surface expression (open histograms) on AML cells (patient 1) after 10-day culture with 16 μM RepSox or DMSO (vehicle control) in the following conditions: with 10% fetal bovine serum or serum replacement (off stroma, 1% O2) (A), on or off BM stromal cells (serum-free, 1% O2) (B), and under 1% or 21% O2 (on stroma, serum-free) (C). Solid histograms display isotype controls. Abbreviations: DMSO, dimethyl sulfoxide; MFI, median fluorescence intensity.
Under all culture conditions examined, RepSox maintained higher proportions of CD34+ cells than DMSO (Fig. 2A–2C). As expected, RepSox inhibited TGF-β-induced phosphorylation of Smad2/3 (supplemental online Fig. 6). Similar proportions of CD34+ cells were maintained in media and DMSO; therefore, only DMSO controls are shown. In summary, optimal conditions for maintaining CD34+ AML cells include 1%–5% O2, coculture with BM stromal cells, and exposure to RepSox.
RepSox Maintains CD34+ AML Cells in a Concentration-Dependent Manner
Increasing concentrations of RepSox maintained higher proportions of CD34+ AML cells (1.6-fold and 2.3-fold increases in the proportion of CD34+ cells, 2 μM and 16 μM RepSox compared with DMSO) (Fig. 3A, 3B). Enrichment of CD34+ cells plateaued at RepSox concentrations greater than 16 μM (data not shown). Effects on CD34 expression were also concentration-dependent (3.0-fold and 12.5-fold increases in CD34 MFI, respectively, 2 μM and 16 μM RepSox compared with DMSO) (Fig. 3A, 3C).
Figure 3.
RepSox maintains CD34+ acute myeloid leukemia (AML) cells in a concentration-dependent manner. (A): Flow cytometric analysis of CD34 surface expression (open histograms) on AML cells (patient 1) after 10-day culture with 2–16 μM RepSox (on stroma, serum-free, 5% O2) or DMSO (vehicle control). Solid histograms display isotype controls. Summary of the proportion of CD34+ cells (B) and CD34 MFI (C) of RepSox-treated cells relative to DMSO-treated controls from the representative experiment shown in panel A. Abbreviations: DMSO, dimethyl sulfoxide; MFI, median fluorescence intensity.
RepSox Slows Decay of CD34+ AML/MDS Cells
Next we investigated the effects of RepSox on diverse AML/MDS specimens. For consistency, all specimens were cultured with 16 μM RepSox, 10% FBS, BM stromal cells, and 5% O2. Inclusion of serum improved viability, although serum-free conditions more effectively maintained the CD34+ subset of cells.
In culture, the proportion of CD34+ AML/MDS cells declined as cells divided asymmetrically and/or differentiated. Culture with RepSox slowed the mean decline in the proportion of CD34+ cells (33% and 54% mean declines with RepSox and DMSO, respectively; P1–P7) (Fig. 4A, 4B); in other words, RepSox maintained 1.2- to 3.0-fold higher proportions of CD34+ cells than DMSO. RepSox-treated CD34+ cells were confirmed to be of leukemic origin by FISH (Fig. 4C). CD34 expression was also 1.9- to 6.5-fold higher on RepSox-treated cells than DMSO-treated controls (CD34 MFIs of 30 and 9 with RepSox and DMSO, respectively; P1–P7) (Fig. 4A). RepSox did not induce CD34 expression on CD34− AML cells (supplemental online Fig. 3). Unlike RepSox, exposure to the TGF-β inhibitors SB 431542, LY 364947, and GW 788388 (supplemental online Fig. 7A) as well as TGF-β neutralizing antibody (data not shown) did not slow decay of CD34+ AML cells. In contrast to AML/MDS cells, RepSox did not slow decay of CD34+ cells from healthy donors (Fig. 4A, 4B).
Figure 4.
RepSox slows decay of CD34+ acute myeloid leukemia (AML) and myelodysplastic syndrome (MDS) cells. (A): Flow cytometric analysis of CD34 surface expression (open histograms) on HD, AML, and MDS CD34+ cells after 6-day culture with 16 μM RepSox or DMSO (on stroma, 10% fetal bovine serum, 5% O2). Solid histograms display isotype controls. (B): Summary of the decline in proportions of CD34+ cells from the representative experiment shown in panel A. ∗p < .005, 33% ± 7% and 54% ± 7%, mean decline in CD34+ cells following RepSox and DMSO exposure (P1–P7). (C): Fluorescence in situ hybridization for leukemic alterations in CD34+ cells (P1) purified by sorting after 6-day exposure to RepSox and DMSO. (D): CFSE staining profiles of RepSox-treated cells (open histograms) and DMSO-treated cells (solid histograms). Abbreviations: CFSE, carboxyfluorescein succinimidyl ester; DMSO, dimethyl sulfoxide; HD, healthy donor; MFI, median fluorescence intensity; P1–P7, patients 1–7.
We investigated whether RepSox slows decay of CD34+ AML/MDS cells by slowing their rate of asymmetric division and/or by inhibiting their differentiation. RepSox-treated AML cells retained greater CFSE fluorescence (Fig. 4D) and incorporated less 5-ethynyl-2′-deoxyuridine (supplemental online Fig. 8) than DMSO-treated controls, consistent with a slower rate of proliferation. On stimulation with IL-3, SCF, and G-CSF, RepSox-treated CD34+ cells expanded as effectively as DMSO-treated controls (supplemental online Fig. 4A). We also evaluated how RepSox may affect differentiation of CD34+ cells into CD34− AML cells. When cultured with DMSO, the proportion of CD34+ AML cells (P1) decreased as the proportion of CD34−CD33−CD14− cells increased (data not shown). In contrast, RepSox maintained a high proportion of CD34+ cells, and no increase in the proportion of CD34−CD33−CD14− cells was observed (data not shown).
