Skip to main content
American Journal of Physiology - Gastrointestinal and Liver Physiology logoLink to American Journal of Physiology - Gastrointestinal and Liver Physiology
. 2013 Oct 24;306(1):G59–G71. doi: 10.1152/ajpgi.00213.2013

Antibiotics modulate intestinal immunity and prevent necrotizing enterocolitis in preterm neonatal piglets

Michael L Jensen 1, Thomas Thymann 1, Malene S Cilieborg 1,2, Mikkel Lykke 1, Lars Mølbak 3, Bent B Jensen 4, Mette Schmidt 5, Denise Kelly 6, Imke Mulder 6, Douglas G Burrin 7, Per T Sangild 1,
PMCID: PMC4073901  PMID: 24157972

Abstract

Preterm birth, bacterial colonization, and formula feeding predispose to necrotizing enterocolitis (NEC). Antibiotics are commonly administered to prevent sepsis in preterm infants, but it is not known whether this affects intestinal immunity and NEC resistance. We hypothesized that broad-spectrum antibiotic treatment improves NEC resistance and intestinal structure, function, and immunity in neonates. Caesarean-delivered preterm pigs were fed 3 days of parenteral nutrition followed by 2 days of enteral formula. Immediately after birth, they were assigned to receive either antibiotics (oral and parenteral doses of gentamycin, ampicillin, and metronidazole, ANTI, n = 11) or saline in the control group (CON, n = 13), given twice daily. NEC lesions and intestinal structure, function, microbiology, and immunity markers were recorded. None of the ANTI but 85% of the CON pigs developed NEC lesions by day 5 (0/11 vs. 11/13, P < 0.05). ANTI pigs had higher intestinal villi (+60%), digestive enzyme activities (+53–73%), and goblet cell densities (+110%) and lower myeloperoxidase (−51%) and colonic microbial density (105 vs. 1010 colony-forming units, all P < 0.05). Microarray transcriptomics showed strong downregulation of genes related to inflammation and innate immune response to microbiota and marked upregulation of genes related to amino acid metabolism, in particular threonine, glucose transport systems, and cell cycle in 5-day-old ANTI pigs. In a follow-up experiment, 5 days of antibiotics prevented NEC at least until day 10. Neonatal prophylactic antibiotics effectively reduced gut bacterial load, prevented NEC, intestinal atrophy, dysfunction, and inflammation and enhanced expression of genes related to gut metabolism and immunity in preterm pigs.

Keywords: immature, microbiota, necrotizing enterocolitis, neonates, premature


necrotizing enterocolitis (NEC) is among the most common gastrointestinal disorders in preterm infants, yet there is still no well-established prevention strategy or treatment for this disease (37). The pathogenesis of NEC remains to be fully elucidated although prematurity, enteral nutrition, and microbial colonization of the gut are considered the three most important risk factors for NEC (37, 43, 55). Evidence supporting the key role of the gut microbiota includes the finding that NEC does not occur in utero (36, 37). Epidemic outbreaks of the disease in neonatal intensive care units are also commonly reported (8), suggesting the involvement of a microbiological component. Additionally, studies in fetal and germ-free preterm pigs, and in quails, show that the initial bacterial colonization is a prerequisite for the development of NEC (5, 53, 68). Regardless, no specific pathogen has been identified as the primary cause of NEC (47, 69) although bacterial overgrowth may be a key element in the etiology of NEC (37). Bacterial overgrowth may result from factors such as intestinal dysmotility, reduced digestive function, and immature immunological responses to microbial colonization, all of which are characteristics of the premature gut (3, 37). Stasis of the intestinal contents and diet malabsorption triggers the overgrowth and fermentation by commensal and pathogenic bacteria, thereby overriding the weak protective factors of the immature mucosal epithelium (6, 65). Specifically in the preterm neonate, bacterial overgrowth may also lead to an inappropriate gut proinflammatory response, mediated via the immature innate mucosal immune system, leading to further disruption of the epithelial barrier, severe systemic inflammation, and multiorgan failure (25, 45).

Antibiotic therapy is frequently used in the clinical management of preterm infants. Antibiotics prevent the onset of sepsis caused by indwelling catheters or from translocation of gut bacteria (38). Antibiotics are also used in cases where early signs of NEC appear or as a treatment after the onset of NEC (44, 63). Concerns regarding possible adverse effects of antibiotics are related to possible development of resistant strains and to the contention that delayed colonization and reduced microbial diversity may predispose to later intestinal disease (15, 32, 63, 70). Indeed, a relatively long period of systemic antibiotic treatment may be associated with reduced bacterial diversity and increased incidence of NEC (1, 15, 69). Oral administration of antibiotics is used seldom for preterm infants, and the short- and long-term effects on gut parameters remain unknown. Despite the above concerns, a systematic review of five clinical trials involving 456 infants concluded that oral antibiotics reduced the incidence of NEC in low-birth-weight infants (10). Regardless of the potential clinical significance of antibiotic therapy on NEC in premature infants, no studies have yet examined the more basic effects of prophylactic antibiotic treatment in a clinically relevant animal model of NEC. One rat study showed a protective effect of clarithromycin treatment in a model of ischemia-reperfusion injury (46a). The objective of the present study was to investigate the impact of prophylactic antibiotics on the incidence and pathogenesis of NEC in preterm pigs. We hypothesized that treatment with a clinically relevant combination of broad-spectrum antibiotics from birth would decrease the incidence and severity of NEC. We speculated that this treatment would improve intestinal structure, function, and immunity, leading to a reduced mucosal proinflammatory response to colonizing bacteria.

MATERIALS AND METHODS

Experiment 1

Twenty-four preterm piglets (Landrace × Large white × Duroc) were delivered by caesarean section on day 105 of gestation from two healthy sows as described previously (53). Anesthesia was induced with Zoletil mixture (Zoletil 50: 125 mg tiletamine, 125 mg zolazepam, 6.25 ml xylazine 20 mg/ml, 1.25 ml ketamin 100 mg/ml, 2.5 ml butorphanol 10 mg/ml) 1 ml/15 kg intramuscularly (IM) and maintained on sodium-thiopenthal, 10 mg/kg intravenously. The newborn preterm pigs were immediately transferred to incubators with regulated temperature and oxygen supply. When respiration had stabilized, pigs were fitted with umbilical and orogastric catheters and immunized with maternal plasma as previously described (6). All procedures were approved by the National Committee on Animal Experimentation in Denmark (protocol number 2004/561-910).

Nutrient solutions and feeding protocol.

All pigs were initially provided parenteral nutrition (PN) via the vascular catheter and small amounts of enteral nutrition (i.e., minimal enteral nutrition, MEN) via the esophageal tube. The PN solution was prepared and administered as described previously and formulated to meet the nutrient requirements of preterm pigs (6). The enteral formula diet was made from three commercially available products used for feeding infants 0–2 yr of age (per liter of water: 80 g Pepdite 2–0, 70 g Protifar, and 75 g Liquigen-MCT; all Nutricia, Allerød, Denmark). The macronutrient per liter of formula was as follows: energy 4,022 kJ, protein 73 g, carbohydrate 42 g, and lipid 57 g. MEN was initiated within 5 h of delivery as boluses of 3 ml/kg every 3 h on days 1 and 2. On day 3, PN was stopped and total enteral nutrition was given through the orogastric feeding tube as boluses of 15 ml/kg every 3 h until death and tissue collection on day 5.

Treatment.

Pigs from each litter were stratified according to birth weight and sex and allocated into controls (CON, n = 13) and an intervention group receiving oral and systemic broad-spectrum antibiotics (Ampicillin, Gentamycin, Metronidazol, ANTI, n = 11, Table 1). These antibiotics were chosen, as they are commonly used for treatment of sepsis and/or NEC in neonatal intensive care units (15, 63). To assure high systemic and intraluminal concentrations, the antibiotics were given both orally and IM. The doses, adapted from Rigshospitalet, Copenhagen, Denmark, were for ampicillin 50 mg/kg per 12 h given orally (NordMedica, Copenhagen, Denmark) plus 50 mg/kg per 12 h given IM (Pentrexyl; Bristol-Myers Sqibb, Bromma, Sweden). Gentamycin was given at 5 mg/kg per day orally and IM (2.5 mg, Gentamycin; KU-LIFE Pharmacy, Copenhagen, Denmark). Metronidazol was given at a total dose of 40 mg/kg twice per day orally (10 mg, Flagyl; Sanofi Aventis, Hørsholm, Denmark) and IM (10 mg, Metronidazol; Actavis, Hafnarfjordur, Iceland). All antibiotics were given immediately after pigs were fed with an oral bolus and control pigs were given corresponding amounts of saline.

Table 1.

Antibiotics, dosage, treatment interval, and bacteria targeted for both experiments

Dosage, mg/kg
Antibiotic Oral Systemic Bacteria Targeted Treatment Time
Ampicillin 50 50 Gram + (−) Twice daily
Gentamycin 2.5 2.5 Gram − (+), Aerobes, Mycoplasma Once daily
Metronidazole 10 10 Anaerobes Twice daily

Clinical observations and in vivo tests.

Signs of discomfort or weakness (unwillingness to stand, cold extremities, distended abdomen, dehydration, pale skin color, diarrhea, and bloody diarrhea) were recorded, and pigs were euthanized if required. An in vivo absorption test with galactose was performed 24 h and 48 h after the first feed. This method enables investigation of the galactose absorption capacity by the apical Na+/glucose cotransporter 1. A bolus (15 ml/kg) of 5% galactose in 0.9% NaCl was given through the orogastric catheter, and a blood sample was taken 20 min later. Samples were kept on ice and centrifuged, and serum was kept at −20°C until later analyses of galactose concentration as previously described (64).

