PKCλ Haploinsufficiency Prevents Diabetes by a Mechanism Involving Alterations in Hepatic Enzymes

Abstract

Tissue-specific knockout (KO) of atypical protein kinase C (aPKC), PKC-λ, yields contrasting phenotypes, depending on the tissue. Thus, whereas muscle KO of PKC-λ impairs glucose transport and causes glucose intolerance, insulin resistance, and liver-dependent lipid abnormalities, liver KO and adipocyte KO of PKC-λ increase insulin sensitivity through salutary alterations in hepatic enzymes. Also note that, although total-body (TB) homozygous KO of PKC-λ is embryonic lethal, TB heterozygous (Het) KO (TBHetλKO) is well-tolerated. However, beneath their seemingly normal growth, appetite, and overall appearance, we found in TBHetλKO mice that insulin receptor phosphorylation and signaling through insulin receptor substrates to phosphatidylinositol 3-kinase, Akt and residual aPKC were markedly diminished in liver, muscle, and adipose tissues, and glucose transport was impaired in muscle and adipose tissues. Furthermore, despite these global impairments in insulin signaling, other than mild hyperinsulinemia, glucose tolerance, serum lipids, and glucose disposal and hepatic glucose output in hyperinsulinemic clamp studies were normal. Moreover, TBHetλKO mice were protected from developing glucose intolerance during high-fat feeding. This metabolic protection (in the face of impaired insulin signaling) in HetλKO mice seemed to reflect a deficiency of PKC-λ in liver with resultant 1) increases in FoxO1 phosphorylation and decreases in expression of hepatic gluconeogenic enzymes and 2) diminished expression of hepatic lipogenic enzymes and proinflammatory cytokines. In keeping with this postulate, adenoviral-mediated supplementation of hepatic PKC-λ induced a diabetic state in HetλKO mice. Our findings underscore the importance of hepatic PKC-λ in provoking abnormalities in glucose and lipid metabolism.

Atypical protein kinase C (aPKC) isoforms, PKC-λ/ι and PKC-ζ, operating downstream of the insulin receptor (IR), IR substrate (IRS)-1/2 and phosphatidylinositol 3-kinase (PI3K), function along with Akt in mediating insulin effects on glucose transport in muscle and adipocytes, and lipid synthesis in liver (reviewed in Ref. 1). On the other hand, Akt, acting alone, at least partly by phosphorylating FoxO1 (2, 3), mediates inhibitory effects of insulin on hepatic gluconeogenesis. In contrast, aPKC, particularly when inordinately activated in states of obesity and type 2 diabetes mellitus (T2DM), diminishes Akt effects on FoxO1 phosphorylation and gluconeogenic enzyme expression (4–7).

Evidence for aPKC requirements during insulin action comes mainly from knockout (KO) studies of PKC-λ, a major aPKC in insulin-sensitive mouse tissues. For example, muscle-specific heterozygous (Het) and homozygous KO of PKC-λ (MλKO) impairs insulin-stimulated glucose transport in muscle, thereby causing glucose intolerance, insulin resistance, hyperinsulinemia, and subsequent activation of hepatic aPKC and excessive increases in lipogenic, gluconeogenic, and proinflammatory factors that promote development of metabolic syndrome features, eg, obesity and hyperlipidemia (5, 6, 8). In contrast, liver-specific KO of PKC-λ (LλKO) diminishes insulin-stimulated increases in lipogenic and proinflammatory factors, and produces insulin sensitivity and metabolic resistance to high-fat-feeding (9, 10). Adipocyte-specific KO of PKC-λ (AλKO) impairs insulin-stimulated glucose transport in isolated adipocytes, but, in contrast to MλKO, produces a phenotype characterized by normal glucose tolerance, diminished adiposity, and enhanced hepatic responsiveness to insulin, presumably through altered secretion of adipose tissue-derived adipo-/cytokines that increase Akt-dependent FoxO1 phosphorylation (11).

In view of the findings in tissue-specific KO studies, it is noteworthy that humans with T2DM have aPKC levels, as well as activities, that are diminished in muscle (5, 12, 13) and increased in liver (5). Unfortunately, the resulting impairment in muscle-dependent glucose disposal would be expected to promote hyperinsulinemia and further increase levels and activity of hepatic aPKC, which in turn would increase expression of hepatic gluconeogenic, lipogenic, and proinflammatory factors (5, 12, 13). Vice versa, increases in hepatic aPKC may amplify muscle abnormalities by releasing inhibitory lipids and cytokines into the circulation, setting up a vicious cycle.