RepSox-Treated AML/MDS Cells Display Higher CD34, CXCL12, and MYC mRNA Levels and Similar ALDH Activity Compared With DMSO-Treated Controls
Both c-Myc and CXCL12 (also known as SDF1) may inhibit differentiation of AML cells [30–33]. RepSox-treated AML cells displayed higher CD34, CXCL12, and MYC mRNA levels than DMSO-treated controls (Fig. 5A). CXCL12 and MYC mRNA levels were substantially higher following exposure to RepSox than the TGF-β inhibitors SB 431542 and LY 364947 (supplemental online Fig. 7C).
Figure 5.
RepSox-treated cells have increased CD34, CXCL12, and MYC mRNA levels and similar ALDH activity compared with DMSO-treated controls. Acute myeloid leukemia (AML) and myelodysplastic syndrome (MDS) cells were cultured with 16 μM RepSox or DMSO for 6 days (on stroma, 10% fetal bovine serum, 5% O2). (A): Quantitative reverse transcription-polymerase chain reaction analysis of CD34 (∗p < .05), CXCL12 (∗p < .05), and MYC (∗p < .005) mRNA levels within RepSox-treated cells relative to DMSO-treated controls. (B): ALDH activity of RepSox- and DMSO-treated CD34+ AML and MDS cells measured by flow cytometry (mean difference was not significant). ALDH+ regions were drawn to exclude >99% of DEAB-treated (negative control) cells. Abbreviations: ALDH, aldehyde dehydrogenase; DEAB, diethylaminobenzaldehyde; DMSO, dimethyl sulfoxide; P1–P5, patients 1–5.
ALDH is involved in chemotherapy resistance [34] and normal HSC self-renewal [35]. In AML patients, the subset of CD34+ cells with ALDH activity is enriched in long-term culture-initiating cells [36]. Furthermore, persistence of CD34+CD38−ALDHint AML cells after induction chemotherapy is associated with disease relapse [37]. Given this clinical relevance, we explored whether RepSox-treated CD34+ cells retain ALDH activity. Similar proportions of RepSox- and DMSO-treated CD34+ cells (gated, as shown in supplemental online Fig. 9) displayed ALDH activity (Fig. 5B), demonstrating that RepSox equally slows decay of ALDH+ and ALDH− subsets of CD34+ cells. Overall, a subset of CD34+ cells with ALDH activity is maintained in our culture system. The observed pattern of ALDH activity is characteristic of LPCs rather than normal stem/progenitor cells [38].
RepSox Reversibly Suppresses AML Colony-Forming Activity
In addition to CD34 expression and ALDH activity, we compared the colony-forming activity (CFA) of RepSox- and DMSO-treated AML/MDS cells. Normal and AML CD34+ cells generated fewer colonies after 6-day culture with RepSox than with DMSO (Fig. 6A). RepSox did not alter the low CFA of CD34− AML/MDS cells (data not shown). Normal and AML CD34+ cells also generated fewer colonies when RepSox, compared with DMSO, was included within the colony-forming assay (Fig. 6B). In contrast, CD34+ MDS cells generated more colonies when RepSox, compared with DMSO, was included within the colony-forming assay (Fig. 6B).
Figure 6.
RepSox reversibly suppresses acute myeloid leukemia (AML) colony-forming activity (CFA). (A): CFA of AML and HD CD34+ cells after 6-day culture with 16 μM RepSox or DMSO (on stroma, 10% fetal bovine serum, 5% O2). Mean difference between CFA of RepSox- and DMSO-treated AML cells was not significant (NS). (B): CFA of AML, myelodysplastic syndrome, and HD CD34+ cells grown with 16 μM RepSox or DMSO included in the colony-forming assay (added once during initiation). Mean difference between CFA of RepSox- and DMSO-treated AML cells was NS. (C): CFA of AML cells (P2) following continuous culture with RepSox for 6 days and removal of RepSox after 3 days. Bar graphs display mean colonies ± high and low counts from duplicate assays. Abbreviations: CFU, colony-forming units; DMSO, dimethyl sulfoxide; HD, healthy donor; P1–P3, patients 1–3; Tim-3, T cell immunoglobulin mucin-3.
Potential reasons for the reduced CFA of AML cells after RepSox exposure include death, differentiation, or arrest of colony-forming cells in a quiescent stem-like state. To rule out RepSox-induced death or differentiation of colony-forming cells, we measured CFA following RepSox removal. Removal of RepSox partially rescued AML CFA (Fig. 6C).
RepSox Decreases Tim-3 Expression on AML/MDS Cells
Increasing tumor cell immunogenicity is one strategy to improve immune cell activation [6]. Consequently, we investigated whether RepSox altered expression of immunomodulatory receptors including Tim-3, CD47, human leukocyte antigens, and MUC1 on AML/MDS cells. HAVCR2 (Tim-3) mRNA levels were consistently reduced in RepSox-treated AML cells compared with DMSO-treated controls (Fig. 7A). A smaller proportion of RepSox-treated CD34+ cells expressed Tim-3, a negative regulator of antitumor immunity [39], than DMSO-treated CD34+ cells (means of 27% and 53% Tim-3+ cells with RepSox and DMSO, respectively; P2 and P3) (Fig. 7B). To determine whether RepSox promoted selective survival of Tim-3− cells or decreased Tim-3 expression, Tim-3+ and Tim-3− fractions were separately exposed to RepSox. Tim-3+ cells converted to Tim-3− cells in vitro (Fig. 7C). RepSox accelerated loss of Tim-3 from the surface of FACS-purified Tim-3+ AML/MDS cells (mean declines in Tim-3+ cells of 64% and 43% with RepSox and DMSO, respectively; P2, P3, and P8) (Fig. 7 C). A greater proportion of MDS cells expressed Tim-3 following removal from RepSox (supplemental online Fig. 10A) compared with continuous culture with RepSox (supplemental online Fig. 10B); this finding suggests that Tim-3 effects are partially reversible. Exposure to both RepSox and the structurally distinct TGF-β inhibitor SB 431542 [40] accelerated loss of Tim-3 from the surface of AML/MDS cells (mean declines in Tim-3+ cells of 81% and 53% with SB 431542 and DMSO, respectively; in P3 and P8) without altering viability relative to DMSO controls (supplemental online Fig. 11). Expression of CD47 and HLA-ABC was not affected by RepSox, whereas MUC1, an antigen contributing to the poor immunogenicity of AML LPCs [41], was not highly expressed by AML/MDS cells (supplemental online Fig. 12).