An in vivo intestinal permeability test with lactulose and mannitol was performed as described previously (6). Mannitol is absorbed via the transcellular route, whereas lactulose is a marker of paracellular permeability (29). A bolus (15 ml/kg) of lactulose and mannitol (both 5% in Millipore water) was given to the pigs via the orogastric catheter 3–5 h before euthanasia. Concentrations of lactulose and mannitol in urine, collected by cystocentesis at tissue collection, were assayed as described previously (7).

Tissue collection and NEC evaluation.

On day 5, all pigs were euthanized, tissue was collected, and a macroscopic NEC scoring system was applied as previously described (6). Briefly, each of the five regions (stomach, proximal, mid and distal small intestine, and the colon) of the gastrointestinal tract was macroscopically evaluated for pathological changes, indicative of inflammation and necrosis. The lesions were graded as follows: 1 = absence of lesions, 2 = local hyperemia, 3 = hyperemia, extensive edema and local hemorrhage, 4 = extensive hemorrhage, 5 = local necrosis and pneumatosis intestinalis, 6 = extensive transmural necrosis and pneumatosis intestinalis. An animal was designated as NEC positive when a minimum disease score of 3 in at least one region was observed.

Each region of the small intestine was carefully emptied of its contents and weighed separately; the luminal contents from the distal region were collected for analyses of the luminal gut microbiota. From the middle of each region, small pieces were snap frozen in liquid nitrogen and kept at −80°C for later analysis. Additionally, from the middle of each region, two 1-cm pieces were fixed in 4% paraformaldehyde (PFA). For determination of mucosal proportion, a 10-cm segment from each small intestinal region was removed and slit along its length. The mucosa was gently scraped off with a plastic slide, and the proportion of mucosa was determined on a wet weight basis and subsequently on a dry matter basis after drying both the mucosa and the underlying tissues (50°C for 72 h) as described before (6). Stomach and colon contents were collected for later analyses of organic acids (OAs). Two pieces of colon were fixed in 4% PFA for later histological analysis. Finally, the wet weights were recorded for heart, lungs, stomach, liver, spleen, kidneys, and colon.

Histology.

Samples of PFA-fixed intestine from proximal and distal regions of the small intestine plus colon were embedded in paraffin, sectioned (5 μm), mounted on slides, and stained with hematoxylin and eosin for histomorphology and histopathology. Representative cross sections of proximal and distal region were selected from each pig, and at least 10 well-oriented crypts and villi were measured using an Axiophot microscope (Carl Zeiss, Oberkochen, Germany) and NIH image software version 1.60 (softWoRx Explorer version 1.1; Applied Precision, Issaquah, WA) as described before (6). Histopathology was evaluated for the distal small intestine and colon. With the use of microscopy (×10–20 magnification), the presence of hyperemia (mucosal tissue appearing more red due to more red blood cells than seen in healthy tissue), submucosal congestion (veins full of red blood cells), and villous sloughing/loss of epithelia was determined to be on 3–5 separate tissue segments for each pig, and the prevalence of pathological changes was calculated.

For quantification of goblet cells in the distal small intestine and colon, tissue slides were stained with Alcian Blue (stains acid and neutral mucopolysaccharides blue and red, respectively) and Periodic Acid Shiff (stains neutral mucopolysaccharides red-violet). An Olympus BX50 microscope, equipped with a Sony CCD camera (Olympus) connected to a computer running the software program Cast-grid (Visiopharm, Hørsholm, Denmark) was used. A point grid was generated, and the numbers of goblet cells and enterocytes were counted in the distal small intestine and colon using the ×20 magnification. The ratio of mucus-containing goblet cells relative to the total number of cells in the epithelia was calculated.

Intraepithelial lymphocytes (IELs) were counted. IELs are mainly T-lymphocytes, and hence visualized by the T-lymphocyte common antigen CD3. PFA-fixed midproximal intestine was embedded in paraffin, sectioned (5 μm), and mounted on slides. Tissue sections were dewaxed in toluene and rehydrated through decreasing concentrations of ethanol. Antigenic retrieval was achieved by microwaving tissue sections immersed in 10 mM Tris, 1 mM EDTA buffer at pH 8.0 for 15 min. Endogenous peroxidase activity was blocked with 1% hydrogen peroxide solution, Biotin Blocking System (X0590; Dako, Glostrup, Denmark), and normal swine serum. Tissue sections were then incubated with primary antibody diluted in PBS overnight at 4°C. Monoclonal antibody rat anti-human CD3 was used (T-lymphocyte common antigen, clone CD3–12; MCA 1477, diluted 1:8,000; from Serotec, Oxford, UK). The next day, sections were washed in PBS and incubated with secondary antibody for 2 h at 4°C (biotinylated anti-rat, 1:2,000; from Jackson ImmunoResearch, West Grove, PA), washed in PBS, and incubated for 30 min in Elite ABC reagent (Sigma-Aldrich, Brøndby, Denmark), and then Tyramid Signal Amplification (Sigma-Aldrich) was added. Slides were developed with 3–3-diaminobenzidine and counterstained with hematoxylin (Sigma-Aldrich), dehydrated through increasing concentrations of alcohol to toluene, and mounted under coverslips with Pertex. Visualized IELs were enumerated with the same microscope and software program as goblet cells. The intestinal luminal area from the base of the villous was marked and in the microscopic field the number of IELs per 100 enterocytes determined (no point grid). Only tissue with intact villi was counted and up to a minimum of 500 enterocytes. Pigs with very inflamed and/or necrotic tissue were excluded from this analysis. Finally, vacuolated fetal-type enterocytes per 100 epithelial cells up to a minimum of 1,000 enterocytes of the distal small intestine and colon were counted on the same slides as above for histopathology. The same microscope and software program, as for goblet cells, were used (no point grid).

Tissue analysis.

As a measure of inflammation, tissue myeloperoxidase (MPO) activity was assayed as described before (61), with minor modifications. Full-thickness distal intestinal tissue samples were homogenized twice at 20,000 g, with the second centrifugation step being preceded by addition of a detergent, hexadecyltrimethylammonium bromide, to disrupt the cell membranes, as described (31). Measured activity (read in a 96-well microplate; Molecular Devices, Sunnyvale, CA) was on the basis of a standard curve of human MPO standards (Alexis/ENZO Life Science, Lugano, Switzerland) with dilutions from 5 to 100 mU/ml. Concentrations of IL1-β, IL-6, IL-8, and TNF-α were determined on tissue samples from the distal small intestine. Homogenates extracted in 1.0% Triton X-100 were added to a 5.0% protease inhibitor (P8340; Sigma-Aldrich, St. Louis, MO). The homogenates were centrifuged (14,000 g, 4°C, 10 min), and the concentration of the cytokines was determined using porcine ELISA kits (DuoSet, ELISA development kits; R&D Systems, Abingdon, UK). The results were expressed per gram of wet intestine. Brush border enzyme activities were measured in snap-frozen samples from the proximal, middle, and distal regions of the small intestine from each pig as previously described (54).

Microarray analysis.

Snap-frozen small intestinal tissues (n = 4 for both ANTI and CON pig, proximal and distal small intestine) were treated with RNAlater-ICE (Ambion; Life Technologies, Carlsbad, CA) to permit thawing of the tissue without RNA degradation. As the aim was to investigate the early treatment-related effects on gene expression changes, before any development of severe tissue inflammation and pathology, we selected tissues from both groups that appeared macroscopically healthy (NEC score 1.38 ± 0.18 for ANTI and 1.75 ± 0.25 for CON pigs, P = 0.25). After overnight incubation at −20°C, the tissue was removed from RNAlater-ICE and lyzed in Trizol (Invitrogen, Life Technologies). RNA was isolated using standard chloroform/isopropanol steps. Total RNA was further purified with the RNeasy Kit (Qiagen, Hilden, Germany), including an RNase-free DNase I (Qiagen) digestion step. RNA integrity was determined using the Agilent 2100 Bioanalyzer (Agilent Technologies, San Diego, CA). Total RNA was then processed using the 3′ IVT Express Kit (Affymetrix, Santa Clara, CA). Hybridization to the GeneChip Porcine Genome Array (Affymetrix) on a GeneChip Fluidics Station 450 (Affymetrix) was performed at the Institute of Medical Sciences Microarray Core Facility (University of Aberdeen, UK). Further data analysis was performed with the software packages R (http://www.r-project.org) and Bioconductor (http://www.bioconductor.org). The moderated F-test provided by the Bioconductor package limma was used to test for differential expression (60). Data were considered significant when P < 0.01 and fold change was >2. All differentially expressed genes were imported into the MetaCore analytical software program (GeneGo, St. Joseph, MI) and the AgriGO website (17) for further functional analysis. Microarray data were submitted to the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (accession number GSE48125; http://www.ncbi.nlm.nih.gov/geo).

RT-PCR analysis.

The genes apolipoprotein C-II precursor (APOC4), macrophage inflammatory protein-2-α precursor (CXCL2), estradiol 17-β-dehydrogenase 2 (HSD17B2), interleukin-8 precursor (IL8), lysozyme C precursor (LYZ), elafin precursor (PI3), pancreatitis-associated protein 1 precursor (REG3A), calgranulin B (S100A9), L-threonine dehydrogenase on chromosome 8 (TDH), and Toll-like receptor 2 precursor (TLR2) were further validated using real-time PCR, as these showed the highest treatment difference in terms of fold change and were considered to be of significant functional interest (Table 5). Two micrograms of total RNA were reverse transcribed into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Life Technologies) with random primers. Real-time PCR analysis was performed using a 7500 Fast Real-Time PCR System (Applied Biosystems) with the Power SYBR Green PCR Master Mix (Applied Biosystems). Primers (Sigma-Aldrich, Table 6) were designed for the porcine sequences of interest using Primer Express Software (Applied Biosystems). PCR cycling conditions were one cycle at 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and 60°C for 1 min, ending with a dissociation step. EF-1 was selected as a reference gene for normalization due to its low variation between samples in the microarray (41).