The importance of hepatic alterations is underscored by the fact that selective inhibition of hepatic aPKC by either adenoviral expression methods (4, 10) or low molecular weight chemical agents (5–7) diminishes expression of lipogenic, proinflammatory, and gluconeogenic factors in hepatocytes of T2DM humans (5, 7) and livers of obese and T2DM rodents (4, 6, 10). Moreover, the inhibition of hepatic aPKC results in improvements in glucose tolerance, insulin resistance, obesity, and hyperlipidemia in MλKO mice (6), high-fat-fed (HFF) mice (4) and ob/ob mice (10) (unpublished observations).

Tissue-specific KO studies were conducted largely because homozygous KO of PKC-λ is embryonic lethal. However, in attempts to produce a KO of PKC-λ, it was noticed that KO of one PKC-λ allele is well-tolerated, and on the surface, these haploinsufficient mice tend to be slightly but not significantly heavier, but are otherwise indistinguishable from wild-type (WT) littermates. Nevertheless, we questioned how total-body (TB) Het KO of PKC-λ (TBHetλKO) might alter metabolic processes, to see whether effects of partial PKC-λ deficiency in one or more of the above insulin-sensitive tissues would be more dominant in determining the resultant phenotype, or whether salutary and detrimental alterations in metabolism would effectively be offsetting. This study also seemed important because systemic use of several small-molecule chemical aPKC inhibitors that selectively target hepatic aPKC has been found to improve obesity, hyperlipidemia, and glucose tolerance, not only in MλKO mice (6) but also in ob/ob and HFF mice (17).

Here, we examined insulin signaling mechanisms and metabolic consequences in 3 major insulin target tissues, and the overall phenotype, of TBHetλKO mice. Surprisingly, despite normal appearances (except that there appeared to be an inconsistent tendency toward obesity), TBHetλKO mice had markedly impaired IR function and insulin signaling to Akt, as well as aPKC, in muscle, liver and adipocytes, and this was accompanied by impaired glucose transport in muscle and adipose tissues. Nevertheless, TBHetλKO mice had normal glucose tolerance and lipid homeostasis, and, moreover, were metabolically protected during high-fat feeding. Moreover, this metabolic protection appeared to be due to diminished expression of hepatic gluconeogenic, lipogenic, and proinflammatory factors, owing to partial deficiency of hepatic PKC-λ.

Materials and Methods

Heterozygous KO of PKC-λ

To clone the mouse Prkcλ locus, a 129/Ola genomic cosmid library (obtained from the Resourcenzentrum, Berlin, Germany) was screened using a full-length mouse cDNA as a probe. Several cosmid clones were identified and further purified. One of those containing the genomic 5′ part of the gene was selected for further cloning. To generate the following targeting constructs for the PKC-λ gene, a 10.9-kb genomic EcoRI fragment, including the second exon (corresponding to nucleotides 110–233 of the published murine PKC-λ cDNA), was subcloned into a bluescript backbone. Using this genomic DNA fragment, the conventional targeting vector was generated by inserting an independent neo-cassette (derived from pMC1neoPolyA from Stratagene) into a Sal I restriction site, which was introduced into the second exon by site-directed mutagenesis. As a consequence of this insertion, the transcription of the PKC-λ gene was abrogated. This construct was expressed in embryonic stem cells that were used to generate mice (C57BL/6 and 129P2/SV background) with germline transmission of the altered allele. These heterozygous mice were bred to yield WT and heterozygous offspring. Genomic DNA prepared from tail biopsies was used for genotyping by PCR. Primers used were λ-forward, TTG TGA AAG CGA CTG GAT TG, and λ-reverse, CTT GGG TGG AGA GGC TAT TC.

Mouse care

Mice were maintained in light (12 hours light from 7:00 am to 5:00 pm and 12 hours dark from 5:00 pm to7:00 am) and temperature-controlled (20°C–24°C) environments and, except where indicated, fed standard chow in the Vivaria of both the James A. Haley Veterans Administration Hospital and Yale University School of Medicine. Male mice 5 to 7 months of age were used, except those sent to Yale were 8 to 10 months of age at the time of the clamp studies. Note that food intake was virtually the same in WT and TBHetλKO mice. Protocols were approved by the Institutional Animal Care and Use Committees of the University of South Florida College of Medicine and Yale University School of Medicine. Studies were conducted in accordance with guidelines of the National Institutes of Health and Principles of the Declaration of Helsinki.

High-fat feeding studies and glucose tolerance testing

In studies of high-fat feeding, mice were studied over a 10-week period, and where indicated, mice were fed standard mouse chow/low-fat diet (10% of calories from fat) or a high-fat diet (40% of calories from milk fat; purchased from Harlan Industries; see Ref. 4 for diet composition). During the ninth week, glucose tolerance was measured in normal-chow-fed and HFF mice after an overnight fast by ip injection of 2 mg glucose per kg body weight and measurement of blood glucose levels at 0, 30, 60, 90, and 120 minutes, as described (8, 11).