Figure 7.
RepSox decreases Tim-3 expression on acute myeloid leukemia (AML) and myelodysplastic syndrome (MDS) cells. AML and MDS cells were cultured with 16 μM RepSox or DMSO for 6 days (on stroma, 10% fetal bovine serum [FBS], 5% O2). (A): Quantitative reverse transcription-polymerase chain reaction analysis of HAVCR2 (Tim-3) mRNA levels within RepSox-treated cells relative to DMSO-treated controls (∗p < .005). (B): Flow cytometric analysis of Tim-3 surface expression (open histograms) on RepSox- and DMSO-treated CD34+ cells (mean difference was not significant [NS]). Solid histograms display isotype controls. (C): Flow cytometric analysis of Tim-3 surface expression (open histograms) following culture of fluorescence-activated cell sorting-purified Tim-3+ AML and MDS cells with 16 μM RepSox or DMSO for 6 days (on stroma, 10% FBS, 5% O2) (mean difference was NS). Solid histograms display isotype controls. Abbreviations: DMSO, dimethyl sulfoxide; MFI, median fluorescence intensity; P1–P8, patients 1–8; Tim-3, T cell immunoglobulin mucin-3.
Discussion
Engineering patient-specific anticancer immune therapies will advance as in vitro techniques improve. Because primitive relapse-causing tumor cells must be targeted, a basic challenge is reducing the in vitro death and differentiation of cancer progenitors. LPCs must be maintained in culture long enough to study their molecular characteristics, to activate immune cells, and to evaluate potential therapies. Currently, key technical obstacles are being identified and addressed. Glettig and Kaplan have explored ways to better maintain CD34+ hematopoietic progenitors in vitro using coculture with adipocytes [42]. Kellner and colleagues report that their “most significant problem” is isolating multiple myeloma stem cells so they can be studied [43]. If relevant stem-like tumor cells can be adequately maintained in vitro, another challenge may be increasing low tumor cell immunogenicity that impedes antigen presentation and immune cell activation. In the setting of AML, abnormal Tim-3 expression on tumor cells and dysfunctional antigen-presenting and immune-effector cells is an especially attractive target because this one receptor impairs antigen presentation and promotes both immune suppression and immune evasion [44–47]. Consequently, Tim-3 should be considered a potentially serious obstacle when engineering immune therapies in vitro.
Considering these technical challenges, the ability of RepSox to extend CD34+ cell survival and decrease Tim-3 expression seems useful for engineering LPC-targeted immune therapies. RepSox is a chemical reprogramming tool with actions linked to maintaining stemness and inhibiting differentiation, two actions that are relevant for maintaining CD34+ AML cells in culture [24, 48]. In mouse embryonic fibroblasts (MEFs), RepSox increased mRNA levels of components of the Wnt, Notch, and Hedgehog signaling pathways that promote pluripotency, self-renewal, and stem cell maintenance [48]. In addition, as a TGF-β inhibitor, RepSox may mitigate immunosuppressive effects induced by TGF-β during cancer progression [49]. Moreover, RepSox may be a valuable tool for manipulating cancer and immune cells because its actions on both normal and cancer cells are potent and consistent [24, 48].
In addition to their poor survival and low immunogenicity, patients’ tumor cells may not be stem-like enough to adequately represent the critical in vivo target: the most recently evolved LPCs capable of triggering relapse. Primary cells may need to be reprogrammed toward more stem-like phenotypes to serve as relevant therapeutic targets. Fortunately, technical breakthroughs are encouraging. The same factors that dedifferentiate normal cells may also dedifferentiate tumor cells [15, 23, 50]. Noh and colleagues converted tumor cells into a more stem-like phenotype in vitro after identifying a Nanog-mediated mechanism by which immune-selection pressures drove this conversion in vivo [15]. Furthermore, mouse cells were chemically reprogrammed to pluripotency using seven small molecules [51].
In this study, the TGF-β inhibitors RepSox and SB 431542 reduced Tim-3 expression on AML cells; however, only RepSox-treated AML cells displayed substantially increased levels of CXCL12 and MYC mRNA, and only RepSox slowed decay of CD34+ AML cells. Slowing decay of CD34+ cells is consistent with prior RepSox findings: RepSox replaces c-Myc during reprogramming [24], RepSox upregulates CXCL12 and MYC in MEFs [48], and both c-Myc and CXCL12 promote tumor cell survival [32, 52–54]. Furthermore, c-Myc is downregulated during differentiation of AML cells [31], and exposing AML cells to a c-Myc inhibitor induces their differentiation [33].
The CXCL12/CXCR4 and CXCL12/CXCR7 axes promote survival of leukemic cells and normal CD34+ cells [55, 56]. Activation of the CXCL12/CXCR4 axis is thought to inhibit AML cell differentiation because inhibition of CXCR4 by AMD 3100 induces AML cells to differentiate [32]. Overall, CXCL12 promotes survival of leukemic progenitors both in vitro and in vivo [57, 58]; however, the implications of cell surface and intracellular receptor levels are still being clarified. In the case of CXCR7, the CXCL12/CXCR7 axis promotes HSC survival even when CXCR7 surface expression is scarce [56]. Conceivably, when used as a potential CXCL12 upregulator, RepSox might help clarify the role of intracellular CXCL12 levels. Of note, the balance of CXCL12- and TGF-β-activated pathways affects CD34+ cell cycle status [59]. Consequently, as both a TGF-β inhibitor and an apparent CXCL12 upregulator, RepSox seems useful for investigating the balance between quiescence and cell cycling.