Table 5.

Comparison of ten genes that were markedly affected by antibiotics treatment based on the microarray and quantitative real-time PCR analyses in experiment 1

Affymetrix
RT-PCR
Gene Tissue Site ID FC P Value FC P Value
APOC4 Distal Ssc.3381.1.S1_a_at 8.77 0.02119 19.35 0.00356
proximal Ssc.3381.1.S1_a_at 63.44 0.00026 19.77 0.00167
CXCL2 distal Ssc.19692.1.S1_at −50.78 0.00066 −12.77 0.00137
proximal Ssc.19692.1.S1_at −29.08 0.00211 −7.75 0.03145
HSD17B2 distal Ssc.14073.1.S1_at 2.72 0.17319 2.23 0.02520
proximal Ssc.14073.2.S1_at 15.03 0.00660 2.65 0.24385
IL8 distal Ssc.658.1.S1_at −7.20 0.00121 −6.69 0.00374
proximal Ssc.658.1.S1_at −5.95 0.00254 −5.68 0.00487
LYZ distal Ssc.670.2.S1_at −29.79 0.00078 −31.90 0.00044
proximal Ssc.670.2.S1_at −16.33 0.00325 −23.55 0.00254
PI3 distal Ssc.15989.1.S1_at −82.65 0.00001 −34.55 0.00001
proximal Ssc.15989.1.S1_at 1.07 0.91599 −1.28 0.84227
REG3A distal Ssc.16470.1.S1_a_at −644.98 0.00017 −207.95 0.00034
proximal Ssc.16470.1.S1_a_at −164.80 0.00117 −157.43 0.00256
S100A9 distal Ssc.2381.1.A1_at −141.66 0.00004 −65.92 0.00014
proximal Ssc.2381.1.A1_at −55.48 0.00027 −15.92 0.00148
TDH distal Ssc.51.1.S1_at 229.86 0.00000 273.18 0.00059
proximal Ssc.51.1.S1_at 1.00 1.00000 4.85 0.21117
TLR2 distal Ssc.17337.1.S1_at −16.10 0.00000 −9.67 0.00003
proximal Ssc.17337.1.S1_at −2.63 0.01217 −2.83 0.08097

ID, identity number of the gene from the microarray analysis; FC, fold change.

Table 6.

Primers used for the porcine gene sequences, designed according to Primer Express Software v3.0 (Applied Biosystems) for validation of gene expressions by RT-PCR

Gene Forward Primer Reverse Primer
EF1 CCTGGCAAGCCCATGTGT TGTCTCATGTCACGAACAGCAA
APOC4 CCCTTGGCTCCCCTGATCT GGGAGCAGGATGCTGAGTTG
CXCL2 GCAGGGAGGGAGTTCTCTCAA CACACACTTCCCCTGATTCCA
HSD17B2 GGAGAGGTGCAGGGAGAATCT GCAGAGCCACCCTGTCTCA
IL8 TTCGATGCCAGTGCATAAATA CTGTACAACCTTCTGCACCCA
LYZ CATTTTGCTGACCATGAAGGAA CAAGCTGATAAAGTTCAGGAAAAGC
PI3 CCTGCCCCAGGATTCTGA TGAGCATCACTCAAACACCTGTT
REG3A CCTCCCTGATCAAGAACAATTTG GTCGTGGAGCCCAATCCA
S100A9 CATGCTGGTGGCCAAGCT GGGCGGTCTTGTGCATCT
TDH TGAACTTCCATGGTGCCCATA TCCTCCGGCGCTTCAG
TLR2 AGCTGCGATCAAGTCCTAGGTT GACCAGCATCGGACCAAGAC

EF1 was selected as the reference gene for normalization.

Microbial community analyses.

Conventional culture-based microbiology was performed on content from the cecum (on plates with calf blood agar; SSI Diagnostika, Hillerød, Denmark). Colony-forming units (CFU) of total aerobic and anaerobic bacteria were determined using serial dilutions and enumerated on the lowest countable dilution. Furthermore, the distal small intestinal microbiota was characterized by terminal restriction fragment length polymorphism (T-RFLP) as described previously (40, 58, 58). Briefly, after the sequencing (Applied Biosystems Genetic Analyzer 3130/3130xl) and analysis in BioNumerics 4.5 (Applied Maths, Sint-Martens-Latem, Belgium), absolute T-RF intensities above the detection limit of 50 and exceeding 0.5% of total intensity were selected for further statistical analysis. The identities of the 14 most dominating T-RFs were proposed based on in silico digest performed in MiCA software and the RDPII database (Release 9, Update 37; Bacterial SSU 16S rRNA). The concentration of OA bacterial fermentation products in stomach and colon contents were measured as described previously (27), with minor modifications (11).

Experiment 2

Eighteen preterm pigs (Landrace × Large white × Duroc) were delivered by caesarean section on day 105 of gestation from one healthy sow as described for experiment 1. All animal procedures were as for experiment 1, except that the experiment was extended 5 days beyond the initial 5 days postpartum where antibiotic treatment took place (as in experiment 1). If the pigs did not thrive, they were euthanized, sampled, and given a macroscopic NEC score as in experiment 1. No other analyses were applied. The pigs were allocated to a group receiving prophylactic antibiotics (ANTI, n = 9) using the same antibiotics and doses as for experiment 1 and another group receiving corresponding amounts of saline (CON, n = 9).

Statistical Analysis

The incidences of diarrhea, euthanasia before end of study, and NEC incidences were evaluated with Fisher's exact test. NEC severity and histopathology scores were evaluated using ordered logistic regression with robust standard errors. All continuous variables were modeled using linear mixed models with treatment and sex as fixed effects and sow and pig as random effects if model assumptions were met; otherwise, robust standard errors were used (STATA version 12; StataCorp LP, College Station, TX). Data are presented as means ± SE, and P values <0.05 were considered significant. Microarray data were analyzed as described above. RT-PCR data were analyzed on a logarithmic scale with base 2 by Student's t-test, allowing for unequal variances.

RESULTS

Experiment 1

Despite the immediate transfer to heated, oxygenated incubators, all pigs showed transient hypothermia (Table 2) and normalized at around 8–10 h postpartum. The degrees of hypothermia between the groups were similar and did not correlate with later NEC development. Three CON pigs were euthanized before the end of study due to severe symptoms of NEC, including abdominal distension, bloody diarrhea, lethargy, labored breathing, and pale appearance. Four pigs in the ANTI group and 12 pigs in the CON group showed diarrhea of varying degrees (4/11 = 36% vs. 12/13 = 92%; P < 0.01). At necropsy, the incidence of NEC was determined from macroscopic lesions and showed 0% in the ANTI compared with 85% in the CON pigs (0/11 vs. 11/13; P < 0.001, Fig. 1A). Similarly, the median NEC severity was lower in ANTI vs. CON (stomach: 1 in ANTI vs. 2 in CON; proximal intestine: 2 in ANTI vs. 2 in CON; middle intestine: 1 in ANTI vs. 2 in CON; distal intestine: 1 in ANTI vs. 2 in CON; and colon: 1 in ANTI vs. 5 in CON). The overall median score across all gastrointestinal regions was 1 in ANTI vs. 2 in CON (P < 0.001).

Table 2.

Body and organ weights for pigs in experiment 1

ANTI CON P Value
Number of pigs 11 13
Body temperature at 2 h,°C 34.7 ± 0.2 34.2 ± 0.2 ns
Birth weight, g 1,094 ± 73 1,140 ± 57 ns
Weight at necropsy, g 1,119 ± 79 1,109 ± 56 ns
Relative daily gain, g/kg per day 7.4 ± 5.1 −6.9 ± 4.2 <0.01
Relative organ weight, g/kg
    Heart 8.7 ± 0.5 8.6 ± 0.3 ns
    Lungs 25.6 ± 1.5 26.7 ± 2.1 ns
    Liver 26.0 ± 0.6 31.8 ± 1.5 <0.01
    Kidney 10.4 ± 0.3 9.8 ± 0.2 ns
    Spleen 1.5 ± 0.1 2.1 ± 0.1 <0.001
    Stomach 5.6 ± 0.3 7.6 ± 0.6 <0.05
    Colon 7.4 ± 0.4 10.6 ± 0.6 <0.001

Values are means ± SE.

ANTI, pigs receiving prophylactic antibiotics; CON, pigs receiving saline (controls); ns, nonsignificant.

Fig. 1.

Fig. 1.

Incidence of necrotizing enterocolitis (NEC) in preterm pigs given prophylactic antibiotics (ANTI) or saline (controls, CON) in experiment 1 (A) and in experiment 2 (B). *** P < 0.001.

In vivo tests.

Galactose absorption was not significantly different between ANTI and CON after 24 h and 48 h (data not shown), whereas intestinal permeability test showed lower lactulose/mannitol ratio for ANTI compared with CON (0.03 ± 0.01 vs. 0.27 ± 0.10; P < 0.05), indicating decreased intestinal permeability in the ANTI group.

Body and relative organ weight.

