The Epigenetic Drug 5-Azacytidine Interferes with Cholesterol and Lipid Metabolism

Background: The anticancer drug 5-azacytidine acts through an incompletely understood mechanism.

Results: 5-Azacytidine reprograms the glycerolipid biosynthesis pathway and prevents activation of master transcription factors that regulate lipid homeostasis.

Conclusion: 5-Azacytidine deeply modifies how cells manage cholesterol and lipid synthesis.

Significance: The findings unravel important insights into the mechanism of 5-azacytidine and highlight new potential cancer therapeutics.

Abstract

DNA methylation and histone acetylation inhibitors are widely used to study the role of epigenetic marks in the regulation of gene expression. In addition, several of these molecules are being tested in clinical trials or already in use in the clinic. Antimetabolites, such as the DNA-hypomethylating agent 5-azacytidine (5-AzaC), have been shown to lower malignant progression to acute myeloid leukemia and to prolong survival in patients with myelodysplastic syndromes. Here we examined the effects of DNA methylation inhibitors on the expression of lipid biosynthetic and uptake genes. Our data demonstrate that, independently of DNA methylation, 5-AzaC selectively and very potently reduces expression of key genes involved in cholesterol and lipid metabolism (e.g. PCSK9, HMGCR, and FASN) in all tested cell lines and in vivo in mouse liver. Treatment with 5-AzaC disturbed subcellular cholesterol homeostasis, thereby impeding activation of sterol regulatory element-binding proteins (key regulators of lipid metabolism). Through inhibition of UMP synthase, 5-AzaC also strongly induced expression of 1-acylglycerol-3-phosphate O-acyltransferase 9 (AGPAT9) and promoted triacylglycerol synthesis and cytosolic lipid droplet formation. Remarkably, complete reversal was obtained by the co-addition of either UMP or cytidine. Therefore, this study provides the first evidence that inhibition of the de novo pyrimidine synthesis by 5-AzaC disturbs cholesterol and lipid homeostasis, probably through the glycerolipid biosynthesis pathway, which may contribute mechanistically to its beneficial cytostatic properties.

Introduction

Epigenetic marks, such as DNA methylation and histone acetylation, finely alter chromatin structure to precisely control gene expression in a time-, cell-, and tissue-specific manner (1). DNA cytosine methylation, catalyzed by DNA methyltransferases forming 5-methylcytosine at specific CpG dinucleotides, is responsible for the establishment of silent chromatin regions (2). Inhibitors of DNA methyltransferases, such as the unmethylable cytosine analogs 5-azacytidine (5-AzaC)⁴ and 5-Aza-2′-deoxycytidine (DAC), generate hypomethylated DNA, allowing re-expression of silenced hypermethylated genes (2). Accordingly, based on the premise that they induce re-expression of tumor suppressor genes and because they lower malignant progression to acute myeloid leukemia and increase survival, both 5-AzaC and DAC are used as standards of care for patients with myelodysplastic syndromes (MDS) (3).

Comparative studies have revealed major mechanistic disparities between DAC and 5-AzaC. Although DAC is the most effective hypomethylating agent, 5-AzaC is more potent to reduce cell viability and proliferation in acute myeloid leukemia cell lines (4, 5). Global DNA microarray analyses demonstrated that the effect of each drug on the cellular transcriptome was very distinct, with largely non-overlapping gene expression profiles. In order to be incorporated into DNA, 5-AzaC has to be converted to DAC by ribonucleotide reductase, which is an inefficient process (∼10–20%) (2). Consequently, 5-AzaC can also be incorporated into different RNA subspecies and may affect nucleic acid and protein metabolism (6). Thus, 5-AzaC antineoplastic effects on abnormal hematopoietic cells may rely on methylation-independent mechanisms, which remain to be determined (4, 6–8).

Sterol regulatory element-binding proteins (SREBPs) are a family of transcription factors that coordinates homeostatic gene expression of proteins and enzymes required for uptake and biosynthesis of cholesterol, fatty acids, triacylglycerols, and phospholipids (9). The proteolytic release of the N-terminal transcriptionally active fragment of SREBPs from their membrane-bound precursor is finely regulated by cholesterol through a negative feedback loop mediated by sterol-sensing endoplasmic reticulum (ER)-resident proteins. Impairment of this mechanism can result in imbalance of cellular cholesterol and lipid content and is associated with severe clinical complications, such as non-alcoholic fatty liver disease, atherosclerosis, and cancer (10–12). Complementary to genome-wide association studies that have identified loci associated with lipid production (13), epigenetics represents one of the most promising fields to study the impact of induced environmental reprogramming of gene expression in metabolic diseases (14). Indeed, mounting evidence indicates that gene promoter DNA methylation levels may be associated with lipid metabolism gene expression (15).

In the present study, we explored the effects of DNA methylation inhibitors 5-AzaC and DAC on cholesterogenic and lipid gene expression and defined a previously unrecognized mechanism regulating the activation of SREBPs. Treatment of various cell lines or injection of mice with 5-AzaC strongly and selectively reduced expression of SREBP target genes independently of DNA methylation. Our data show that 5-AzaC, unlike DAC, promotes triglyceride synthesis and accumulation of lipid droplets and impedes SREBPs activation. In sterol-resistant Chinese hamster ovary cells, the activation of SREBP-2 was insensitive to 5-AzaC, indicating that this antimetabolite alters the ER cholesterol content. Co-incubation with UMP or cytidine completely reversed the effects of 5-AzaC, demonstrating that inhibition of UMP synthase and CTP depletion is the underlying mechanism. Taken together, these data highlight a major DNA methylation-independent effect of 5-AzaC and the existing link between the de novo pyrimidine and glycerolipid biosynthesis pathways and SREBP signaling.