RepSox may slow decay of CD34+ AML cells by increasing c-Myc, which inhibits AML cell differentiation. c-Myc blocks differentiation of AML cell lines by increasing microRNA-17 and microRNA-20a levels, which, in turn, decrease p21 and STAT3 [60]. RepSox may increase c-Myc by upregulating CXCL12, which signals via CXCR4 to activate nuclear factor-κB (NF-κB) [61]. NF-κB increases expression of microRNA binding protein Lin28 [62], which inhibits maturation of the let-7 family of microRNAs [62, 63]. Because let-7 microRNAs repress translation of MYC mRNA, reduced let-7 may lead to increased c-Myc expression [63, 64]. Furthermore, RepSox-treated MEFs expressed higher mRNA levels of the Wnt signaling components FZD1, FZD4, FZD9, and LEF1 than DMSO-treated controls [48]. Because MYC is a target of Wnt signaling [65], RepSox may upregulate MYC via Wnt activation. Upregulation of MYC by Wnt/β-catenin signaling has been reported independently by Zhang et al. [66] and He et al. [65], and He and colleagues highlighted the T cell factor-4 binding sites in the MYC promoter. CXCL12 exposure also increased mRNA levels of the Wnt target genes CTNNB1 (encoding β-catenin), CCND1 (encoding cyclin-D1), and MYC (encoding c-Myc) in the AML cell line HL60 [67].
In contrast to the “CD34+ effect” unique to RepSox, Tim-3 expression on AML/MDS cells was also reduced by the structurally distinct TGF-β inhibitor SB 431542. Consequently, TGF-β inhibition may reduce Tim-3 levels, a mechanism supported by reports that TGF-β induces Tim-3 expression on mast cells [68, 69]. Of note, the ALDH activity of RepSox-treated CD34+ AML cells was unaltered, despite reduced Tim-3 expression relative to controls, suggesting these cells remained stem-like. Although Tim-3 is an AML LPC-associated antigen, reduced Tim-3 expression may not diminish the disease-initiating or relapse-causing potential of LPCs. Indeed, RepSox-treated AML cells engrafted the BM of NOD-scid IL2Rgammanull mice (data not shown).
Tim-3 may be a critical obstacle when engineering AML immunotherapies because it impairs antitumor immunity [39]. By inducing Tim-3 expression, tumor microenvironments inhibit the antitumor activity of dendritic [70], natural killer [71], T-lymphocytic [39], and monocytic [72] cells. Furthermore, blocking Tim-3 signaling with antibodies restores the cytotoxicity of CD8+ T cells and improves antitumor immunity [12, 73, 74]. Conceivably, reduced Tim-3 expression on AML cells might increase their immunogenicity because Tim-3 binds to and suppresses helper T cells when expressed by endothelial cells [47].
Immunotherapies involving antibodies, activated immune cells, and/or inhibitors of antiapoptotic factors (responsible for tumor cell immune resistance) may be required to eliminate LPCs that trigger AML relapse. Although a cancer patient’s immune-effector and antigen-presenting cells are not malignant, their cancer-induced dysfunctions may need to be reversed. Reprogramming exhausted T cells to pluripotency improves their functions, increases their proliferative capacity, and preserves their antigen-specificity following redifferentiation into T cells [75, 76]. Because immune cell suppression and tumor cell immune-evasion worsen over time, immune therapies may need to be administered shortly after diagnosis to be effective. Thus, the ability to quickly manipulate a patient’s diagnostic cells may be an advantage. Like N-propionylmannosamine [77], resiquimod [78], and the MUC1 inhibitor GO-203 [41], RepSox is a chemical that alters leukemia cells in vitro within a week. Prolonging survival of a patient’s CD34+ cells in culture by days may be sufficient to chemically engineer cells. Exposing cells to small molecules like RepSox is less labor-intensive than genetic engineering, and effects may be reversible. Of note, culture with a leukemic patient’s BM stromal cells, rather than BM stromal cells from healthy donors, may further enhance maintenance of that patient’s CD34+ AML cells because cancer-associated fibroblasts have evolved to support tumor growth in vivo [79, 80]. The ability to quickly and reversibly alter the primary cells of AML patients in vitro may be valuable if sequential cellular manipulations prove useful for therapy development.
Conclusion
RepSox may be useful for developing immunotherapies as a cell culture additive (to slow decay of CD34+ AML cells, which often contain LPCs) and/or as a cell-engineering tool (to decrease Tim-3 expression). Because Tim-3 expression on the tumor and immune cells of cancer patients may adversely affect tumor cell immunogenicity, immune cell activation, and antigen presentation, RepSox may improve the antitumor actions of antigen-presenting and immune-effector cells that become functionally impaired in cancer patients. Because the effects of RepSox seem potent and predictable, RepSox warrants consideration for manipulating the tumor and immune cells of patients with other cancers. Because molecular tools have recently been shown to chemically reprogram cells, RepSox and other molecules may eventually eliminate the need for genetic engineering when developing patient-specific immune therapies. Characterizing the actions of RepSox and other reprogramming tools may promote development of immunotherapies by simplifying in vitro engineering of tumor and immune cells.