Glucose uptake/transport in vivo

As described (8, 11), after an overnight fast, 0.2 mL physiologic saline containing, per gram body weight, 0.05 μCi [³H]2-deoxyglucose (NEN/Life Science Products), 0.005 μCi [¹⁴C]l-glucose (NEN/Life Science Products), and with or without 1 mU insulin (Sigma), was administered ip 10 minutes before killing. Glucose uptake into abdominal/retroperitoneal/perigonadal adipose tissue, hind limb muscles (vastus lateralis and gastrocnemius), and heart ventricle muscle was measured by dividing the tissue ³H counts per minute (corrected for nonspecific trapping of extracellular water as per [¹⁴C]l-glucose radioactivity) by the specific ³H radioactivity of serum glucose.

Tissue lysate preparation

As described (4–8, 10, 11), liver and muscle samples were homogenized in ice-cold buffer containing 0.25mM sucrose, 20mM Tris/HCl (pH, 7.5), 2mM EGTA, 2mM EDTA, 1mM phenylmethylsulfonyl fluoride, 20 μg/mL leupeptin, 10 μg/mL aprotinin, 2mM Na₄P₂O₇, 2mM Na₃VO₄, 2mM NaF, and 1μM microcystin, and then supplemented with 1% Triton X-100, 0.6% Nonidet P-40, and 150mM NaCl and cleared by low-speed centrifugation.

aPKC activation

Lysate aPKC activity was measured as described (4–8, 10, 11). Briefly, aPKCs were immunoprecipitated with rabbit polyclonal antiserum (Santa Cruz Biotechnology), collected on Sepharose-AG beads, and incubated for 8 minutes at 30°C in 100 μL buffer containing 50mM Tris/HCl (pH 7.5), 100μM Na₃VO₄, 100μM Na₄P₂O₇, 1mM NaF, 100μM phenylmethylsulfonyl fluoride, 4 μg phosphatidylserine (Sigma), 50μM [γ-³²P]ATP (NEN/Life Science Products), 5mM MgCl₂, and as substrate, 40μM serine analog of the PKC-ϵ pseudosubstrate (BioSource). After incubation, ³²P-labeled substrate was trapped on P-81 filter paper and counted in a liquid scintillation counter. Note that basal, but not insulin-stimulated, activity is poorly inhibited by aPKC inhibitors (4–8, 10, 11), possibly reflecting coimmunoprecipitation of non-aPKC kinases or folded unstimulated aPKC being less susceptible to inhibition than unfolded stimulated aPKC. aPKC activation was also assessed by immunoblotting phospho-threonine-555/560-PKC-λ/ζ, which more clearly reflects activity (1), regardless of stimulation. Nevertheless, kinase activity is numerical and more precise and is particularly useful for stimulated activity.

Akt activation

Lysate Akt activation was assessed (4–8, 10, 11) by 1) Western analysis and immunoblotting for phosphorylation of Ser-473-Akt1/2 and 2) enzymatic activity of immunoprecipitable Akt2 using antibodies and assay reagents from Upstate Cell Signaling Technologies.

PI3K activation

PI3K activity was measured by immunoprecipitation of IRS-1 or IRS-2 (antisera from Upstate Cell Signaling Technologies), incubation with phosphatidyl Inositol, [γ-³²P]ATP, and MgCl₂ and subsequent isolation of labeled PI-3-PO₄ by thin-layer chromatography, and counting in a phosphoimager, as described (8, 12).

Western analyses

As described (4–8, 10, 11), lysates were immunoblotted for PKC-ζ/λ (rabbit polyclonal antiserum; Santa Cruz Biotechnology), which recognizes C termini of both aPKCs, λ and ζ; mouse monoclonal anti-PKC-λ antibody (Transduction Labs); rabbit polyclonal anti-PKC-ζ antiserum (kindly provided by Dr Todd Sacktor, State University of New York, New York, NY); rabbit polyclonal anti-phospho-Thr-560/555-PKC-ζ/λ/ι antiserum (Invitrogen); rabbit polyclonal anti-glyceraldehyde-phosphate dehydrogenase antiserum (Santa Cruz Biotechnologies); rabbit polyclonal anti-Akt1/2 antiserum (Upstate Cell Signaling Technologies); rabbit polyclonal anti-phospho-Ser-256-FoxO1 and anti-FoxO1 (Abnova) antisera; rabbit polyclonal anti-phospho-Ser-473-Akt1/2 antiserum (Upstate Cell Signaling Technology); rabbit polyclonal anti-phospho-Ser-473-Akt antiserum (Santa Cruz Biotechnologies); anti-phospho-Ser-473-Akt antiserum (Santa Cruz Biotechnologies); rabbit polyclonal anti-IR α-subunit antiserum; rabbit polyclonal anti-IR β-subunit antiserum; rabbit polyclonal anti-p85 subunit of PI3K antiserum; rabbit polyclonal anti-p85 subunit of PI3K antiserum; rabbit polyclonal anti-p110 subunit of PI3K antiserum; rabbit polyclonal anti-IRS-1 antiserum (Upstate Cell Signaling Technology); rabbit polyclonal anti-IRS-2 antiserum; mouse monoclonal anti–sterol receptor element binding protein-1c (SREBP-1c) antibody (Neomarkers, Inc); and rabbit polyclonal anti-p65/RelA subunit of κB (NFκB) (Santa Cruz Biotechnologies). In each blot, equal amounts of lysate protein were analyzed, and glyceraldehyde-phosphate dehydrogenase was used to verify equal immunoreactivity of an unchanging standard in the lysates.