EXPERIMENTAL PROCEDURES

Reagents

Cytidine (catalog no. C4654), 5-AzaC (catalog no. A2385), DAC (catalog no. A3656), uridine 5′-monophosphate (catalog no. U6375), actinomycin D (catalog no. A9415), mevastatin (catalog no. M2537), mevalonolactone (catalog no. M4667), cholesterol (catalog no. C3045), 25-hydroxycholesterol (catalog no. H1015), cycloheximide (CHX; catalog no. C7698), propranolol (catalog no. P0884), and filipin III (catalog no. F4767) were purchased from Sigma-Aldrich. Pyrazofurin (catalog no. PYA 11004) was purchased from Berry and Associates. Human lipoprotein-deficient serum (LPDS) was obtained from Millipore (catalog no. LP4), and the HCS LipidTOX Phospholipidosis/Steatosis Detection Kit (catalog no. H34157) and BODIPY 493/503 (catalog no. D3922) were from Molecular Probes. The authentic LC/MS metabolite standards were purchased from Sigma-Aldrich, and LC/MS grade ammonium acetate, LC/MS grade water, and LC/MS grade acetonitrile were purchased from Fisher.

Plasmids

Human V5-tagged PCSK9 and LDLR subcloned into pIRES2-EGFP vector were a kind gift from Dr. Nabil Seidah (Clinical Research Institute of Montreal). PC5 and furin (pDONR221-hPC5 and pENTR223-Furin, DF/HCC DNA Resource Core, Harvard Medical School) were PCR-amplified and fused in frame with the V5 epitope tag subcloned into pIRES2-EGFP (16). Full-length human SREBP-2 was purchased from Open Biosystems (pCMV-SPORT6-hSREBP2; accession number BC056158, catalog no. MHS1010-9205715). The cDNA fragment encoding the transcriptionally active nuclear form of SREBP-2 (amino acids 1–468 with stop codon) (17) was PCR-amplified using Phusion High-Fidelity DNA polymerase (catalog no. F-530, Finnzymes) and subcloned into pIRES2-EGFP vector. All selected clones were verified by DNA sequencing.

Cell Culture and Transfections

Human hepatoma cell lines HepG2 and Huh-7 were routinely cultivated in Dulbecco's modified Eagle's medium (DMEM; catalog no. 319-005-CL, Wisent) supplemented with 10% fetal bovine serum (FBS; catalog no. 080-350, Wisent). For sterol-regulated conditions, HepG2 cells were incubated in 5% LPDS, 50 μm mevastatin, and 50 μm mevalonolactone in the absence (−sterols) or presence of 1 μg/ml 25-hydroxycholesterol and 10 μg/ml cholesterol (+sterols) for 24 h. Fresh medium was added (−/+ sterols) without (−) or with (+) 10 μm 5-AzaC for another 24 h. Human embryonic kidney 293 (HEK293) cells were cultivated in complete DMEM without sodium pyruvate (catalog no. 319-015-CL, Wisent). Chinese hamster ovary (CHO)-K1 cells and CHO-K1-derived cell lines 25-RA (SCAP⁺) (18), M19 (S2P-deficient) (19), and AC29 (SCAP⁺ and ACAT-deficient) (20) were cultivated in F12K/DMEM (1:1) medium containing 5% FBS. HepG2 cells were transfected with X-tremeGENE 9 (catalog no. 06365779001, Roche Applied Science), and HEK293 cells were transfected with Lipofectamine 2000 (catalog no. 11668-019, Invitrogen) DNA transfection reagents according to the manufacturer's recommendations.

Animals

Wild-type C57BL/6 male mice were obtained from Charles River and maintained on a standard rodent diet for 3 days in a 12-h light/12-h dark cycle for acclimatization. Pcsk9-deficient male mice (Pcsk9^−/−; Jackson Laboratories) were continuously backcrossed to C57BL/6 mice at least six generations prior to experimentations. 8–10-week-old male mice (∼25 g) were injected intraperitoneally or subcutaneously with 0.9% NaCl (saline) or with 2.5, 5, or 10 mg/kg/day 5-AzaC. 24, 48, or 120 h postinjection, mice were anesthetized, and blood was collected by cardiac puncture, and dissected livers were snap-frozen in liquid nitrogen for further analyses. The Montreal Heart Institute Animal Care and Ethical Committee approved all animal studies.

Reverse Transcription and Quantitative Real-time PCR

The integrity of total RNA samples, isolated using TRIzol (catalog no. 15596026, Invitrogen), was verified by agarose gel electrophoresis or by an Agilent 2100 Bioanalyzer profile. Afterward, cDNA was prepared using SuperScript II reverse transcriptase according the manufacturer's instructions (catalog no. 18064-014, Invitrogen). Quantitative real-time PCR was performed with the MX3000p real-time thermal cycler (Agilent) using PerfeCTa SYBR Green SuperMix, UNG, Low ROX (catalog no. 95070–100, Quanta Biosciences). For each gene of interest, dissociation curves and agarose gel electrophoresis were performed to ensure a unique PCR product. Arbitrary units were determined from PCR duplicates for each sample using the TATA box-binding protein (TBP), the ribosomal protein S14, or glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as a normalizer. Oligonucleotide sequences are listed in Table 1.