There was a slight net body weight gain in ANTI pigs, whereas the CON showed body weight loss (7.4 ± 5.1 vs. −6.9 ± 4.2 g/kg per day; P < 0.01, Table 2). Relative to body weight, the weight of liver, spleen, and colon were lower for ANTI, relative to CON (Table 2). In contrast, ANTI pigs had a higher relative weight of the small intestine (42.3 ± 2.1 vs. 28.6 ± 1.7 g/kg; P < 0.001, Table 3), and, consistent with this, dry weight mucosal proportion was higher for ANTI vs. CON pigs (72.6 ± 1.7 vs. 59.9 ± 2.0%; P < 0.001; Fig. 2, A and B).

Table 3.

Relative weight and length of small intestine, crypt depth, and villous height of proximal and distal small intestine for pigs in experiment 1

ANTI CON P Value
Small intestine
Total wet weight, g/kg 42.3 ± 2.1 28.6 ± 1.7 <0.001
Total length, cm/kg 306 ± 14 287 ± 16 ns
Crypts/villi, μm
    Proximal crypt depth 83.3 ± 3.2 76.4 ± 7.7 ns
    Proximal villous height 695 ± 66 490 ± 67 <0.05
    Distal crypt depth 88.6 ± 3.7 79.9 ± 7.0 ns
    Distal villous height 908 ± 45 569 ± 82 <0.001

Values are means ± SE.

Fig. 2.

Fig. 2.

Mucosal proportion, goblet cells, and inflammatory markers in experiment 1 for pigs given prophylactic antibiotics (open bars) or saline (solid bars). A: mucosal proportion of the small intestine. Representative histological hematoxylin and eosin-stained sections of the distal small intestine from pigs given prophylactic antibiotics (B, left) or saline (B, right) are shown. Arrows indicate hyperemia, and arrowheads indicate vascular coagulation. C: goblet cell ratio in colon. Representative histological Alcian Blue and Periodic Acid Shiff (PAS)-stained sections of the colon from pigs given antibiotics (D, left) with many goblet cells containing pink-stained mucus are shown together with sections from pigs given saline (controls, D, right) with few mucus-containing goblet cells. IL-1β and IL-8 in tissue from the distal small intestine in pigs given prophylactic antibiotics or saline (controls, E). Myeloperoxidase (MPO) in tissue from distal small intestine and colon in pigs given prophylactic antibiotics or saline (control, F). All values are means + SE (*P < 0.05, *** P < 0.001).

Histology.

ANTI pigs had higher villous length, both proximally and distally, compared with CON pigs, whereas no difference was found in crypt depth (Table 3). In the colon, the ANTI group had a higher proportion of mucin-containing goblet cells (35.5 ± 2.4 vs. 16.9 ± 2.2%; P < 0.001, Fig. 2, C and D). No difference was observed in the crypt area of the distal intestine with regard to goblet cells (Table 4). The percentage of vacuolated fetal-type enterocytes in the villous epithelium of the distal small intestine and colon was higher for the ANTI pigs (Table 4). The number of intraepithelial lymphocytes in the proximal intestine per 100 enterocytes was similar for ANTI and CON pigs (1.8 ± 0.1 vs. 1.8 ± 0.2, Table 4). Histopathology for the distal small intestine and colon is shown in Table 4.

Table 4.

Histopathology, goblet cell ratio, and vacuolated cell ratio in distal small intestine and colon and intraepithelial lymphocytes in proximal small intestine for pigs from experiment 1

ANTI CON P Value
Histopathology (Distal small intestine)
    Hyperemia, % 8.3 ± 4.3 60.9 ± 11.8 <0.01
    Congestion, % 11.4 ± 6.2 44.4 ± 12.5 0.07
    Villous sloughing, % 11.4 ± 7.0 34.8 ± 12.1 ns
Histopathology (Colon)
    Hyperemia, % 9.1 ± 9.1 55.4 ± 14.0 <0.01
    Congestion, % 9.1 ± 9.1 51.3 ± 13.9 <0.05
    Loss of epithelia, % 0.0 ± 0.0 52.3 ± 14.1 <0.01
Goblet cell ratio, distal, % 10.8 ± 1.0 11.3 ± 2.0 ns
Goblet cell ratio, colon, % 35.5 ± 2.4 16.9 ± 2.2 <0.001
Vacuolated cells, distal, % 100 ± 0 62 ± 14 <0.001
Vacuolated cells, colon, % 81 ± 9 31 ± 13 <0.01
Intra epithelial lymphocytes, proximal, % 1.8 ± 0.1 1.8 ± 0.2 ns

Values are means ± SE.

Tissue analyses.

The MPO activity was lowered for ANTI pigs in the distal small intestine (39.1 ± 10.0 vs. 73.8 ± 14.8 U/g protein; P ≤ 0.001) and colon (3.2 ± 0.2 vs. 10.2 ± 1.8 U/g protein; P < 0.001, Fig. 2E). No difference was found for the liver (16.8 ± 3.0 vs. 19.0 ± 3.2 U/g protein). IL1-β and IL-8 levels in the distal small intestine were lowered in ANTI pigs (Fig. 2F). No difference was found for IL-6 and TNF-α (data not shown). A higher activity of brush border enzymes was found in the intestine of ANTI pigs, except for maltase, which was higher in CON. There was no difference in DPP IV activity between treatments (Fig. 3).

Fig. 3.

Fig. 3.

Activity of brush border enzymes in pigs in experiment 1, given prophylactic antibiotics (ANTI, ◇) or saline (controls, CON, ■). Disaccharidases: lactase (A), sucrase (B), and maltase (C). Peptidases: aminopeptidase A (ApA, D), aminopeptidase N (ApN, E), and dipeptidylpeptidase IV (DPP IV, F). All values are means + SE. *P < 0.05, **P < 0.01, and ***P < 0.001.

Microarray analysis.

Of the genes differentially expressed between ANTI and CON pigs, 76 genes were affected in both the proximal and distal intestine (Fig. 4). Most of these genes (58 transcripts) showed reduced expression in ANTI pigs compared with CON animals. These included pancreatitis-associated protein 1 precursor (REG3A; 644-fold), calgranulin B (S100A9; 141-fold), macrophage inflammatory protein-2-α precursor (CXCL2; 50-fold), lysozyme C precursor (LYZ; 29-fold), pulmonary surfactant-associated protein D precursor (SFTPD; 26-fold), complement C5 precursor (C5; 24-fold), glutathione peroxidase-gastrointestinal (GPX2; 19-fold), and deleted malignant brain tumors 1 isoform b precursor (DMBT1; 18-fold). Arginase II mitochondrial precursor (ARG2) was also lower in ANTI pigs, and other immune-related genes that were reduced in expression in the small intestine included CD163 antigen isoform a (CD163), Toll-like receptor 2 precursor (TLR2), small inducible cytokine B6 precursor (CXCL6), and interleukin-8 precursor (IL8).

Fig. 4.

Fig. 4.

Affymetrix heat map from gene expression analysis in experiment 1, (n = 4 for ANTI and CON pigs for both proximal and distal small intestine).

Genes upregulated in ANTI pigs included L-threonine dehydrogenase on chromosome 8 (TDH; 229-fold), apolipoprotein C-II precursor (APOC4; 63-fold), cytochrome P450 2C18 (CYP2C18; 20-fold), F-box/WD-repeat protein 1 A (BTRC; 20-fold), and solute carrier family 2, facilitated glucose transporter, member 8 (SLC2A8; 10-fold). The most highly upregulated gene was TDH. In the expression of gene ontology terms, cellular nitrogen compound metabolic process (GO:0034641) and lipid localization (GO:0010876) were significantly increased in the proximal intestine of ANTI pigs (Supplemental Tables S1 and S2; supplemental material for this article is available online at the American Journal of Physiology Gastrointestinal and Liver Physiology website), with the highest upregulation found for the genes apolipoprotein C-II precursor (APOC4) and estradiol 17-β-dehydrogenase 2 (HSD17B2).

The up- or downregulation of genes were consistent between the microarray results and the RT-PCR analyses (Table 5) although the magnitude of fold change varied between different target genes (primer sequences are shown in Table 6). Significantly enriched MetaCore pathways of interest for both proximal and distal small intestine included the classical, alternative, the lectin-induced complement pathways and immune response C5a signaling (also from the complement system). The proximal IL-6 and distal NF-κB signaling pathways were also significantly affected by the antibiotics treatment for 5 days (Table 7 and 8).

Table 7.

Top 20 MetaCore pathways that were significantly enriched in the proximal small intestine of pigs from experiment 1 (ANTI vs. CON)

# Maps P Value Genes Significantly Affected of Total Genes in Pathway
1 Immune response_Classical complement pathway 0.00000 13/52
2 Immune response_Lectin induced complement pathway 0.00000 12/49
3 Immune response_Alternative complement pathway 0.00000 11/39
4 Development_EGFR signaling pathway 0.00002 8/63
5 Retinol metabolism/Rodent version 0.00003 8/68
6 Retinol metabolism 0.00004 8/72
7 Cytokine production by Th17 cells in CF 0.00006 6/39
8 Immune response_Delta-type opioid receptor signaling in T-cells 0.00015 5/29
9 Immune response_Gastrin in inflammatory response 0.00024 7/69
10 Cytokine production by Th17 cells in CF (Mouse model) 0.00024 6/49
11 Immune response_C5a signaling 0.00027 6/50
12 Immune response_Role of the Membrane attack complex in cell survival 0.00034 5/34
13 Immune response_CCR5 signaling in macrophages and T lymphocytes 0.00060 6/58
14 Immune response_IL-27 signaling pathway 0.00084 4/24
15 Development_Role of IL-8 in angiogenesis 0.00111 6/65
16 G-protein signaling_Ras family GTPases in kinase cascades (scheme) 0.00114 4/26
17 Development_EPO-induced MAPK pathway 0.00126 5/45
18 Development_HGF signaling pathway 0.00153 5/47
19 Immune response_IL-6 signaling pathway 0.00224 4/31
20 Development_EGFR signaling via small GTPases 0.00284 4/31

Significance was determined at P < 0.05, FC >2.