Supplementary Material
Acknowledgments
This work and L.F.G. were supported by NIH grants RO1 HL056888 and RO1 CA134573, NIGMS P30 GM103488, NIGMS CTR-IDeA U54GM104942, the Alexander B. Osborn Hematopoietic Malignancy and Transplantation Program, and the West Virginia Research Trust Fund. A.N.J. was supported by a National Cancer Institute (NCI) predoctoral fellowship F31 CA159805 and an NCI supplement RO1 CA134573-02S1. We thank the West Virginia University (WVU) Tissue Bank, the WVU Biospecimen Processing Core, and patients and clinicians at the Mary Babb Randolph Cancer Center for donating leukapheresis specimens. We gratefully acknowledge Dr. Kathleen Brundage for expertise related to flow cytometry experiments performed in the WVU Flow Cytometry Core Facility, supported in part by an NIH equipment grant RR020866, NIGMS P30 GM103488, and INBRE RCP11011809. We thank the WVU Microscope Imaging Facility, which has been supported by the Mary Babb Randolph Cancer Center and NIH grants P20 RR016440, P30 RR032138/GM103488 and P20 RR016477, and the WVU nonlinear optical microscopy laboratory, supported by the WVU Center for Neuroscience and Centers of Biomedical Research Excellence grant P30 R031155. We thank Dr. Gibson's lab and Drs. Ryan and Jessica Jajosky for their insights and advice.
Author Contributions
A.N.J.: conception/design, collection and/or assembly of data, processing of patient samples, data analysis and interpretation, manuscript writing; J.E.C. and J.A.V.: collection and/or assembly of data, data analysis and interpretation; K.H.M., J.R.S., and S.L.W.: collection and/or assembly of data; L.F.G.: conception/design, data analysis and interpretation, manuscript writing.
Disclosure of Potential Conflicts of Interest
The authors indicate no potential conflicts of interest.
References
- 1.Dunn GP, Bruce AT, Ikeda H, et al. Cancer immunoediting: From immunosurveillance to tumor escape. Nat Immunol. 2002;3:991–998. doi: 10.1038/ni1102-991. [DOI] [PubMed] [Google Scholar]
- 2.Zitvogel L, Tesniere A, Kroemer G. Cancer despite immunosurveillance: Immunoselection and immunosubversion. Nat Rev Immunol. 2006;6:715–727. doi: 10.1038/nri1936. [DOI] [PubMed] [Google Scholar]
- 3.Jan M, Chao MP, Cha AC, et al. Prospective separation of normal and leukemic stem cells based on differential expression of TIM3, a human acute myeloid leukemia stem cell marker. Proc Natl Acad Sci USA. 2011;108:5009–5014. doi: 10.1073/pnas.1100551108. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Kikushige Y, Shima T, Takayanagi S, et al. TIM-3 is a promising target to selectively kill acute myeloid leukemia stem cells. Cell Stem Cell. 2010;7:708–717. doi: 10.1016/j.stem.2010.11.014. [DOI] [PubMed] [Google Scholar]
- 5.van Stijn A, van der Pol MA, Kok A, et al. Differences between the CD34+ and CD34- blast compartments in apoptosis resistance in acute myeloid leukemia. Haematologica. 2003;88:497–508. [PubMed] [Google Scholar]
- 6.Costello RT, Mallet F, Gaugler B, et al. Human acute myeloid leukemia CD34+/CD38- progenitor cells have decreased sensitivity to chemotherapy and Fas-induced apoptosis, reduced immunogenicity, and impaired dendritic cell transformation capacities. Cancer Res. 2000;60:4403–4411. [PubMed] [Google Scholar]
- 7.Blankenstein T, Coulie PG, Gilboa E, et al. The determinants of tumour immunogenicity. Nat Rev Cancer. 2012;12:307–313. doi: 10.1038/nrc3246. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Kalos M, Levine BL, Porter DL, et al. T cells with chimeric antigen receptors have potent antitumor effects and can establish memory in patients with advanced leukemia. Sci Transl Med. 2011;3:95ra73. doi: 10.1126/scitranslmed.3002842. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Brentjens RJ, Davila ML, Riviere I, et al. CD19-targeted T cells rapidly induce molecular remissions in adults with chemotherapy-refractory acute lymphoblastic leukemia. Sci Transl Med. 2013;5:177ra38. doi: 10.1126/scitranslmed.3005930. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Khong HT, Restifo NP. Natural selection of tumor variants in the generation of “tumor escape” phenotypes. Nat Immunol. 2002;3:999–1005. doi: 10.1038/ni1102-999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Gajewski TF, Meng Y, Blank C, et al. Immune resistance orchestrated by the tumor microenvironment. Immunol Rev. 2006;213:131–145. doi: 10.1111/j.1600-065X.2006.00442.x. [DOI] [PubMed] [Google Scholar]
- 12.Fourcade J, Sun Z, Benallaoua M, et al. Upregulation of Tim-3 and PD-1 expression is associated with tumor antigen-specific CD8+ T cell dysfunction in melanoma patients. J Exp Med. 2010;207:2175–2186. doi: 10.1084/jem.20100637. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Hodi FS, O’Day SJ, McDermott DF, et al. Improved survival with ipilimumab in patients with metastatic melanoma. N Engl J Med. 2010;363:711–723. doi: 10.1056/NEJMoa1003466. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Glaser SP, Lee EF, Trounson E, et al. Anti-apoptotic Mcl-1 is essential for the development and sustained growth of acute myeloid leukemia. Genes Dev. 2012;26:120–125. doi: 10.1101/gad.182980.111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Noh KH, Kim BW, Song KH, et al. Nanog signaling in cancer promotes stem-like phenotype and immune evasion. J Clin Invest. 2012;122:4077–4093. doi: 10.1172/JCI64057. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Jordan CT, Upchurch D, Szilvassy SJ, et al. The interleukin-3 receptor alpha chain is a unique marker for human acute myelogenous leukemia stem cells. Leukemia. 2000;14:1777–1784. doi: 10.1038/sj.leu.2401903. [DOI] [PubMed] [Google Scholar]