TABLE 1.

Oligonucleotides used for quantitative PCR and plasmid constructions

Quantitative PCR	Forward (5′ → 3′)	Reverse (5′ → 3′)
Gene (accession no.)
Human PCSK9 (NM_174936)	ATCCACGCTTCCTGCTGC	CACGGTCACCTGCTCCTG
Human HMGCR (NM_000859)	GTCACATGATTCACAACAGG	GTCCTTTAGAACCCAATGC
Human LDLR (NM_000527)	AGGAGACGTGCTTGTCTGTC	CTGAGCCGTTGTCGCAGT
Human SREBF2 (NM_004599)	AGAATGTCCTTCTGATGTCC	GGAGAGTCTGGCTCATCTT
Human AGPAT9 (NM_032717)	CGTCTGTGACGTGTGGTACA	TCCTCCATCCCAGGGAAGTT
Human H19 (NR_002196)	CTTTACAACCACTGCACTACCTGAC	GATGGTGTCTTTGATGTTGGGCTGA
Human TBP (NM_001172085)	CGAATATAATCCCAAGCGGTTT	GTGGTTCGTGGCTCTCTTATCC
Human RPS14 (NM_001025071)	GGCAGACCGAGATGAATCCTCA	CAGGTCCAGGGGTCTTGGTCC
Mouse Pcsk9 (NM_153565)	TGCAAAATCAAGGAGCATGGG	CAGGGAGCACATTGCATCC
Mouse Hmgcr (NM_008255)	GTACGGAGAAAGCACTGCTGAA	TGACTGCCAGAATCTGCATGTC
Mouse Lldlr (NM_010700)	GTATGAGGTTCCTGTCCATC	CCTCTGTGGTCTTCTGGTAG
Mouse RPS16 (NM_013647)	AGGAGCGATTTGCTGGTGTGG	GCTACCAGGGCCTTTGAGATG
Hamster Ldlr (NM_001246823)	AAGGAGAAGGACACTGTTCC	ATGCTGGAGATAGAGTGGAG
Hamster Gapdh (NM_001244854)	ACCCAGAAGACTGTGGATGG	CGACATGTGAGATCCACGAC
pGLuc constructs
TBP	TGTACTAGTTGAGTATGTAGGATAGATAGTC	GCAAAGCTTGATGTTCACTTTCTTCTTGGC
LDLR	TGTACTAGTCTTATTCCTGGGGGAACCGC	GCAAAGCTTGCTCGCAGCCTCTGCCAGGCAGTG
PCSK9 (1000 bp)	TACACTAGTCTGGTACACAATAGGTGTTTACTG	TGAAAGCTTGAGGGCCAGGGGAGAGGTTGC
PCSK9 (400 bp)	ACAACTAGTAGTCCGGGGGTTCCGTTAATG	TTCTCGGTGGGCTTGGCCTC
PCSK9 (1000 bp; SRE-mut)	PCR1: CAAGGTGGACCCAGGAAACACT	PCR1: CGCAGATCACGGATCCAGAGCCCCATCG
	PCR2: GGCTCTGGATCCGTGATCTGCGCGCCCCAGG	PCR2: TGAAAGCTTGAGGGCCAGGGGAGAGGTTGC
PCSK9 (1000 bp; HNF-mut)	PCR1: CAAGGTGGACCCAGGAAACACT	PCR1: CCTATCTGATTAAACATTCCAGGAACCCCCGGA
	PCR2: GGGGTTCCTGGAATGTTTAATCAGATAGGATCG	PCR2: TGAAAGCTTGAGGGCCAGGGGAGAGGTTGC
Nuclear SREBP-2
pIRES-nBP2 (amino acids 1–468)	CCGCTCGAGGGGCGGTGGCGACGGCACCG	CGTGGATCCTCAGTCTGGCTCATCTTTGACC

DNA Microarrays and Data Analysis

Extracted total RNA was purified with the RNeasy MinElute cleanup kit (catalog no. 74204, Qiagen). The quality of the total RNA was evaluated on an Agilent 2100 Bioanalyzer system. The microarray experiment was performed using the GeneChip Human Gene 1.0 ST (catalog no. 901085, Affymetrix). For each sample, 100 ng of total RNA was converted into cDNA using the Ambion WT Expression Kit (catalog no. 4411974, Invitrogen). 6 μg of the single-stranded cDNA was fragmented and labeled using the Affymetrix GeneChip WT Terminal Labeling Kit (catalog no. 900670), and 2 μg of the resulting cDNA was hybridized onto the chip. The whole hybridization procedure was performed using the Affymetrix GeneChip system according to the protocol recommended by Affymetrix. The hybridization was evaluated with Affymetrix GeneChip Command Console Software (AGCC), and the quality of the chips was evaluated with Affymetrix Expression Console. Partek Genomics Suite was used for data analysis. First, the data were normalized by the RMA (robust multichip average) algorithm, which uses background adjustment, quantile normalization, and summarization. Then the transcripts found to be significantly differentially expressed between control (DMEM) and treatment (5-AzaC) groups by more than 2-fold were included in the gene enrichment and pathway analyses, which were performed using the Web-based DAVID functional enrichment algorithm (21). Complete microarray data can be found in supplemental File 1.