Table 8.

Top 25 MetaCore pathways significantly enriched in the distal small intestine of pigs from experiment 1 (ANTI vs. CON)

# Maps P Value Genes Significantly Affected of Total Genes in Pathway
1 Immune response_Classical complement pathway 0.00000 20/52
2 Immune response_Lectin induced complement pathway 0.00000 16/49
3 Immune response_Alternative complement pathway 0.00000 14/39
4 Bacterial infections in CF airways 0.00000 15/58
5 Immune response_Bacterial infections in normal airways 0.00000 14/50
6 Cell adhesion_ECM remodeling 0.00000 12/52
7 Immune response_Histamine H1 receptor signaling in immune response 0.00000 11/48
8 Immune response_HMGB1/RAGE signaling pathway 0.00000 11/53
9 Immune response_IL-1 signaling pathway 0.00000 10/44
10 Immune response_Role of HMGB1 in dendritic cell maturation and migration 0.00000 8/27
11 Cytokine production by Th17 cells in CF 0.00001 9/39
12 Apoptosis and survival_Role of IAP-proteins in apoptosis 0.00001 8/31
13 Cell adhesion_Chemokines and adhesion 0.00002 14/100
14 Immune response_IFN alpha/beta signaling pathway 0.00002 7/24
15 Immune response_HSP60 and HSP70/TLR signaling pathway 0.00002 10/54
16 Immune response_Oncostatin M signaling via JAK-Stat in mouse cells 0.00003 6/18
17 Immune response_Oncostatin M signaling via MAPK in mouse cells 0.00003 8/35
18 Development_Prolactin receptor signaling 0.00005 10/58
19 Immune response_Oncostatin M signaling via MAPK in human cells 0.00005 8/37
20 Immune response_Oncostatin M signaling via JAK-Stat in human cells 0.00006 6/20
21 Cytokine production by Th17 cells in CF (Mouse model) 0.00007 9/49
22 Transcription_NF-kB signaling pathway 0.00007 8/39
23 Immune response_C5a signaling 0.00008 9/50
24 Immune response_Signaling pathway mediated by IL-6 and IL-1 0.00009 7/30
25 Immune response_MIF in innate immunity response 0.00009 8/40

Significance was set at P < 0.05, FC >2.

Microbial community.

The bacterial density, expressed as CFU/ml in caecum contents, was reduced in ANTI pigs after culture on calf blood agar (aerobically: 2.6 × 105 ± 1.1 × 105 vs. 7.5 × 109 ± 1.4 × 109 CFU/ml, P < 0.001; and anaerobically: 2.6 × 105 ± 1.1 × 105 vs. 7.6 × 109 ± 1.4 × 109 CFU/ml, P < 0.001, Fig. 5A). Sequencing of the 16S rRNA gene of cultivated colonies from ANTI pigs revealed that the following six species, had survived the antimicrobial treatment: Bacillus cereus, Clostridium paraputrificum, Clostridium perfringens, Cronobacter sakazakii, Enterococcus faecium/hirae, and Staphylococcus pasteuri.

Fig. 5.

Fig. 5.

Aerobic and anaerobic colony-forming units in pigs in experiment 1 (A), given prophylactic antibiotics (ANTI, open bars) or saline (controls, CON, solid bars). Concentration of dominating and total organic acids in stomach and colon contents of pigs in experiment 1 (B), given prophylactic antibiotics (ANTI) or saline (controls, CON). Absolute intensity of dominating terminal restriction fragments in pigs given prophylactic antibiotics (open bars) or saline (controls, solid bars) in experiment 1 (C). All values are means + SE (*P < 0.05, **P < 0.01, and ***P < 0.001).

T-RFLP analysis with restriction enzyme CfoI revealed a total of 14 different T-RFs ranging from 204 to 610 base pairs (bp) in contents from the distal small intestine. In total, 10 T-RFs were detected in ANTI, with an average of 1.7 ± 0.9 T-RFs per ANTI pig and lower relative to CON, where a total of 14 T-RFs with an average of 6.4 ± 0.6 T-RFs were found (P < 0.001). The semiquantitative, total intensity of all T-RFs in the ANTI pigs was lower than in CON pigs (3,624 ± 1,821 vs. 19,231 ± 1,176; P < 0.001). Ten T-RFs were shared between the groups, including the four most abundant T-RFs (217, 232, 373, and 594 bp). To further characterize the composition of the bacterial community, mean intensity values were calculated. Comparison revealed significant difference in intensity for T-RFs with 204, 217, 232, 570, and 594 bp (Fig. 5C). However, enough bacterial DNA was obtained from only four ANTI pigs (reflecting the low bacterial density), which compromised the T-RFLP analyses. According to the swine-specific database of OTU using the Cfo I restriction enzyme (35), and the in silico digest in the MiCA software (http://mica.ibest.uidaho.edu/digest.php) using the RDPII database, T-RFs with bp 217, 232, and 373 were identified as Enterococcus, Clostridium perfringens, and Enterobacter. Bp 570 and 594 remain unidentified. OTU 217, Enterococcus, and OTU 232, Clostridium perfringens, have repeatedly been identified to be associated with advanced NEC in preterm pigs (6, 53, 59). The total concentration of OAs in the stomach tended to be lower for ANTI pigs (32.0 ± 5.9 vs. 62.0 ± 14.6; P < 0.07). For the colon, the values were markedly lower for ANTI compared with CON (0.95 ± 0.43 vs. 54.8 ± 6.34; P < 0.001, Fig. 5B).

Experiment 2

All CON pigs had to be euthanized before the planned end of the experiment on day 10, whereas all ANTI pigs were vital at the end of the experiment. The NEC incidence was lower in ANTI compared with CON pigs (0/9 = 0% vs. 9/9 100%; P < 0.001, Fig. 1B). Median severity was lower in ANTI relative to CON pigs (stomach: 1 in ANTI vs. 5 in CON; proximal intestine: 1 in ANTI vs. 4 in CON; middle intestine: 1 in ANTI vs. 3 in CON; distal intestine: 1 in ANTI vs. 4 in CON; and colon: 1 in ANTI vs. 4 in CON). The overall median score across all gastrointestinal regions was 1 in ANTI vs. 4 in CON; P < 0.001.

DISCUSSION

The exact etiology of NEC onset remains uncertain, but two dominant prerequisite factors associated with the disease are prematurity (37) and gut microbial colonization (53). The most convincing evidence that implicates the gut microbiota as a necessary factor in the pathogenesis of NEC is from studies in gnotobiotic pigs and quail (53, 68). The clinical evidence for a necessary link between the gut microbiota and NEC is less definitive but includes the hallmark features of pneumatosis intestinalis, intraluminal bowel gas, and abdominal distension, all suggesting a bacterial component, either in the form of general overgrowth or a distorted diversity leading to detrimental tissue responses induced by a single or few pathogens. In the present study, we show that a lowered gut bacterial density, and a delayed colonization following neonatal antibiotics treatment, completely prevented NEC in preterm pigs and that these effects were associated with a broad range of improvements in structural, functional, and immunological indices in the immature intestine.

In clinical conditions, interpretation of the effects of the gut microbiota on NEC risk is complicated by the frequent treatment with antibiotics soon after birth, typically as a precaution or therapy against sepsis. Some clinical studies have supported the use of antibiotics in the treatment or prevention of NEC (10, 46, 63), but, until now, there is no general clinical consensus. Concerns about bacterial resistance problems and also delayed negative effects are justified, as retrospective cohort analyses show that prolonged antibiotic therapy is associated with increased risk of NEC (14, 32).

We confirmed that antibiotic treatment delayed microbial colonization and reduced bacterial diversity and total abundance of microbial species (about 10,000-fold). Antibiotics markedly reduced the number of cecal T-RFs, representing putative bacterial species, thus suggesting lower diversity in treated pigs relative to controls. Importantly, T-RFLP analysis showed that antibiotics markedly decreased the abundance of Enterococcus (T-RF 217) and Clostridium perfringens (T-RF 232), both species that we repeatedly have identified to be associated with advanced NEC in preterm pigs (6, 53, 59), and they have also been observed in preterm infants (30). Interestingly, Cronobacter sakazakii, which has been associated with NEC in infants (23), was found among the few species detected in the cecal contents of the ANTI pigs, suggesting that the strain is not causative of NEC. The reduced level of the bacterial fermentation products in the stomach and colon confirmed the reduced bacterial load in the ANTI group.

The suppression of bacterial colonization by antibiotics was associated with markedly improved intestinal structure, digestive function, and innate immunity indices. Intestinal mucosal mass, villous height, and hydrolase enzyme activities were all significantly higher in ANTI vs. CON pigs, and, for mucosal mass and villous height, values in ANTI pigs were similar to those found in colostrum-fed, NEC-resistant preterm pigs (6, 13, 59). Potentially, malabsorption of dietary carbohydrate creates a favorable luminal environment for bacterial overgrowth that then triggers inflammation. Antibiotics also preserved innate immune function, and there was a markedly higher density of mucus-producing goblet cells in the colon in ANTI vs. CON pigs. Production and secretion of mucus by goblet cells are accelerated when challenged by pathogens (18). The reduced number of mucin-containing goblet cells in the CON pigs indicates mucin depletion induced by an accelerated secretion to the lumen in response to a high-density microbiota.