- 17.Majeti R, Chao MP, Alizadeh AA, et al. CD47 is an adverse prognostic factor and therapeutic antibody target on human acute myeloid leukemia stem cells. Cell. 2009;138:286–299. doi: 10.1016/j.cell.2009.05.045. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Spencer JA, Ferraro F, Roussakis E, et al. Direct measurement of local oxygen concentration in the bone marrow of live animals. Nature. 2014;508:269–273. doi: 10.1038/nature13034. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Ailles LE, Gerhard B, Hogge DE. Detection and characterization of primitive malignant and normal progenitors in patients with acute myelogenous leukemia using long-term coculture with supportive feeder layers and cytokines. Blood. 1997;90:2555–2564. [PubMed] [Google Scholar]
- 20.Dontu G, Al-Hajj M, Abdallah WM, et al. Stem cells in normal breast development and breast cancer. Cell Prolif. 2003;36(suppl 1):59–72. doi: 10.1046/j.1365-2184.36.s.1.6.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Reynolds BA, Weiss S. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science. 1992;255:1707–1710. doi: 10.1126/science.1553558. [DOI] [PubMed] [Google Scholar]
- 22.Eppert K, Takenaka K, Lechman ER, et al. Stem cell gene expression programs influence clinical outcome in human leukemia. Nat Med. 2011;17:1086–1093. doi: 10.1038/nm.2415. [DOI] [PubMed] [Google Scholar]
- 23.Noh KH, Lee YH, Jeon JH, et al. Cancer vaccination drives Nanog-dependent evolution of tumor cells toward an immune-resistant and stem-like phenotype. Cancer Res. 2012;72:1717–1727. doi: 10.1158/0008-5472.CAN-11-3758. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Ichida JK, Blanchard J, Lam K, et al. A small-molecule inhibitor of tgf-Beta signaling replaces sox2 in reprogramming by inducing nanog. Cell Stem Cell. 2009;5:491–503. doi: 10.1016/j.stem.2009.09.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Gellibert F, Woolven J, Fouchet MH, et al. Identification of 1,5-naphthyridine derivatives as a novel series of potent and selective TGF-beta type I receptor inhibitors. J Med Chem. 2004;47:4494–4506. doi: 10.1021/jm0400247. [DOI] [PubMed] [Google Scholar]
- 26.Hall BM, Fortney JE, Taylor L, et al. Stromal cells expressing elevated VCAM-1 enhance survival of B lineage tumor cells. Cancer Lett. 2004;207:229–239. doi: 10.1016/j.canlet.2003.10.033. [DOI] [PubMed] [Google Scholar]
- 27.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 28.Overton WR. Modified histogram subtraction technique for analysis of flow cytometry data. Cytometry. 1988;9:619–626. doi: 10.1002/cyto.990090617. [DOI] [PubMed] [Google Scholar]
- 29.Eliasson P, Jönsson JI. The hematopoietic stem cell niche: Low in oxygen but a nice place to be. J Cell Physiol. 2010;222:17–22. doi: 10.1002/jcp.21908. [DOI] [PubMed] [Google Scholar]
- 30.Leon J, Ferrandiz N, Acosta JC, et al. Inhibition of cell differentiation: A critical mechanism for MYC-mediated carcinogenesis? Cell Cycle. 2009;8:1148–1157. doi: 10.4161/cc.8.8.8126. [DOI] [PubMed] [Google Scholar]
- 31.Salvatori B, Iosue I, Djodji Damas N, et al. Critical role of c-Myc in acute myeloid leukemia involving direct regulation of miR-26a and histone methyltransferase EZH2. Genes Cancer. 2011;2:585–592. doi: 10.1177/1947601911416357. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Tavor S, Eisenbach M, Jacob-Hirsch J, et al. The CXCR4 antagonist AMD3100 impairs survival of human AML cells and induces their differentiation. Leukemia. 2008;22:2151–2158. doi: 10.1038/leu.2008.238. [DOI] [PubMed] [Google Scholar]
- 33.Huang MJ, Cheng YC, Liu CR, et al. A small-molecule c-Myc inhibitor, 10058-F4, induces cell-cycle arrest, apoptosis, and myeloid differentiation of human acute myeloid leukemia. Exp Hematol. 2006;34:1480–1489. doi: 10.1016/j.exphem.2006.06.019. [DOI] [PubMed] [Google Scholar]
- 34.Hilton J. Role of aldehyde dehydrogenase in cyclophosphamide-resistant L1210 leukemia. Cancer Res. 1984;44:5156–5160. [PubMed] [Google Scholar]
- 35.Chute JP, Muramoto GG, Whitesides J, et al. Inhibition of aldehyde dehydrogenase and retinoid signaling induces the expansion of human hematopoietic stem cells. Proc Natl Acad Sci USA. 2006;103:11707–11712. doi: 10.1073/pnas.0603806103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Ran D, Schubert M, Pietsch L, et al. Aldehyde dehydrogenase activity among primary leukemia cells is associated with stem cell features and correlates with adverse clinical outcomes. Exp Hematol. 2009;37:1423–1434. doi: 10.1016/j.exphem.2009.10.001. [DOI] [PubMed] [Google Scholar]