Gaussia Luciferase Assay

Human PCSK9 (−1000 bp), LDLR (−1020 bp), and TBP (−1000 bp) proximal promoter cDNAs were generated by PCR using genomic DNA from HepG2 cells as template. Sterol response element (SRE; bp −345 to −337) and HNF1 (hepatocyte nuclear factor 1) motifs (bp −386 to −374) were mutated within the 1000-bp PCSK9 proximal promoter by directed mutagenesis, as described (22). All amplified products were digested with SpeI and HindIII endonucleases and ligated into pCMV-GLuc vector (catalog no. N8081S, New England Biolabs) in order to replace the CMV promoter. Selected clones were verified by DNA sequencing. All oligonucleotides used are listed in Table 1. Before transfection, HepG2 cells were seeded in 24-well plates at a density of 1.5 × 10⁵/well. 24 h later, cells were transfected in duplicate with the corresponding pGLuc construct. After overnight incubation, cells were washed twice with DMEM and incubated in 0.5 ml of DMEM without or with 10 μm 5-AzaC for 24 h. 20 μl of conditioned media was loaded into black 96-well plates, and relative activity of secreted Gaussia luciferase was assessed by luminescence measurements using the BioLux kit (catalog no. E3300L, New England Biolabs) and the BioTek Synergy 2 microplate reader.

Immunoprecipitation and Western Blot Analysis

Cells were washed three times in phosphate-buffered saline (PBS) and lysed in radioimmune precipitation assay buffer (50 mm Tris/HCl, pH 8.0, 1% (v/v) Nonidet P-40, 0.5% sodium deoxycholate, 150 mm NaCl, and 0.1% (v/v) SDS) supplemented with a complete protease inhibitor mixture (catalog no. 11 697 498 001, Roche Applied Science). Proteins were separated by 8% SDS-polyacrylamide gel electrophoresis, blotted on nitrocellulose membranes (Bio-Rad), and blocked for 1 h in Tris-buffered saline-Tween 20 (TBS-T; 50 mm Tris-HCl, pH 7.5, 150 mm NaCl, 0.1% Tween 20) containing 5% nonfat dry milk. Membranes were then incubated overnight in TBS-T supplemented with 1% nonfat milk and the indicated antibodies: rabbit anti-PCSK9 (amino acids 31–454) (1:2500; custom made, GenScript), goat anti-human or anti-mouse LDLR (1:1000; catalog no. AF2148 or A2255, R&D Systems), mouse anti-SREBP-1 (1:1000; catalog no. MS-1207, Thermo Fisher Scientific), rabbit anti-SREBP-2 (1:2000 (catalog no. ab30682, Abcam) or 1:10,000 (kindly provided by Dr. Sahng Park, Yonsei University College of Medicine, Seoul, Korea) (23)), mouse anti-V5-tag (1:5000; catalog no. A00641, GenScript), rabbit anti-Stat1 (1:1000; catalog no. 9172, Cell Signaling), hamster anti-SREBP-2 (purified from hybridoma IgG-7D4 (1:5; ATCC), anti-transferrin receptor (1:2500; catalog no. 13-6800, Invitrogen), rabbit anti-β-actin (1:5000; catalog no. A2066, Sigma-Aldrich), or horseradish peroxidase (HRP)-conjugated goat anti-human albumin (1:5000; catalog no. AL10H-G1a, Academy Bio-medical). Appropriate HRP-conjugated secondary antibodies (1:10,000; GE healthcare) were used for detection using the Western Lightning Ultra chemiluminescence kit (catalog no. NEl112001EA, PerkinElmer Life Sciences) and BioFlex EC Films (catalog no. CLEC810, InterScience). Circulating mouse Pcsk9 was immunoprecipitated and analyzed by Western blotting, as described previously (24). Total SREBP-2 was immunoprecipitated from 1 mg of protein (1:500; provided by Dr. Park) together with 50 μl of protein A/G PLUS-agarose (catalog no. sc-2003, Santa Cruz Biotechnology, Inc.) supplemented with protease inhibitors and 25 μg/ml N-acetyl-leucinal-leucinal-norleucinal (catalog no. 208750, Calbiochem). Following overnight incubation, beads were washed six times in radioimmune precipitation assay buffer and resuspended in 75 μl of Laemmli sample buffer. All of the immunoprecipitation procedure was carried out at 4 °C.

Immunocytochemistry

24 h after treatment, HepG2 or CHO cells were washed three times with PBS, fixed with 4% paraformaldehyde for 15 min, permeabilized with 0.1% Triton X-100/PBS for 10 min, and incubated with 150 mm glycine to stabilize the aldehydes. The cells were then incubated for 30 min with 1% BSA (Fraction V, Sigma) containing 0.1% Triton X-100, followed by overnight incubation at 4 °C with rabbit anti-human PCSK9 (1:250) and goat anti-human LDLR (1:100; R&D Systems, catalog no. AF2148). Afterward, cells were incubated for 60 min with corresponding Alexa Fluor-conjugated secondary antibodies (Molecular Probes) and mounted in 90% glycerol containing 5% 1,4-diazabicyclo[2.2.2]octane (Sigma). For the qualitative assessment of free cholesterol, cells were incubated with freshly prepared filipin III diluted in PBS (50 μg/ml) for 1 h at room temperature or overnight at 4 °C. Phospholipids were visualized using LipidTOX Red, and neutral lipids were stained with LipidTOX Green or BODIPY 493/503. Nuclei were counterstained with Hoechst 33342 (1:1000, Molecular Probes). Immunofluorescence analyses were performed with an Olympus FluoView FV10i confocal microscope.