The density of intestinal IELs was very low, and this confirms the immaturity of gut immunity in preterm pigs, as the IEL cell densities in both groups were substantially lower than those reported for term pigs during the first week of life, but higher than those reported in specific pathogen-free pigs (51). Immature intestinal epithelial cells may mediate an exaggerated inflammatory response to both commensal and pathogenic bacteria in the inflamed gut of NEC neonates (42).

Histopathological analysis showed that the extent of intestinal congestive coagulopathy, inflammatory infiltrates, and epithelial sloughing were markedly lowered in ANTI pigs. These changes in intestinal mucosal integrity also support the improved intestinal barrier function reflected in the lower urinary lactulose/mannitol ratios in ANTI pigs. The pathogenesis of NEC is characterized by the deterioration of intestinal mucosal structure, digestive function, and barrier function, which ultimately leads to proinflammatory responses and tissue injury. Our results show that antibiotic treatment dampened the mucosal inflammatory response and the extent of tissue injury. Consistent with this, we observed lowered MPO and proinflammatory cytokine concentrations in the distal small intestine and colon of ANTI pigs. The finding that the number of vacuolated fetal type enterocytes was elevated in ANTI pigs suggests that this dampened inflammatory state delayed the functional maturation of the intestinal epithelium (50).

The microarray analysis revealed data consistent with the above mentioned analyses at the structural and functional levels. REG3A is part of the regenerating gene family, similar to C-type lectins. Members of the REG3A family play an important role in controlling the cross talk between the microbiota and the host (67) and are significantly elevated in states of inflammation, like in the present CON pigs. Another important indicator of bacteria-host interactions is the synthesis of intestinal glycoproteins, such as mucins, which are essential for intestinal barrier function (49). Mucin-containing goblet cells were markedly increased in number in the ANTI pigs, and this may relate to the highly upregulated L-threonine dehydrogenase gene (TDH), which catabolizes the mucin substrate threonine.

S100A9 is a phagocyte-derived, endogenous activator of innate immune responses. S100A9 is abundantly expressed throughout the lamina propria and epithelium of the inflamed gut mucosa and is used as a disease index in pediatric patients with inflammatory bowel disease (IBD) (33). Complexes of S100A8/S100A9 (calprotectin) are also ligands of Toll-like receptor 4 (21) and contribute to ongoing innate immune activation in inflammatory disease states. CD163 is produced by activated macrophages and elevated in inflammatory diseases (20, 28), whereas both IL8 and CXCL6 are potent neutrophil chemoattractants. The reduced levels of MPO in the ANTI pigs are consistent with the reduction in these inflammatory chemokines.

GPX2, a member of the glutathione peroxidase family, is highly expressed in mucosal epithelial cells, especially in the crypt area. It is involved in glutathione-dependent hydrogen peroxide-reducing activity and responds to the luminal microbiota, and it has been proposed to have an anti-inflammatory role (9, 19). LYZ is an antimicrobial peptide secreted by activated monocytes that damages bacterial cell walls by catalyzing hydrolysis of peptidoglycan of Gram-positive bacteria. Like GPX2, it is elevated in inflamed tissue in response to infection, and it is thought to function in a negative-feedback system designed to antagonize the inflammatory response (22).

SFTPD is a C-type lectin carbohydrate recognition molecule of innate immunity and a chemoattractant for macrophages. It acts as an opsonin and in this way can attenuate bacterial and viral infection (24, 34). SFTPD directly interacts with DMBT1, which agglutinates both Gram-negative and Gram-positive bacteria (39). Interestingly, this surfactant protein has been identified as a genetic risk factor for respiratory distress syndrome and bronchopulmonary dysplasia in preterm infants (52) and in patients with IBD (62). Here we report for the first time the expression of this gene in NEC and suggest that it may also provide a measure of disease severity and potentially represents a genetic risk factor for NEC. Arginine is a versatile amino acid that has a key role in immunity and barrier function, and its degradation depends on the enzyme ARG2 in enterocytes. Arginine supplementation has previously been shown to reduce NEC (2, 48), and in fact arginine supplementation has been considered as a prophylactic treatment for NEC (57). The reduced level of ARG2 in ANTI pigs would suggest higher levels of tissue and plasma arginine and may also have contributed to the reduction in incidence and severity of NEC in the ANTI preterm pigs.

To summarize the transcriptomics analysis, the top genes expressed at significantly lower levels in ANTI pigs were mostly involved in the innate immune response to the microbiota and to inflammation. Functional analysis of the transcriptome response using GeneGo MetaCore and Gene Ontology analysis further confirmed that antibiotics had the greatest impact on inflammatory and innate immune responses, with the downregulation of immune pathways such as the complement pathways and those known from bacterial infections in airways. Whether the higher expression of these genes in CON animals is due to an inappropriate response to the microbiota in premature animals, a defense against bacterial overgrowth in the lumen, or a reaction to certain pathobionts within the microbiota of NEC-susceptible pigs remains to be determined.

An important concern is that widespread use of antibiotics may be associated with the emergence of antibiotic-resistant organisms, and recent reports have also linked early antibiotic exposure to later onset of adiposity and obesity (12, 66). In experiment 2, we made a preliminary study of effects beyond the initial 5 days of antibiotics and did not find any reappearance of NEC sensitivity when antibiotic treatment was discontinued and the gut was allowed to be fully colonized. All pigs were vital but suffered from degrees of diarrhea, which we speculate could have been solved by different types of medication or probiotics (4, 16).

The current results are consistent with a model of NEC pathogenesis that begins when the immature intestine is stressed by the malabsorption of dietary nutrients, leading to excessive bacterial growth and fermentation in the distal part of the small intestine and colon. The premature intestine cannot adapt to a high microbial load due to immature innate immune and gut barrier function, as well as the lack of protection from the immunological components normally ingested via colostrum and milk (56). These factors contribute directly or indirectly to the bacterial overgrowth, higher concentration of OAs in the distal intestine, the marked deterioration of the physiochemical intestinal barrier, and elevated inflammation and tissue injury, all of which culminate in NEC. Our current results show novel evidence that prophylactic treatment with antibiotics completely prevented NEC in premature pigs. This striking result further confirms our previous evidence (5, 53) showing that bacterial colonization is a necessary element of NEC pathogenesis in preterm pigs. We suggest that the general inhibition of bacterial growth is key among the mechanisms whereby antibiotics prevent NEC although we cannot exclude that the antibiotics may have worked by specifically targeting bacterial species implicated in the pathogenesis of NEC. Further research could address this issue by examining the effects of narrow-spectrum, highly targeted antibiotics. Our results with premature pigs provide experimental evidence that sustained administration of antibiotics beyond the first few days of life may protect against NEC in preterm infants. This short-term beneficial response must be balanced against the possible later adverse consequences of neonatal antibiotic treatment.

GRANTS

This work was supported financially by the Danish Strategic Research Councils.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

Author contributions: M.L.J., T.T., M.S.C., and P.T.S. conception and design of research; M.L.J., T.T., M.S.C., M.L., and M.S. performed experiments; M.L.J., L.M., B.B.J., D.K., I.M., and D.G.B. analyzed data; M.L.J., T.T., D.K., I.M., and P.T.S. interpreted results of experiments; M.L.J. prepared figures; M.L.J., D.K., I.M., and D.G.B. drafted manuscript; M.L.J., T.T., M.S.C., M.L., L.M., B.B.J., D.K., I.M., D.G.B., and P.T.S. edited and revised manuscript; M.L.J., T.T., M.S.C., M.L., L.M., B.B.J., M.S., D.K., I.M., D.G.B., and P.T.S. approved final version of manuscript.

Supplementary Material

Table S1
tableS1.pdf (41.3KB, pdf)
Table S2
tableS2.pdf (41.7KB, pdf)
Table S3
tableS3.pdf (218.8KB, pdf)
Table S4
tableS4.pdf (378KB, pdf)

ACKNOWLEDGMENTS

We thank Andreas Vegge, Elin Skytte, and Kristina Møller from Department of Nutrition, Exercise and Sports, Faculty of Science and Mandy Grieg from Department of Large Animal Sciences, Faculty of Health and Medical Sciences, University of Copenhagen, Denmark for technical support with animal procedures and subsequent laboratory analyses. We also thank Annie Ravn Pedersen at the National Veterinary Institute, Copenhagen and Thomas Rebsdorf at Faculty of Agricultural Sciences, Aarhus University, Aarhus, Denmark for assistance with laboratory, microbiological, and short-chain fatty acid analyses, respectively. Finally, we thank Christian Ritz from Department of Nutrition, Exercise and Sports, University of Copenhagen, for statistical advice.