Effects of iv administration of adenoviruses encoding WT and constitutively active PKC-λ οn blood glucose levels

As in previous studies (4, 10), adenovirus vector or adenovirus encoding WT PKC-λ or constitutively active PKC-λ (5 × 10⁸ plaque-forming units per gram body weight) were administered via the tail vein, and blood glucose levels were measured 4 days later. The adenoviruses encoding these PKCs were described previously (14).

Measurements of serum triglycerides, cholesterol, free fatty acids, insulin, and glucose

Serum triglycerides, cholesterol, free fatty acids, glucose, and insulin levels were measured as described (4, 6, 8, 11).

Nuclear preparations

As described previously (4, 6, 10), nuclei were prepared with NE-PER nuclear and cytoplasmic extraction reagents (Pierce Biotechnology).

mRNA analyses

As described (4, 6, 10, 11), tissues were added to Trizol reagent (Invitrogen); RNA was extracted and purified with the RNeasy Mini Kit and ribonuclease-free deoxyribonuclease set (QIAGEN), quantified (A₂₆₀/A₂₈₀), and checked for integrity by electrophoresis on 1.2% agarose gels; and mRNA was quantified by quantitative real-time RT-PCR, using TaqMan reverse transcription reagent (Applied Biosystems) and SYBR Green kit (Applied Biosystems) and mouse primers as follows: SREBP-1c, ATCGGCGCGGAAGCTGTCGGGGTAGCGTC (forward) and ACTGTCTTGGTTGATGAGCTGGAGCAT (reverse); FAS, GAGGACACTCAAGTGGCTGA (forward) and GTGAGGTTGCTGTCGTCTGT (reverse); ACC, GACTTCATGAATTTGCTGAT (forward) and AAGCTGAAAGCTTTCTGTCT (reverse); PEPCK, GACAGCCTGCCCCAGGCAGTGA (forward) and CTGGCCACATCTCGAGGGTCAG (reverse); G6Pase, TGCTGCTCACTTTCCCCACCAG (forward) and TCTCCAAAGTCCACAGGAGGT (reverse); IL-1β, TTGACGGACCCCAAAAGATG (forward) and AGAAGGTGCTCATGTCCTCA (reverse); TNF-α, ACGGCATGGATCTCAAAGAC (forward) and AGATAGCAAATCGGCTGACG (reverse); PKC-ζ, CATGCAGAGGCAGAGAAAACT (forward) and TTAGGTCCCGGTAGATGATCC (reverse); PKC-λ, TCACTGACTACGGCATGTGTAA (forward) and CGCAGAAAGTGCTGGTTG (reverse); and housekeeping gene HPRT, TGAAAGACTTGCTCGAGATGT (forward) and AAAGAACTTATAGCCCCCCTT (reverse).

Blood, serum, and tissue analyses

Glucose was measured with a Life Scan glucometer; immunoreactive insulin with a mouse kit from Linco; free/nonesterified fatty acids with a kit from Wako Chemicals; triglycerides with a kit from Sigma; total cholesterol, low-density lipoprotein cholesterol, and high-density lipoprotein cholesterol with the Advia 1650 Autoanalyzer (Bayer Instruments); and adiponectin, leptin, and resistin with Quantikine kits (R&D Systems).

Hyperinsulinemic-euglycemic clamps

After transfer to the Yale University School of Medicine, male mice were maintained for several months before the clamp studies were conducted, as described (8, 11).

Statistical methods

Data are expressed as mean ± SEM. Statistical differences between 2 and 3 or more groups were determined by Student's t test and ANOVA (SigmaStat Statistical Software), respectively.