Analysis of SREBP Cleavage

Cell fractionation was carried out as described previously (25) with minor modifications. HepG2 or HEK293 cells from 60-mm dishes were washed three times with PBS and resuspended in 0.4 ml of 10 mm Hepes-KOH (pH 7.5), 10 mm KCl, 1.5 mm MgCl₂, 5 mm sodium EDTA, 5 mm sodium EGTA, and 250 mm sucrose supplemented with complete protease inhibitors and 25 μg/ml ALLN for 30 min on ice. Cells were then passed 25 times through a 22-gauge needle and centrifuged at 1000 × g for 5 min at 4 °C. Supernatants were centrifuged at 100,000 × g for 30 min at 4 °C. Membrane pellets were resuspended in 75 μl of 10 mm Tris-HCl (pH 7.3), 100 mm NaCl, 1% (w/v) SDS, 1 mm EDTA-Na₂, 1 mm sodium EGTA-Na₂. Pellets from the initial 1000 × g spin were resuspended in 0.1 ml of 20 mm Hepes-KOH (pH 7.6), 2.5% (v/v) glycerol, 0.42 m NaCl, 1.5 mm MgCl₂, 1 mm sodium EDTA, and 1 mm sodium EGTA supplemented with protease inhibitor and ALLN, rotated for 1 h at 4 °C, and centrifuged at 100,000 × g for 20 min at 4 °C. The resulting supernatant was designated as the nuclear extract. For liver subcellular fractionation, snap-frozen pieces were homogenized and processed as described above. After total protein concentration measurements, membrane and nuclear fractions were then subjected to Western blot analyses.

Enzymatic Assays and Incorporation of Glycerol 3-Phosphate into Lipids

For CTP-phosphocholine cytidylyltransferase activity, HepG2 cells were plated at a density of 2 × 10⁶/60-mm dish. 48 h later, cells were preincubated with 10 μm 5-AzaC for 2 h and then incubated for 15 min in choline-free Hanks' balanced salt solution supplemented with 2 μCi of ³H-labeled choline chloride per dish without or with 10 μm 5-AzaC and subsequently incubated for up to 4 h in DMEM. Organic and aqueous fractions were isolated, aliquots of each were subjected to thin layer chromatography, and spots corresponding to phosphatidylcholine and p-choline were removed, and radioactivity was determined as described previously (26). Phosphatidic acid (PA)-CTP cytidylyltransferase (CDS) activity was measured as described previously (27) in microsomal fractions of HepG2 cells in the presence of 0–50 μm 5-AzaC. De novo glycerolipid biosynthesis was monitored by the addition of 3 μCi [1,3-³H]glycerol without or with 10 μm 5-AzaC or 0.1 mm cytidine or both for 24 h. Following incubation, phospholipids, diacylglycerol, and triacylglycerol (TG) were extracted and separated by thin layer chromatography, and incorporation of radioactivity was determined as described previously (27).

MS-based Nucleotide Analysis

Metabolites from 5-AzaC-treated and untreated cells (∼5 × 10⁶) were extracted as follows. Cells were washed three times with ice-cold 150 mm ammonium formate, pH 7.4, and scraped into 380 μl of LC/MS grade 50% methanol water mixture. A volume of 320 μl cold acetonitrile was added before the cells were lysed by bead beating for 2 min at 30 Hz (TissueLyser, Qiagen). A volume of 300 μl of ice-cold water and 600 μl of ice-cold methylene chloride was added to the lysate. Samples were vortexed and then allowed to rest on ice for 10 min for phase separation followed by centrifugation at 4000 rpm for 5 min. The upper aqueous layer of the samples was dried by vacuum centrifugation operating at −4 °C (Labconco) and resuspended in 50 μl of LC/MS grade ice-cold water by sonication and vortex. Samples were then clarified by centrifugation for 15 min at 15,000 rpm at 1 °C. For LC/MS-MS analysis, nucleotides were separated by ultrahigh performance liquid chromatography (1290 Infinity UPLC, Agilent Technologies) using a Scherzo SM-C18 (3 × 150 mm) 3-μm column and guard column (Imtakt) operating at 10 °C. Solvent A consisted of 5 mm ammonium acetate in water, and solvent B consisted of 200 mm ammonium acetate in 80% water and 20% acetonitrile. Mono-, di-, and triphosphonucleotides were separated using a linear gradient from 0% to 100% B over a period of 5 min followed by 5 min at 100% B at a flow rate of 0.4 ml/min. Nucleotides were eluted into an electrospray ionization source and detected by multiple reaction monitoring using a triple quadrupole mass spectrometer (6430 QQQ, Agilent Technologies). Quantifying ion integrated intensities were compared with external calibration curves collected at the same time as sample mass spectrometric data acquisition.