- 37.Gerber JM, Smith BD, Ngwang B, et al. A clinically relevant population of leukemic CD34(+)CD38(-) cells in acute myeloid leukemia. Blood. 2012;119:3571–3577. doi: 10.1182/blood-2011-06-364182. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Pearce DJ, Taussig D, Simpson C, et al. Characterization of cells with a high aldehyde dehydrogenase activity from cord blood and acute myeloid leukemia samples. Stem Cells. 2005;23:752–760. doi: 10.1634/stemcells.2004-0292. [DOI] [PubMed] [Google Scholar]
- 39.Anderson AC. Tim-3, a negative regulator of anti-tumor immunity. Curr Opin Immunol. 2012;24:213–216. doi: 10.1016/j.coi.2011.12.005. [DOI] [PubMed] [Google Scholar]
- 40.Inman GJ, Nicolás FJ, Callahan JF, et al. SB-431542 is a potent and specific inhibitor of transforming growth factor-beta superfamily type I activin receptor-like kinase (ALK) receptors ALK4, ALK5, and ALK7. Mol Pharmacol. 2002;62:65–74. doi: 10.1124/mol.62.1.65. [DOI] [PubMed] [Google Scholar]
- 41.Rosenblatt J, Stroopinsky D, Luptakova K, et al. Muc1 inhibition reverses the poor immunogenicity of leukemia stem cells rendering them susceptible to immunotherapy. Biol Blood Marrow Transplant. 2012;18:S319. [Google Scholar]
- 42.Glettig DL, Kaplan DL. Extending human hematopoietic stem cell survival in vitro with adipocytes. Biores Open Access. 2013;2:179–185. doi: 10.1089/biores.2013.0006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Kellner J, Liu B, Kang Y, et al. Fact or fiction-identifying the elusive multiple myeloma stem cell. J Hematol Oncol. 2013;6:91. doi: 10.1186/1756-8722-6-91. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Hastings WD, Anderson DE, Kassam N, et al. TIM-3 is expressed on activated human CD4+ T cells and regulates Th1 and Th17 cytokines. Eur J Immunol. 2009;39:2492–2501. doi: 10.1002/eji.200939274. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.McMahan RH, Golden-Mason L, Nishimura MI, et al. Tim-3 expression on PD-1+ HCV-specific human CTLs is associated with viral persistence, and its blockade restores hepatocyte-directed in vitro cytotoxicity. J Clin Invest. 2010;120:4546–4557. doi: 10.1172/JCI43127. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Tang D, Lotze MT. Tumor immunity times out: TIM-3 and HMGB1. Nat Immunol. 2012;13:808–810. doi: 10.1038/ni.2396. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Huang X, Bai X, Cao Y, et al. Lymphoma endothelium preferentially expresses Tim-3 and facilitates the progression of lymphoma by mediating immune evasion. J Exp Med. 2010;207:505–520. doi: 10.1084/jem.20090397. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Larsen DM. Evaluation of the TGF-β Inhibitor RepSox on the Expression of Pluripotency Pathways in Murine and Bovine Cells [master’s thesis]. Logan, UT: Utah State University; 2013. [Google Scholar]
- 49.Wahl SM, Swisher J, McCartney-Francis N, et al. TGF-β: The perpetrator of immune suppression by regulatory T cells and suicidal T cells. J Leukoc Biol. 2004;76:15–24. doi: 10.1189/jlb.1103539. [DOI] [PubMed] [Google Scholar]
- 50.Silva J, Nichols J, Theunissen TW, et al. Nanog is the gateway to the pluripotent ground state. Cell. 2009;138:722–737. doi: 10.1016/j.cell.2009.07.039. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Hou P, Li Y, Zhang X, et al. Pluripotent stem cells induced from mouse somatic cells by small-molecule compounds. Science. 2013;341:651–654. doi: 10.1126/science.1239278. [DOI] [PubMed] [Google Scholar]
- 52.Nair R, Roden DL, Teo WS, et al. c-Myc and Her2 cooperate to drive a stem-like phenotype with poor prognosis in breast cancer. Oncogene. 2013 doi: 10.1038/onc.2013.368. [E-pub ahead of print] [DOI] [PubMed] [Google Scholar]
- 53.Burns JM, Summers BC, Wang Y, et al. A novel chemokine receptor for SDF-1 and I-TAC involved in cell survival, cell adhesion, and tumor development. J Exp Med. 2006;203:2201–2213. doi: 10.1084/jem.20052144. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Broxmeyer HE, Kohli L, Kim CH, et al. Stromal cell-derived factor-1/CXCL12 directly enhances survival/antiapoptosis of myeloid progenitor cells through CXCR4 and G(α)i proteins and enhances engraftment of competitive, repopulating stem cells. J Leukoc Biol. 2003;73:630–638. doi: 10.1189/jlb.1002495. [DOI] [PubMed] [Google Scholar]
- 55.Civini S, Jin P, Ren J, et al. Leukemia cells induce changes in human bone marrow stromal cells. J Transl Med. 2013;11:298. doi: 10.1186/1479-5876-11-298. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Torossian F, Anginot A, Chabanon A, et al. CXCR7 participates in CXCL12-induced CD34+ cell cycling through β-arrestin-dependent Akt activation. Blood. 2014;123:191–202. doi: 10.1182/blood-2013-05-500496. [DOI] [PubMed] [Google Scholar]
- 57.Kim HY, Oh YS, Song IC, et al. Endogenous stromal cell-derived factor-1 (CXCL12) supports autonomous growth of acute myeloid leukemia cells. Leuk Res. 2013;37:566–572. doi: 10.1016/j.leukres.2013.01.016. [DOI] [PubMed] [Google Scholar]
- 58.Tavor S, Petit I, Porozov S, et al. CXCR4 regulates migration and development of human acute myelogenous leukemia stem cells in transplanted NOD/SCID mice. Cancer Res. 2004;64:2817–2824. doi: 10.1158/0008-5472.can-03-3693. [DOI] [PubMed] [Google Scholar]