Results

Tissue levels of insulin signaling factors in WT and TBHetλKO mice

Levels of PKC-λ and total aPKC (PKC-λ/ζ), but not PKC-ζ, were diminished in various tissues of TBHetλKO mice, relative to WT mice (Figure 1). Levels of other insulin signaling factors, namely, IR subunits α and β, IRS-1, IRS-2, p85 and p110 subunits of PI3K, and Akt, were comparable in TBHetλKO and WT mice (Figure 1).

Figure 1.

Expression of PKC-λ and other insulin signaling proteins in liver, muscle, and adipose tissues of TBHetλKO and WT mice. Equal amounts of lysate protein were subjected to Western analysis for the indicated proteins. Shown here are representative blots of determinations from 8 WT and 8 HetλKO mice.

Insulin signaling in liver, muscle, and adipose tissues of WT and TBHetλKO mice

As expected, because PKC-λ is the major aPKC in insulin-sensitive mouse tissues, activation of total aPKC by insulin was diminished in muscle, adipose, and liver tissues of TBHetλKO mice (Figures 2 and 3, E and F). Surprisingly, insulin activation of Akt2 and its major upstream activator, IRS-1–dependent PI3K (15), was also markedly impaired in each tissue (Figures 2 and 3, D and F). Similarly, IRS-2–dependent PI3K, which contributes to hepatic Akt activation, and alone mediates insulin signaling to hepatic aPKC (15), was markedly impaired in livers of TBHetλKO mice (Figure 3A).

Figure 2.

Activation of aPKC, Akt2, and IRS-1–dependent PI3K by insulin (Ins) in liver, muscle, and adipose tissues of TBHetλKO and WT mice. Mice fed ad libitum mice were treated with or without insulin (1 U/kg body weight) given ip 15 minutes before killing. All assays involved immunoprecipitation of the indicated protein and subsequent assay with substrates and necessary cofactors, as described in Materials and Methods. Values are mean ± SEM of the number of determinations shown in parentheses. *, P < .05; **, P < .01; ***, P < .001 (ANOVA) for comparison of insulin-stimulated vs adjacent unstimulated value. Brackets show statistical comparisons between indicated groups.

Figure 3.

Activation of IRS-2-dependent PI3K (A) and tyrosine phosphorylation of IR β-subunit (B) and phosphorylation of Ser-256-FoxO1 (C), Ser-473-Akt (D), and Thr-555/560-PKC-λ/ζ (E) by insulin in liver of TBHetλKO and WT mice. Mice fed ad libitum were treated with or without insulin (1 U/kg body weight) given ip 15 minutes before killing. In A, IRS-2 was immunoprecipitated and incubated with PI, [γ³²PO₄]ATP, and MgCl₂, and PI-3-³²PO₄ was isolated by thin-layer chromatography and quantified as described in Materials and Methods. In B, IR β-subunit was immunoprecipitated and analyzed for phosphotyrosine content by Western analysis. In other panels, lysate proteins were analyzed for indicated proteins by Western analysis. Values are mean ± SEM of the number of determinations shown in parentheses. *, P < .05; **, P < .01; ***, P < .001 (ANOVA) for comparison of insulin-stimulated vs adjacent unstimulated value. Brackets show statistical comparisons between indicated groups. Representative blots are shown at right.

Insulin signaling abnormalities in TBHetλKO mice were at least partly attributable to impaired tyrosine autophosphorylation of the β-subunit of the IR (Figure 3, B and F). However, the levels of both α- and β-subunits of the IR were comparable in tissues of TBHetλKO and WT mice (Figures 1 and 3F).

Glucose uptake in muscle and adipose tissues of WT and TBHetλKO mice

With impaired activation of Akt and aPKC, insulin-stimulated glucose uptake in skeletal muscle, heart muscle, and adipose tissue was impaired in TBHetλKO mice (Figure 4A).

Figure 4.

Stimulation of glucose transport by insulin in skeletal muscle (vastus lateralis and gastrocnemius), heart muscle, and adipose tissue (A) and comparison of metabolic parameters (B) TBHetλKO and WT mice. In A, mice fed ad libitum were injected ip with [³H]2-deoxyglucose (to assess glucose transport) and [¹⁴C]l-glucose (to correct for nonspecific counts) with or without insulin (1 U/kg body weight) 20 minutes before killing, serum was examined for hexose-specific activity, and tissues were examined for uptake of label, from which specific uptake of glucose was calculated as described in Materials and Methods. In B, metabolic parameters (serum glucose, insulin, and indicated lipids) were measured in overnight fasted mice. (Although not portrayed, note that the decrease in blood glucose in response to acute 10-minute insulin treatment was, if anything, greater in Het-KO mice [226 ± 15 in saline-treated mice, decreasing to 163 ± 21 mg/dL with insulin treatment; apparent decrement, 63 mg/dL, or 28%], as compared with WT mice [203 ± 16 in saline-treated mice, decreasing to 176 ± 15 mg/dL with insulin treatment; apparent decrement, 27 mg/dL, or 13%].) Values are mean ± SEM of the number of determinations shown in parentheses. ***, P < .001 (ANOVA) for comparison of insulin-stimulated vs adjacent unstimulated values. Brackets show statistical comparisons between indicated groups.