RESULTS

5-AzaC Alters Cholesterol-regulated Gene Expression

To study the role of DNA methylation in cholesterol and lipid homeostasis, we first incubated human liver-derived HepG2 cells with increasing concentrations of the unmethylable analog of cytidine 5-AzaC. We observed a very robust and dose-dependent decline in secreted proprotein convertase subtilisin/kexin type 9 (PCSK9) protein levels, the third locus associated with familial hypercholesterolemia (28), whereas albumin secretion remained constant for all dosages tested (Fig. 1A). Quantitative PCR (QPCR) analyses showed that 5-AzaC caused a strong reduction in the mRNA abundance of PCSK9 and HMG-CoA reductase (HMGCR), the rate-limiting enzyme for cholesterol biosynthesis, reaching the maximal effect at 10 μm (Fig. 1B), without apparent cytotoxicity (data not shown). Whereas the expression of the cholesterogenic transcription factor SREBF2 (the gene encoding for SREBP-2) was not significantly modified, we noticed that 5-AzaC increased low density lipoprotein receptor (LDLR) gene expression (Fig. 1B), which is usually co-regulated with PCSK9 and HMGCR through SREBP-2 (29). Then, to define the time required for 5-AzaC to modify cholesterogenic gene expression, HepG2 cells were incubated with 10 μm 5-AzaC for 0, 2, 4, 6, 8, and 24 h. QPCR analyses revealed that PCSK9 and HMGCR expression began to decrease, and that of LDLR increased, already after 6 h and culminated at 24 h postincubation (Fig. 1C). These results show that the effect of 5-AzaC on those genes occurred within 24 h and indicate that inhibition of DNA methyltransferases and de novo methylation during cell division may not be involved.

FIGURE 1.

Dose and time response of 5-AzaC on SREBF2 expression and its downstream target genes. A and B, HepG2 cells were treated with 0, 1, 2.5, 5, 10, or 25 μm 5-AzaC in DMEM for 24 h. A, secreted PCSK9 and albumin (herein used as an internal control) levels were analyzed by Western blotting. Duplicate analysis for each concentration tested is shown. B, relative mRNA levels of SREBP-2 (SREBF2) and target genes (PCSK9, HMGCR, and LDLR) were analyzed by QPCR. C, HepG2 cells incubated without (DMEM; gray bars) or with 10 μm 5-AzaC (black bars) for 0, 2, 4, 6, 8, and 24 h. Relative mRNA levels of PCSK9, HMGCR, LDLR, and SREBF2 were analyzed by QPCR for all time points. Error bars, mean ± S.D. (n ≥ 3, analyzed in duplicate).

To verify if these effects are caused by DNA demethylation, HepG2 cells were incubated with cytidine or its nucleoside analogues 5-AzaC or DAC (Fig. 2A). Remarkably, only 5-AzaC robustly reduced mRNA levels of HMGCR and PCSK9 and increased LDLR expression (Fig. 2B). Kinetic experiments demonstrated that the decrease in PCSK9 expression was not due to the accelerated decay of its mRNA (Fig. 2C). On the other hand, we noticed that the rapid mRNA turnover of LDLR and, to a lesser extent, of HMGCR was stabilized by the addition of 5-AzaC (Fig. 2C), similar to the effect of berberine, a cholesterol-lowering compound (30). Consequently, in human hepatoma HepG2 and Huh-7 cell lines, LDLR protein was strongly up-regulated by 5-AzaC concomitantly to the reduction of PCSK9 (Fig. 2, D and E), a natural inducer of LDLR degradation (reviewed in Ref. 31), but not in HEK293 cells that do not express PCSK9 (Fig. 2D).

FIGURE 2.

5-AzaC reduces PCSK9 and HMGCR gene expression independently of DNA methylation. A, chemical structure of cytidine and its analogs 5-AzaC and DAC. B, HepG2 cells were treated without (DMEM) or with 10 μm cytidine (Cyt), 5-AzaC, or DAC for 24 h. Relative mRNA levels of PCSK9, HMGCR, LDLR, and SREBF2 were analyzed by QPCR. C, for mRNA turnover analyses, HepG2 cells were incubated with 5-AzaC for 24 h and then with 5 μg/ml actinomycin D for 0, 60, 120, and 240 min. PCSK9, HMGCR, and LDLR relative mRNA levels were analyzed by QPCR. Error bars, S.D. (n = 4, analyzed in duplicate). D, HepG2, Huh-7, and HEK293 cells were incubated without (−) or with (+) 10 μm 5-AzaC for 24 h, and LDLR, PCSK9, and β-actin were revealed by Western blot. E, HepG2 cells were incubated with DMEM or with 10 μm 5-AzaC for 24 h, and LDLR (blue) and PCSK9 (green) were revealed by immunocytochemistry as described under “Experimental Procedures.” Scale bar, 20 μm. F, genomic structure of the imprinted H19 locus was extracted from the University of California Santa Cruz Encode whole-genome browser. Note the highly methylated DNA regions (red bars and orange squares) in and near the CpG island (green) present at the H19 locus in HepG2 cells. H19 relative expression was analyzed by QPCR. Error bars, mean ± S.D. (n ≥ 4; analyzed in duplicate). *, p < 0.001.

To compare the impact of 5-AzaC and DAC on DNA methylation, we measured the expression of the large intergenic non-coding RNA H19, a maternally imprinted region hypermethylated in HepG2 cells (Fig. 2F). Under basal conditions, H19 was nearly undetectable in HepG2 cells, but it was strongly re-expressed only upon DAC treatment, ∼125-fold higher than 5-AzaC (Fig. 2F). Because DAC did not significantly modulate expression of PCSK9, HMGCR, and LDLR (Fig. 2B), we conclude that the effect of 5-AzaC on SREBP-2 target genes does not primarily involve DNA methylation.

5-AzaC Promotes Lipid Droplet Formation and Disturbs Lipid Homeostasis

Next, we examined the consequence of 5-AzaC on subcellular distribution of lipids and cholesterol by confocal microscopy. We noticed that 5-AzaC induced an intracellular accumulation of phospholipids and cholesterol only in the presence of lipoproteins (Fig. 3A), which correlates with increased LDLR levels (Fig. 2D). Intriguingly, 5-AzaC strongly induced the formation of lipid droplets (LDs) independently of exogenous lipoproteins (Fig. 3, A and B). Filipin staining also demonstrated a noticeable reduction of cholesterol in cells grown in lipoprotein-deficient serum and treated with 5-AzaC (Fig. 3B), probably resulting from the 5-AzaC-induced HMGCR knockdown (Fig. 2B).