REFERENCES

  • 1.Alexander VN, Northrup V, Bizzarro MJ. Antibiotic exposure in the newborn intensive care unit and the risk of necrotizing enterocolitis. J Pediatr 159: 392–397, 2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Amin HJ, Zamora SA, McMillan DD, Fick GH, Butzner JD, Parsons HG, Scott RB. Arginine supplementation prevents necrotizing enterocolitis in the premature infant. J Pediatr 140: 425–431, 2002. [DOI] [PubMed] [Google Scholar]
  • 3.Anand RJ, Leaphart CL, Mollen KP, Hackam DJ. The role of the intestinal barrier in the pathogenesis of necrotizing enterocolitis. [Review]. Shock 27: 124–133, 2007. [DOI] [PubMed] [Google Scholar]
  • 4.Bernardo WM, Aires FT, Carneiro RM, de Sa FP, Vagnozzi Rullo VE, Burns DA. Effectiveness of probiotics in the prophylaxis of necrotizing enterocolitis in preterm neonates: A systematic review and meta-analysis. J Pediatr 89: 18–24, 2013. [DOI] [PubMed] [Google Scholar]
  • 5.Bjornvad CR, Schmidt M, Petersen YM, Jensen SK, Offenberg H, Elnif J, Sangild PT. Preterm birth makes the immature intestine sensitive to feeding-induced intestinal atrophy. Am J Physiol Regul Integr Comp Physiol 289: R1212–R1222, 2005. [DOI] [PubMed] [Google Scholar]
  • 6.Bjornvad CR, Thymann T, Deutz NE, Burrin DG, Jensen SK, Jensen BB, Molbak L, Boye M, Larsson LI, Schmidt M, Michaelsen KF, Sangild PT. Enteral feeding induces diet-dependent mucosal dysfunction, bacterial proliferation, and necrotizing enterocolitis in preterm pigs on parenteral nutrition. Am J Physiol Gastrointest Liver Physiol 295: G1092–G1103, 2008. [DOI] [PubMed] [Google Scholar]
  • 7.Blood J, Ingle AR, Allison N, Davies GR, Hill PG. Rapid enzymatic method for the measurement of mannitol in urine. Ann Clin Biochem 28: 401–406, 1991. [DOI] [PubMed] [Google Scholar]
  • 8.Boccia D, Stolfi I, Lana S, Moro ML. Nosocomial necrotising enterocolitis outbreaks: epidemiology and control measures. Eur J Pediatr 160: 385–391, 2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Brigelius-Flohe R, Kipp AP. Physiological functions of GPx2 and its role in inflammation-triggered carcinogenesis. Ann NY Acad Sci 1259: 19–25, 2012. [DOI] [PubMed] [Google Scholar]
  • 10.Bury RG, Tudehope D. Enteral antibiotics for preventing necrotizing enterocolitis in low birthweight or preterm infants. Cochrane Database Syst Rev CD000405, 2001. [DOI] [PubMed] [Google Scholar]
  • 11.Canibe N, Hojberg O, Badsberg JH, Jensen BB. Effect of feeding fermented liquid feed and fermented grain on gastrointestinal ecology and growth performance in piglets. J Anim Sci 85: 2959–2971, 2007. [DOI] [PubMed] [Google Scholar]
  • 12.Cho I, Yamanishi S, Cox L, Methe BA, Zavadil J, Li K, Gao Z, Mahana D, Raju K, Teitler I, Li HL, Alekseyenko AV, Blaser MJ. Antibiotics in early life alter the murine colonic microbiome and adiposity. Nature 488: 621–626, 2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Cilieborg MS, Boye M, Thymann T, Jensen BB, Sangild PT. Diet-dependent effects of minimal enteral nutrition on intestinal function and necrotizing enterocolitis in preterm pigs. JPEN J Parenter Enteral Nutr 35: 32–42, 2011. [DOI] [PubMed] [Google Scholar]
  • 14.Cordero L, Ayers LW. Duration of empiric antibiotics for suspected early-onset sepsis in extremely low birth weight infants. JPEN J Parenter Enteral Nutr 24: 662–666, 2003. [DOI] [PubMed] [Google Scholar]
  • 15.Cotten CM, Taylor S, Stoll B, Goldberg RN, Hansen NI, Sanchez PJ, Ambalavanan N, Benjamin DK. Prolonged duration of initial empirical antibiotic treatment is associated with increased rates of necrotizing enterocolitis and death for extremely low birth weight infants. Pediatrics 123: 58–66, 2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Downard CD, Renaud E, St Peter SD, Abdullah F, Islam S, Saito JM, Blakely ML, Huang EY, Arca MJ, Cassidy L, Aspelund G. Treatment of necrotizing enterocolitis: an american pediatric surgical association outcomes and clinical trials committee systematic review. J Pediatr Surg 47: 2111–2122, 2012. [DOI] [PubMed] [Google Scholar]
  • 17.Du Z, Zhou X, Ling Y, Zhang Z, Su Z. agriGO: a GO analysis toolkit for the agricultural community. Nucleic Acids Res 38: W64–W70, 2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Epple HJ, Kreusel KM, Hanski C, Schulzke JD, Riecken EO, Fromm M. Differential stimulation of intestinal mucin secretion by cholera toxin and carbachol. Pflügers Arch 433: 638–647, 1997. [DOI] [PubMed] [Google Scholar]
  • 19.Esworthy R, Smith D, Chu F. A strong impact of genetic background on gut microflora in mice. Int J Inflam 1: 1–12, 2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Etzerodt A, Moestrup SK. CD163 and inflammation: biological, diagnostic, and therapeutic aspects. Antioxid Redox Signal 18: 2352–2363, 2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Foell D, Wittkowski H, Ren Z, Turton J, Pang G, Daebritz J, Ehrchen J, Heidemann J, Borody T, Roth J, Clancy R. Phagocyte-specific S100 proteins are released from affected mucosa and promote immune responses during inflammatory bowel disease. J Pathol 216: 183–192, 2008. [DOI] [PubMed] [Google Scholar]
  • 22.Gordon L, I, Douglas SD, Kay NE, Yamada O, Osserman EF, Jacob HS. Modulation of neutrophil function by lysozyme potential negative feedback system of inflammation. J Clin Invest 64: 226–232, 1979. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Grishin A, Papillon S, Bell B, Wang J, Ford HR. The role of the intestinal microbiota in the pathogenesis of necrotizing enterocolitis. Semin Pediatr Surg 22: 69–75, 2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Guo CJ, Atochina-Vasserman EN, Abramova E, Foley JP, Zaman A, Crouch E, Beers MF, Savani RC, Gow AJ. S-nitrosylation of surfactant protein-D controls inflammatory function. PLoS Biol 6: 2414–2423, 2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Hackam DJ, Upperman JS, Grishin A, Ford HR. Disordered enterocyte signaling and intestinal barrier dysfunction in the pathogenesis of necrotizing enterocolitis. Semin Pediatr Surg 14: 49–57, 2005. [DOI] [PubMed] [Google Scholar]
  • 27.Jensen MT, Cox RP, Jensen BB. Microbial-production of skatole in the hind gut of pigs given different diets and its relation to skatole deposition in backfat. Anim Sci 61: 293–304, 1995. [Google Scholar]
  • 28.Jude C, Dejica D, Samasca G, Balacescu L, Balacescu O. Soluble CD163 serum levels are elevated and correlated with IL-12 and CXCL10 in patients with long-standing rheumatoid arthritis. Rheumatol Int 33: 1031–1037, 2013. [DOI] [PubMed] [Google Scholar]
  • 29.Kansagra K, Stoll B, Rognerud C, Niinikoski H, Ou CN, Harvey R, Burrin D. Total parenteral nutrition adversely affects gut barrier function in neonatal piglets. Am J Physiol Gastrointest Liver Physiol 285: G1162–G1170, 2003. [DOI] [PubMed] [Google Scholar]
  • 30.Kliegman RM, Fanaroff AA. Necrotizing enterocolitis. N Engl J Med 310: 1093–1103, 1984. [DOI] [PubMed] [Google Scholar]
  • 31.Krawisz JE, Sharon P, Stenson WF. Quantitative assay for acute intestinal inflammation based on myeloperoxidase activity—assessment of inflammation in rat and hamster models. Gastroenterology 87: 1344–1350, 1984. [PubMed] [Google Scholar]
  • 32.Kuppala VS, Meinzen-Derr J, Morrow AL, Schibler KR. Prolonged initial empirical antibiotic treatment is associated with adverse outcomes in premature infants. J Pediatr 159: 720–725, 2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Leach ST, Yang Z, Messina I, Song CJ, Geczy CL, Cunningham AM, Day AS. Serum and mucosal S100 proteins, calprotectin (S100A8/S100A9) and S100A12, are elevated at diagnosis in children with inflammatory bowel disease. Scand J Gastroenterol 42: 1321–1331, 2007. [DOI] [PubMed] [Google Scholar]
  • 34.Ledford JG, Pastva AM, Wright JR. Collectins link innate and adaptive immunity in allergic airway disease. Innate Immun 16: 183–190, 2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Leser TD, Lindecrona RH, Jensen TK, Jensen BB, Moller K. Changes in bacterial community structure in the colon of pigs fed different experimental diets and after infection with Brachyspira hyodysenteriae. Appl Environ Microbiol 66: 3290–3296, 2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Lin PW, Nasr TR, Stoll BJ. Necrotizing enterocolitis: Recent scientific advances in pathophysiology and prevention. Semin Perinatol 32: 70–82, 2008. [DOI] [PubMed] [Google Scholar]
  • 37.Lin PW, Stoll BJ. Necrotising enterocolitis. Lancet 368: 1271–1283, 2006. [DOI] [PubMed] [Google Scholar]