Glucose and lipid homeostasis in WT and TBHetλKO mice

Despite impairments in insulin signaling and glucose uptake, fasting levels of serum glucose, triglycerides, free fatty acids, and total cholesterol in TBHetλKO mice were normal, and fasting serum insulin levels were only modestly increased in TBHetλKO mice (Figure 4B).

While consuming standard chow, glucose tolerance was identical in TBHetλKO and WT mice (Figure 5). Moreover, whereas glucose tolerance was impaired, and, whereas serum insulin levels were elevated when WT mice were challenged for 10 weeks with a high-fat diet, no such impairment in glucose tolerance was observed, and serum insulin levels were essentially unaltered in TBHetλKO mice placed on the same high-fat diet (Figure 5). Note that abdominal adiposity and serum and liver triglycerides were comparable in WT and TBHetλKO mice after high-fat feeding (not shown) and did not appear to be factors in maintaining glucose tolerance in TBHetλKO mice.

Figure 5.

Comparison of glucose tolerance in TBHetλKO and WT mice consuming standard mouse chow (10% of calories from fat) (low-fat diet at left) or a high-fat diet (40% of calories from milk fat) (high-fat diet at right). After an overnight fast, mice were subjected to glucose tolerance testing by administration of 2 mg glucose per g body weight given ip at time 0, and tail vein blood glucose was measured at the indicated times. Values are mean ± SEM of 5 to 7 determinations. P values (ANOVA) are given for comparisons between Het KO and WT mice.

Euglycemic-hyperinsulinemic clamp studies in WT and TBHetλKO mice

In keeping with normal glucose tolerance, in basal conditions, blood glucose (Figure 6A) and basal hepatic glucose output (Figure 6H) were similar in TBHetλKO and WT mice. Furthermore, during insulin administration in the clamp, the glucose infusion rate (Figure 6, E–G), suppression of hepatic glucose output (Figure 6I), glucose uptake (Figure 6J), glycolysis (Figure 6K), and glycogen synthesis (Figure 6l) in TBHetλKO mice and WT mice were not significantly different. Similar to findings in mice housed in Tampa, basal insulin levels in the TBHetλKO mice sent to New Haven for clamp studies (including preclamp preparatory operative procedures) trended above the basal levels seen in their WT littermates, but statistical significance was not achieved (Figure 6C).

Figure 6.

Comparison of insulin-stimulated glucose infusion/disposal rates (E and G), suppression of hepatic glucose output (I), total body glucose uptake (J), glycolysis (K), and glycogen synthesis (L) during euglycemic-hyperinsulinemic clamp studies of TBHetλKO and WT mice. Also shown are blood glucose and serum insulin levels and hepatic glucose output in basal conditions and during insulin administration. Values are mean ± SEM of the number of determinations shown in parentheses. Note that findings in HetλKO and WT mice were not significantly different.

Expression of hepatic lipogenic, gluconeogenic, and proinflammatory factors in WT and TBHetλKO mice

Maintenance of normal overall glucose and lipid homeostasis and normal suppression of hepatic glucose output in the face of a marked impairment in IR function and Akt2 activation in livers of TBHetλKO mice prompted us to examine hepatic expression of lipogenic, gluconeogenic, and proinflammatory factors that impact glucose and lipid homeostasis. As seen in Figure 7A, apparent activities, as judged from active nuclear levels of 1) SREBP-1c, which controls expression of an array of lipogenic enzymes, and 2) NFκB, which controls expression of multiple proinflammatory factors, were increased by insulin treatment in livers of WT mice, but poorly if at all in livers of TBHetλKO mice. In keeping with decreased nuclear levels of these transactivators, feeding-induced (presumably largely insulin-mediated) increases in expression of SREBP-1c itself, and lipogenic enzymes, fatty acyl synthase (FAS) and acetyl-coenzyme A carboxylase (ACC) (Figure 7B), and proinflammatory factors, IL-1β, and TNF-α (Figure 7C) were substantially diminished in livers of TBHetλKO mice. In addition to alterations in expression of lipogenic and proinflammatory factors, the expression of gluconeogenic enzymes phosphoenolpyruvate carboxykinase (PEPCK) and glucose-6-phosphatase (G6Pase) was diminished in fasted TBHetλKO mice, virtually to levels seen with feeding in WT mice (Figure 7D).