FIGURE 3.

5-AzaC promotes cytosolic neutral lipid accumulation independently of exogenous lipoproteins. HepG2 cells were incubated without (DMEM) or with 10 μm 5-AzaC in either complete medium (10% FBS) (A) or in lipoprotein-deficient serum (5% LPDS) (B) for 24 h. Following incubation, cells were fixed and stained for neutral lipid droplets (LipidTOX Green), phospholipids (LipidTOX Red), and cholesterol (filipin III). Note that 5-AzaC induces distinct dark vesicular structures visible in phase-contrast images that represent neutral lipid droplets. Confocal images are representative of four independent experiments. Selected regions (dotted squares) represent a ×2.5 digital zoom. Scale bar, 20 μm.

To identify the target(s) of 5-AzaC in HepG2 cells, we used a DNA microarray approach and examined modifications in global gene expression. Whole genome expression analyses revealed that from a total coverage of 28,871 genes, 26,955 (93.4%) were not affected, 1,187 (4.1%) were down-regulated, and 729 (2.5%) were up-regulated more than 2-fold after treatment with 5-AzaC (Fig. 4A and supplemental File 1). Gene ontology analyses highlighted that lipid and sterol biosynthetic, transport, localization, and organic acid and ketone metabolic processes were strongly down-regulated, with highly significant p values and -fold enrichments without major modification of other biological processes (Fig. 4A). Even more selectively, SREBPs target genes involved in the complete program of cholesterol (SREBP-2) and fatty acid biosynthesis (SREBP-1) (29) were significantly down-regulated by 5-AzaC (Fig. 4, B and C). Thus, we hypothesized that 5-AzaC might have interrupted SREBP activation.

FIGURE 4.

Genome-wide expression profiling reveals 5-AzaC-induced down-regulation of cholesterogenic and lipid genes. HepG2 cells were treated without (DMEM; n = 4) or with 10 μm 5-AzaC (n = 4) for 24 h. A total of eight cDNA libraries were generated and hybridized onto individual Human Gene 1.0 ST microarrays. A, gene ontology analysis using the DAVID functional annotation tool revealed that sterol and lipid processes were predominant in down-regulated genes (upper table). No major biological process emerged in up-regulated genes upon treatment with 5-AzaC (lower table). B and C, relative expression levels of SREBP-2 and SREBP-1 target genes extracted from microarray data (gray bars, DMEM; black bars, 5-AzaC). Listed are genes involved in cholesterol biosynthesis and regulation of low density lipoprotein uptake (LDLR and PCSK9) (B) and genes controlling fatty acid biosynthesis (C). Error bars, mean ± S.D.

5-AzaC Reduces SREBP Nuclear Levels

Cellular sterol levels tightly regulate the activation of membrane-bound SREBPs. When sterol levels are low, SREBPs are released from the ER retention protein INSIG and transported into COPII vesicles toward the Golgi apparatus with the help of SREBP cleavage-activating protein (SCAP) (9). SREBPs are then sequentially cleaved by site 1 (S1P) and site 2 (S2P) proteases to release their transcriptionally active N-terminal domain into the nucleus, which induces genes bearing a promoter-embedded SRE. SREBP-2 induces the expression of cholesterol metabolism genes (e.g. HMGCR, MVK, LDLR, and PCSK9), and SREBP-1 induces that of lipid metabolism genes (e.g. FASN, SCD, and FADS1) (9, 29). Accordingly, to test the effect of 5-AzaC on SREBP-2 activity, we subcloned the proximal promoter of PCSK9, a SREBP-2-regulated gene, and that of TBP (TATA box-binding protein; invariable internal standard used for QPCR analyses) into Gaussia luciferase vector (Fig. 5A). As described previously (22), we mutated separately or in combination the SRE or hepatocyte nuclear factor 1 (HNF1) binding site motifs in PCSK9 promoter, which were shown to be crucial for its sterol-dependent gene expression. In HepG2 cells, relative secreted luciferase activities showed that 5-AzaC lowers exclusively the transcriptional activity of wild-type PCSK9 promoter (Fig. 5A), probably affecting nuclear SREBP-2 and/or HNF1 content. Consequently, HEK293 cells were transfected with a transcriptionally active nuclear form of SREBP-2, which bypasses the sterol-dependent regulation present in the ER (9). Under this condition, 5-AzaC did not alter the nuclear transport or content of truncated SREBP-2 and failed to repress its transcriptional activity (Fig. 5B). In sterol-deprived HepG2 cells, PCSK9, HMGCR, and LDLR mRNAs are markedly up-regulated, an effect that can be reversed by adding sterols (Fig. 5C) (32), which block the activation of SREBP-2 and reduce its nuclear form (Fig. 5D). Similarly to sterols, 5-AzaC decreased PCSK9 and HMGCR mRNA levels (Fig. 5C) resulting from reduced nuclear SREBP-2 protein levels (Fig. 5D). In addition, 5-AzaC also strongly lowered nuclear content of the lipogenic transcription factor SREBP-1 (Fig. 5D). Importantly, 5-AzaC did not affect SREBP-2 protein synthesis after 4 h of incubation as compared with CHX (Fig. 5E). Total SREBP-2 protein levels were decreased after a 24-h incubation with 5-AzaC, albeit less than with CHX, probably resulting from the autoregulatory feedback loop of SREBP-2 (33). Of note, protein levels of PCSK9, LDLR, or proprotein convertases PC5A and furin, all under the control of a CMV promoter and overexpressed in HepG2 cells, were not regulated by 5-AzaC, indicating that protein synthesis is not affected (data not shown). Taken together, our data demonstrated that 5-AzaC most likely prevents SREBPs activation within the secretory pathway.