- 59.Chabanon A, Desterke C, Rodenburger E, et al. A cross-talk between stromal cell-derived factor-1 and transforming growth factor-β controls the quiescence/cycling switch of CD34(+) progenitors through FoxO3 and mammalian target of rapamycin. Stem Cells. 2008;26:3150–3161. doi: 10.1634/stemcells.2008-0219. [DOI] [PubMed] [Google Scholar]
- 60.He M, Wang QY, Yin QQ, et al. HIF-1α downregulates miR-17/20a directly targeting p21 and STAT3: A role in myeloid leukemic cell differentiation. Cell Death Differ. 2013;20:408–418. doi: 10.1038/cdd.2012.130. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Rehman AO, Wang CY. CXCL12/SDF-1 α activates NF-kappaB and promotes oral cancer invasion through the Carma3/Bcl10/Malt1 complex. Int J Oral Sci. 2009;1:105–118. doi: 10.4248/IJOS.09059. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Hoesel B, Schmid JA. The complexity of NF-κB signaling in inflammation and cancer. Mol Cancer. 2013;12:86. doi: 10.1186/1476-4598-12-86. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Boyerinas B, Park SM, Hau A, et al. The role of let-7 in cell differentiation and cancer. Endocr Relat Cancer. 2010;17:F19–F36. doi: 10.1677/ERC-09-0184. [DOI] [PubMed] [Google Scholar]
- 64.Sampson VB, Rong NH, Han J, et al. MicroRNA let-7a down-regulates MYC and reverts MYC-induced growth in Burkitt lymphoma cells. Cancer Res. 2007;67:9762–9770. doi: 10.1158/0008-5472.CAN-07-2462. [DOI] [PubMed] [Google Scholar]
- 65.He TC, Sparks AB, Rago C, et al. Identification of c-MYC as a target of the APC pathway. Science. 1998;281:1509–1512. doi: 10.1126/science.281.5382.1509. [DOI] [PubMed] [Google Scholar]
- 66.Zhang S, Li Y, Wu Y, et al. Wnt/β-catenin signaling pathway upregulates c-Myc expression to promote cell proliferation of P19 teratocarcinoma cells. Anat Rec (Hoboken) 2012;295:2104–2113. doi: 10.1002/ar.22592. [DOI] [PubMed] [Google Scholar]
- 67.Zheng F, Li H, Du W, et al. Role of hERG1 K(+) channels in leukemia cells as a positive regulator in SDF-1a-induced proliferation. Hematology. 2011;16:177–184. doi: 10.1179/102453311X12940641878000. [DOI] [PubMed] [Google Scholar]
- 68.Wiener Z, Kohalmi B, Pocza P, et al. TIM-3 is expressed in melanoma cells and is upregulated in TGF-beta stimulated mast cells. J Invest Dermatol. 2007;127:906–914. doi: 10.1038/sj.jid.5700616. [DOI] [PubMed] [Google Scholar]
- 69.Kim JS, Shin DC, Woo MY, et al. T cell immunoglobulin mucin domain (TIM)-3 promoter activity in a human mast cell line. Immune Netw. 2012;12:207–212. doi: 10.4110/in.2012.12.5.207. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Chiba S, Baghdadi M, Akiba H, et al. Tumor-infiltrating DCs suppress nucleic acid-mediated innate immune responses through interactions between the receptor TIM-3 and the alarmin HMGB1. Nat Immunol. 2012;13:832–842. doi: 10.1038/ni.2376. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Ndhlovu LC, Lopez-Vergès S, Barbour JD, et al. Tim-3 marks human natural killer cell maturation and suppresses cell-mediated cytotoxicity. Blood. 2012;119:3734–3743. doi: 10.1182/blood-2011-11-392951. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Zhang Y, Ma CJ, Wang JM, et al. Tim-3 regulates pro- and anti-inflammatory cytokine expression in human CD14+ monocytes. J Leukoc Biol. 2012;91:189–196. doi: 10.1189/jlb.1010591. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Sakuishi K, Apetoh L, Sullivan JM, et al. Targeting Tim-3 and PD-1 pathways to reverse T cell exhaustion and restore anti-tumor immunity. J Exp Med. 2010;207:2187–2194. doi: 10.1084/jem.20100643. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Ngiow SF, von Scheidt B, Akiba H, et al. Anti-TIM3 antibody promotes T cell IFN-γ-mediated antitumor immunity and suppresses established tumors. Cancer Res. 2011;71:3540–3551. doi: 10.1158/0008-5472.CAN-11-0096. [DOI] [PubMed] [Google Scholar]
- 75.Nishimura T, Kaneko S, Kawana-Tachikawa A, et al. Generation of rejuvenated antigen-specific T cells by reprogramming to pluripotency and redifferentiation. Cell Stem Cell. 2013;12:114–126. doi: 10.1016/j.stem.2012.11.002. [DOI] [PubMed] [Google Scholar]
- 76.Vizcardo R, Masuda K, Yamada D, et al. Regeneration of human tumor antigen-specific T cells from iPSCs derived from mature CD8(+) T cells. Cell Stem Cell. 2013;12:31–36. doi: 10.1016/j.stem.2012.12.006. [DOI] [PubMed] [Google Scholar]
- 77.Liu T, Guo Z, Yang Q, et al. Biochemical engineering of surface alpha 2-8 polysialic acid for immunotargeting tumor cells. J Biol Chem. 2000;275:32832–32836. doi: 10.1074/jbc.C000573200. [DOI] [PubMed] [Google Scholar]
- 78.Smits EL, Cools N, Lion E, et al. The Toll-like receptor 7/8 agonist resiquimod greatly increases the immunostimulatory capacity of human acute myeloid leukemia cells. Cancer Immunol Immunother. 2010;59:35–46. doi: 10.1007/s00262-009-0721-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Xing F, Saidou J, Watabe K. Cancer associated fibroblasts (CAFs) in tumor microenvironment. Front Biosci (Landmark Ed) 2010;15:166–179. doi: 10.2741/3613. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Cirri P, Chiarugi P. Cancer associated fibroblasts: The dark side of the coin. Am J Cancer Res. 2011;1:482–497. [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.