Figure 7.

Comparison of basal and insulin-stimulated activity of SREBP-1c (as per nuclear level of its active fragment) and NFκB (as per nuclear level of the RelA/p65 active subunit) (A) and hepatic expression of SREBP-1c and SREBP-1c–dependent lipogenic enzymes, FAS and ACC (B), gluconeogenic enzymes PEPCK and G6Pase (C), and proinflammatory factors IL-1β and TNF-α (D) in TBHetλKO and WT mice. In A, mice fed ad libitum were treated with or without insulin (1 U/kg body weight) given ip 15 minutes before killing. In B, C, and D, mice were fasted overnight or fed ad libitum, as indicated, and tissues were examined for mRNA levels of indicated substances. Values are mean ± SEM of the number of determinations shown in parentheses. *, P < .05; **, P < .01; ***, P < .001 (ANOVA) for comparison of fed vs adjacent fasted value. Brackets show statistical comparisons between indicated groups.

Phosphorylation of hepatic FoxO1 in WT and TBHetλKO mice

During insulin action in liver, Akt2 diminishes expression of gluconeogenic enzymes by phosphorylating FoxO1, thereby inhibiting nuclear import of FoxO1 and its ability to stimulate expression of gluconeogenic enzymes (2, 3). Accordingly, in WT mice, insulin, presumably acting via Akt2, increased phosphorylation of Ser-256 in FoxO1 (Figure 3, C and F). In TBHetλKO mice, however, resting/basal as well as insulin-stimulated FoxO1 phosphorylation was increased, essentially to the level seen during maximal insulin stimulation in WT mice (Figure 3, C and F).

Effects of supplementation of hepatic PKC-λ by adenovirally mediated expression of WT and constitutively active PKC-λ in HetλKO mice

As in previous studies (4, 10), we administered adenovirus iv to selectively express aPKC in livers of HetλKO mice. Whereas adenovirus vector alone did not significantly alter ad lib blood glucose levels, administration of adenovirus encoding WT PKC-λ to TBHetλKO mice increased hepatic immunoreactive 75-kDa total aPKC levels and increased blood glucose from 129 ± 4 mg/dL (mean ± SEM; n = 12) to 208 ± 6 mg/dL (n = 6), and adenovirus encoding a truncated constitutively active PKC provoked expression of a 63-kDa truncated aPKC (14) and increased blood glucose to 321 ± 28 mg/dL (n = 7) (Supplemental Figure 1).

Effects of streptozotocin-induced diabetes on WT and HetλKO mice

In view of the profound deficiency in insulin signaling in HetλKO mice, we questioned whether insulin was needed to maintain glucose homeostasis. We therefore used streptozotocin to destroy pancreatic islet β-cells. In WT mice, ad lib blood glucose levels rose from 158 ± 6 to 230 ± 12 mg/dL (mean ± SEM) at 8 days and 441 ± 16 mg/dL at 12 days after streptozotocin treatment. In HetλKO mice, ad lib blood glucose levels rose from 139 ± 11 to 236 ± 16 mg/dL at 12 days, and 372 ± 27 mg/dL at 17 days after streptozotocin treatment (Supplemental Figure 2).

Discussion

It was surprising to find in TBHetλKO mice that 1) insulin signaling to IRS-1/2–dependent PI3K and Akt2, as well as aPKC, was markedly impaired in muscle, adipose, and liver tissues; 2) this impairment in signaling was at least partly due to impaired tyrosine autophosphorylation of the IR β-subunit; and 3), nevertheless, glucose and lipid homeostasis in TBHetλKO mice was indistinguishable from that seen in WT mice. Moreover, TBHetλKO mice were protected from developing glucose intolerance during 10 weeks of high-fat feeding.

The modest degree of hyperinsulinemia in HetλKO mice is noteworthy, because it was both required (as per streptozotocin studies) and sufficient to offset impairments in insulin signaling at receptor and postreceptor levels in 3 major insulin-sensitive tissues and impairments in glucose transport in muscle and adipose tissues.

Remarkably, HetλKO mice had normal glucose tolerance and serum insulin responses during the glucose tolerance testing in conditions of low-fat and high-fat feeding. Moreover, HetλKO mice had normal insulin-mediated suppression of hepatic glucose output in euglycemic-hyperinsulinemic clamp studies, despite impaired hepatic Akt2 activation.