  • 38.Lodha A, Furlan AD, Whyte H, Moore AM. Prophylactic antibiotics in the prevention of catheter-associated bloodstream bacterial infection in preterm neonates: a systematic review. J Perinatol 28: 526–533, 2008. [DOI] [PubMed] [Google Scholar]
  • 39.Madsen J, Mollenhauer J, Holmskov U. Gp-340/DMBT1 in mucosal innate immunity. Innate Immun 16: 160–167, 2010. [DOI] [PubMed] [Google Scholar]
  • 40.Molbak L, Thomsen LE, Jensen TK, Knudsen KEB, Boye M. Increased amount of Bifidobacterium thermacidophilum and Megasphaera elsdenii in the colonic microbiota of pigs fed a swine dysentery preventive diet containing chicory roots and sweet lupine. J Appl Microbiol 103: 1853–1867, 2007. [DOI] [PubMed] [Google Scholar]
  • 41.Mulder IE, Schmidt B, Stokes CR, Lewis M, Bailey M, Aminov RI, Prosser JI, Gill BP, Pluske JR, Mayer CD, Musk CC, Kelly D. Environmentally-acquired bacteria influence microbial diversity and natural innate immune responses at gut surfaces. BMC Biol 7: 2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Nanthakumar NN, Fusunyan RD, Sanderson I, Walker WA. Inflammation in the developing human intestine: A possible pathophysiologic contribution to necrotizing enterocolitis. Proc Natl Acad Sci USA 97: 6043–6048, 2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Neu J. The ‘myth’ of asphyxia and hypoxia-ischemia as primary causes of necrotizing enterocolitis. Biol Neonate 87: 97–98, 2005. [DOI] [PubMed] [Google Scholar]
  • 44.Neu J, Walker WA. Medical progress: necrotizing enterocolitis. N Engl J Med 364: 255–264, 2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Neu J, Chen M, Beierle E. Intestinal innate immunity: How does it relate to the pathogenesis of necrotizing enterocolitis. Semin Pediatr Surg 14: 137–144, 2005. [DOI] [PubMed] [Google Scholar]
  • 46.Ng YY, Su PH, Chen JY, Quek YW, Hu JM, Lee IC, Lee HS, Chang HP. Efficacy of intermediate-dose oral erythromycin on very low birth weight infants with feeding intolerance. Pediatr Neonatol 53: 34–40, 2012. [DOI] [PubMed] [Google Scholar]
  • 46a.Ozdemir ÍMA, Ergin H, Yenisey Ã, Türk NS, Simsek NG. Protective effects of clarithromycin in rats with hypoxia/reoxygenation-induced intestinal injury. J Pediatr Surg 45: 2169–2174, 2010. [DOI] [PubMed] [Google Scholar]
  • 47.Peter CS, Feuerhahn M, Bohnhorst B, Schlaud M, Ziesing S, von der Hardt H, Poets CF. Necrotising enterocolitis: is there a relationship to specific pathogens? Eur J Pediatr 158: 67–70, 1999. [DOI] [PubMed] [Google Scholar]
  • 48.Polycarpou E, Gavrili S, Zachaki S, Papaevangelou V, Tsolia M, Kostalos C, Kafetzis D. Oral arginine supplementation reduces the incidence of necrotizing entrocolitis (nec) in very low birth weight (Vlbw). Acta Paediatr 100: 15, 2011. [Google Scholar]
  • 49.Puiman PJ, Jensen M, Stoll B, Renes IB, de Bruijn ACJM, Dorst K, Schierbeek H, Schmidt M, Boehm G, Burrin DG, Sangild PT, van Goudoever JB. Intestinal threonine utilization for protein and mucin synthesis is decreased in formula-fed preterm pigs. J Nutr 141: 1306–1311, 2011. [DOI] [PubMed] [Google Scholar]
  • 50.Radberg K, Biernat M, Linderoth A, Zabielski R, Pierzynowski SG, Westrom BR. Enteral exposure to crude red kidney bean lectin induces maturation of the gut in suckling pigs. J Anim Sci 79: 2669–2678, 2001. [DOI] [PubMed] [Google Scholar]
  • 51.Rothkotter H, Mollhoff S, Pabst R. The influence of age and breeding conditions on the number and proliferation of intraepithelial lymphocytes in pigs. Scand J Immunol 50: 31–38, 1999. [DOI] [PubMed] [Google Scholar]
  • 52.Ryckman K, Dagle J, Kelsey K, Momany A, Murray J. Genetic associations of surfactant protein D and angiotensin-converting enzyme with lung disease in preterm neonates. J Perinatol 32: 349–355, 2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Sangild PT, Siggers RH, Schmidt M, Elnif J, Bjornvad CR, Thymann T, Grondahl ML, Hansen AK, Jensen SK, Boye M, Moelbak L, Buddington RK, Westrom BR, Holst JJ, Burrin DG. Diet- and colonization-dependent intestinal dysfunction predisposes to necrotizing enterocolitis in preterm pigs. Gastroenterology 130: 1776–1792, 2006. [DOI] [PubMed] [Google Scholar]
  • 54.Sangild PT, Sjostrom H, Noren O, Fowden AL, Silver M. The prenatal development and glucocorticoid control of brush-border hydrolases in the pig small intestine. Pediatr Res 37: 207–212, 1995. [DOI] [PubMed] [Google Scholar]
  • 55.Schnabl KL, Van Aerde JE, Thomson AB, Clandinin MT. Necrotizing enterocolitis: A multifactorial disease with no cure. World J Gastroenterol 14: 2142–2161, 2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Shah NP. Effects of milk-derived bioactives: An overview. Br J Nutr 84: S3–S10, 2000. [DOI] [PubMed] [Google Scholar]
  • 57.Shah P, Shah V. Arginine supplementation for prevention of necrotising enterocolitis in preterm infants. Cochrane Database Syst Rev 2007: CD004339, 2007. [DOI] [PubMed] [Google Scholar]
  • 58.Siggers RH, Siggers J, Boye M, Thymann T, Molbak L, Leser T, Jensen BB, Sangild T. Early administration of probiotics alters bacterial colonization and limits diet-induced gut dysfunction and severity of necrotizing enterocolitis in preterm pigs. J Nutr 138: 1437–1444, 2008. [DOI] [PubMed] [Google Scholar]
  • 59.Siggers RH, Thymann T, Jensen BB, Molbak L, Heegaard PMH, Schmidt M, Buddington RK, Sangild PT. Elective cesarean delivery affects gut maturation and delays microbial colonization but does not increase necrotizing enterocolitis in preterm pigs. Am J Physiol Regul Integr Comp Physiol 294: R929–R938, 2008. [DOI] [PubMed] [Google Scholar]
  • 60.Smyth GK. Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat Appl Genet Mol Biol 3: Article3, 2004. [DOI] [PubMed] [Google Scholar]
  • 61.Suzuki K, Ota H, Sasagawa S, Sakatani T, Fujikura T. Assay-method for myeloperoxidase in human polymorphonuclear leukocytes. Anal Biochem 132: 345–352, 1983. [DOI] [PubMed] [Google Scholar]
  • 62.Tanaka M, Arimura Y, Goto A, Hosokawa M, Nagaishi K, Yamashita K, Yamamoto H, Sonoda T, Nomura M, Motoya S, Imai K, Shinomura Y. Genetic variants in surfactant, pulmonary-associated protein D (SFTPD) and japanese susceptibility to ulcerative colitis. Inflamm Bowel Dis 15: 918–925, 2009. [DOI] [PubMed] [Google Scholar]
  • 63.Thompson AM, Bizzarro MJ. Necrotizing enterocolitis in newborns: pathogenesis, prevention and management. Drugs 68: 2008. [DOI] [PubMed] [Google Scholar]
  • 64.Thymann T, Burrin DG, Tappenden KA, Bjornvad CR, Jensen SK, Sangild PT. Formula-feeding reduces lactose digestive capacity in neonatal pigs. Br J Nutr 95: 1075–1081, 2006. [DOI] [PubMed] [Google Scholar]
  • 65.Thymann T, Moller HK, Stoll B, Stoy ACF, Buddington RK, Bering SB, Jensen BB, Olutoye OO, Siggers RH, Molbak L, Sangild PT, Burrin DG. Carbohydrate maldigestion induces necrotizing enterocolitis in preterm pigs. Am J Physiol Gastrointest Liver Physiol 297: G1115–G1125, 2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Trasande L, Blustein J, Liu M, Corwin E, Cox LM, Blaser MJ. Infant antibiotic exposures and early-life body mass. Int J Obes 37: 16–23, 2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Vaishnava S, Severson K, Ruhn K, Benjamin J, Yu X, Hu B, Yamamoto M, Defranco A, Wakeland E, Hooper L. The antibacterial C-type lectin RegIIIgamma maintains spatial segregation between microbiota and host in the intestine. Inflamm Bowel Dis 17: S2–S3, 2011. [Google Scholar]
  • 68.Waligora-Dupriet AJ, Dugay A, Auzeil N, Huerre M, Butel MJ. Evidence for clostridial implication in necrotizing enterocolitis through bacterial fermentation in a gnotobiotic quail model. Pediatr Res 58: 629–635, 2005. [DOI] [PubMed] [Google Scholar]
  • 69.Wang Y, Hoenig JD, Malin KJ, Qamar S, Petrof EO, Sun J, Antonopoulos DA, Chang EB, Claud EC. 16S rRNA gene-based analysis of fecal microbiota from preterm infants with and without necrotizing enterocolitis. ISME J 3: 944–954, 2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Young VB, Schmidt TM. Antibiotic-associated diarrhea accompanied by large-scale alterations in the composition of the fecal microbiota. J Clin Microbiol 42: 1203–1206, 2004. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1
tableS1.pdf (41.3KB, pdf)
Table S2
tableS2.pdf (41.7KB, pdf)
Table S3
tableS3.pdf (218.8KB, pdf)
Table S4
tableS4.pdf (378KB, pdf)

Articles from American Journal of Physiology - Gastrointestinal and Liver Physiology are provided here courtesy of American Physiological Society

RESOURCES