As to what hepatic abnormalities would have been expected with poor Akt2 activation in the absence of metabolic protection in HetλKO mice, the feeding of a diet containing 60% of calories from fat to normal mice diminishes hepatic Akt activation by insulin and impairs glucose tolerance (16). Also, we recently observed in normal mice that feeding a diet containing 40% of calories from fat, as used presently, impairs glucose tolerance without diminishing basal or insulin-stimulated hepatic Akt2 activity; instead, this 40% fat diet specifically impairs Akt2-dependent phosphorylation of hepatic FoxO1, but not other Akt substrates, and thereby increases expression of PEPCK and G6Pase (17). Thus, without the metabolic protection afforded by PKC-λ haploinsufficiency, high-fat feeding would be expected to have impaired Akt-dependent FoxO1 phosphorylation, increased expression of gluconeogenic enzymes, and diminished glucose intolerance. To the contrary, FoxO1 phosphorylation was increased, expression of gluconeogenic enzymes was suppressed, and glucose tolerance was normal in HetλKO mice.

We believe that maintenance of normal glucose homeostasis in HetλKO mice resulted from partial deficiency of hepatic PKC-λ. In keeping with this hypothesis, comparable to the situation in TBHetλKO mice, decreases in fasting levels of PEPCK and G6Pase mRNA have been consistently observed with partial inhibition of hepatic aPKC elicited by either adenoviral-mediated expression of kinase-inactive aPKC (4, 10) or chemical inhibitors of aPKC (6). Moreover, inhibition of hepatic aPKC is consistently attended by increased phosphorylation of Ser-256 in FoxO1 (5–7), a major insulin-dependent regulator of gluconeogenic enzyme expression, comparable to that presently seen in HetλKO mice. Collectively, these and other findings suggest that aPKC, particularly when elevated excessively, inhibits Akt-dependent FoxO1 phosphorylation.

In support of the hypothesis that deficiency of hepatic C-λ was responsible for maintaining glucose homeostasis in TBHetλKO, we found that adenoviral-mediated expression of WT and constitutive PKC-λ in livers of HetλKO mice provoked moderate and marked increases, respectively, in blood glucose levels in HetλKO mice.

In addition to protection of glucose homeostasis, HetλKO mice did not have hyperlipidemia. This is not surprising, because deficient activation of both aPKC and Akt by insulin would be expected to diminish feeding-dependent increases in hepatic SREBP-1c activity and expression of SREBP-1c and SREBP-1c–dependent lipogenic factors such as FAS and ACC.

Additional metabolic protection in HetλKO mice may have been provided by diminished feeding/insulin-dependent cytokine production in liver and possibly other tissues. In this regard, note that 1) aPKC phosphorylates and activates IKKβ (inhibitor of nuclear factor kappa-B kinase subunit beta), which in turn phosphorylates IκB (inhibitor of nuclear factor kappa-B) and thereby releases NFκB for nuclear uptake, ie, activation (18); 2) aPKC directly phosphorylates and activates NFκB (19); 3) IKKβ/NFκB inhibition by salicylate therapy diminishes systemic insulin resistance (20, 21); and 4) inhibition of hepatic aPKC diminishes insulin- and feeding-stimulated increases in NFκB activity and expression of IL-1β and TNF-α (4, 10).

It was interesting that IR function and downstream signaling were diminished to a degree that seemed to counterbalance the decreases in gluconeogenic enzyme expression seen in fasted HetλKO mice and thereby avoid the development of hypoglycemia that might otherwise have occurred with normal insulin signaling. In this regard, it is possible that a factor needed for optimum IR function is fortuitously dependent on PKC-λ. Another possibility is that diminished hepatic gluconeogenic enzyme expression owing to the increased FoxO1 phosphorylation in TBHetλKO mice may have diminished IR function to a degree needed to maintain normal glucose homeostasis.

To summarize, we found that TB deletion of one PKC-λ allele in mice leads to deficiencies in IR function and a subsequent signaling to IRS-1/PI3K, IRS-2/PI3K, Akt, and aPKC in muscle, adipose, and liver tissues. Understandably, this global signaling defect was accompanied by impairments in insulin-stimulated glucose transport in muscle and adipose tissues. On the other hand, this widespread abnormality in insulin signaling did not significantly disturb overall glucose or lipid homeostasis, and HetλKO mice were metabolically protected during high-fat feeding. This metabolic protection was most likely conferred by deficient levels and activity of hepatic aPKC, accompanied by the following alterations: 1) increased FoxO1 phosphorylation and diminished expression of gluconeogenic enzymes, 2) decreased SREBP-1c activity and decreased expression of lipogenic enzymes, and 3) decreased NFκB activity and expression of proinflammatory factors. These findings underscore the importance of hepatic PKC-λ as a negative modulator of Akt and a promoter of increases in hepatic gluconeogenic and lipogenic enzyme expression.

Additional material

Supplementary data supplied by authors.