FIGURE 5.

5-AzaC prevents SREBP processing. A, HepG2 cells transfected with Gaussia luciferase (pGluc) plasmids under the control of TBP or PCSK9 proximal promoters. SRE and HNF1 motifs were mutated within PCSK9 promoter. 24 h post-transfection, cells were incubated with 10 μm 5-AzaC for 24 h. Secreted luciferase relative activity was measured and normalized to total secreted protein levels. Error bars, mean ± S.D. (n = 4, analyzed in duplicate). *, p < 0.05. B, HEK293 cells were transfected with an empty vector (Vect), nuclear (nBP2) or full-length (FL) SREBP-2. After overnight incubation, cells were incubated without (−) or with (+) 10 μm 5-AzaC for 24 h. Total and nuclear SREBP-2 protein levels (top panel) and relative mRNA expression of its downstream targets (bottom panels) were analyzed by Western blotting and QPCR, respectively. P, SREBP-2 precursor. N, SREBP-2 nuclear form. C, in condition 1, HepG2 cells were incubated without (−) or with (+) 10 μm 5-AzaC in complete medium. After 24 h, cells were incubated in conditioned medium without or with sterols, as described under “Experimental Procedures,” for 24 h in the absence of 5-AzaC. In condition 2, cells were incubated in conditioned medium without or with sterols for 24 h and then incubated without (−) or with (+) 10 μm 5-AzaC until 48 h. HepG2 cells were also treated without (Ctl) or with 10 μm 5-AzaC (+Aza) in complete medium (10% FBS) for 48 h. PCSK9, HMGCR, LDLR, and SREBF2 relative mRNA levels were analyzed by QPCR. D, 5-AzaC impedes transport of SREBPs to the nucleus. HepG2 cells treated with sterols or 5-AzaC were lysed and fractionated. Subcellular SREBP-2 and SREBP-1 protein levels and specific markers (transferrin receptor (TfR), membrane; STAT1, nucleus) were analyzed by Western blotting. E, HepG2 cells were incubated with 5 μg/ml actinomycin D (ActD) in the presence of 10 μm 5-AzaC or 5 μg/ml CHX for 4 or 24 h. Total SREBP-2 was immunoprecipitated (IP) and analyzed by Western blotting. The specificity was confirmed by the absence of immunoreactive bands in lane 1 (immunoprecipitation without SREBP-2 antisera) and the presence of SREBP-2 precursor (P) and nuclear (N) forms following overexpression of full-length (BP2 (FL)) or nuclear SREBP-2 (nBP2) (right). F, CHO-K1, 25-RA, M19, or AC29 cell lines were treated with 5-AzaC or CHX for 24 h. SREBP-2 precursor (P) and nuclear (N) forms and β-actin protein levels (top) and relative LDLR mRNA levels (bottom) were analyzed. G, lipid droplet staining (BODIPY 493/503) in CHO-K1, 25-RA, M19, or AC29 cell lines treated with 5-AzaC for 24 h. Scale bar, 20 μm. For A–G, n ≥ 4, analyzed in duplicate. Data and error bars represent mean ± S.D. *, p < 0.001.

We next compared the direct effect of 5-AzaC on SREBP-2 synthesis and processing in M19, 25-RA, and AC29 CHO mutant cell lines. M19 cells are cholesterol auxotroph because they are deficient for S2P and unable to release membrane-bound SREBPs (19). 25-RA cells constitutively express active SREBPs due to the mutation D443N in the sterol-sensing domain of SCAP that prevents binding to INSIG and ER retention of SREBPs in the presence of sterols (18). Isolated from the 25-RA cell line, AC29 cells are also deficient in acyl-CoA:cholesterol acyltransferase 1 (ACAT1) and cannot esterify cholesterol within the ER (20). Upon treatment with 5-AzaC, we observed a reduction of both precursor and nuclear forms of SREBP-2 in parental CHO-K1 cells, but not in 25-RA and AC29 cells that are insensitive to sterols and constitutively activate SREBP-2 (Fig. 5F). In contrast, CHX blocked SREBP-2 protein synthesis in CHO-K1 as well as in 25-RA and AC29 mutant cell lines at levels comparable with S2P-deficient M19 cells (Fig. 5F). Therefore, the mRNA expression of the SREBP-2 target gene LDLR was found to be reduced by 5-AzaC only in CHO-K1 cells, suggesting impaired SREBP-2 activation and signaling (Fig. 5F, bottom). Of note, LDLR mRNA is not stabilized in 5-AzaC-treated CHO-K1 cells as compared with HepG2 cells (Fig. 2C). Importantly, we noticed that 5-AzaC induced the formation of LDs exclusively in CHO-K1 cells, emphasizing a direct involvement of both SREBP and ACAT1 (Fig. 5G). Therefore, we conclude that 5-AzaC directly interferes with cholesterogenic and lipid gene expression by promoting cholesterol accumulation in the ER and inhibition of SREBP processing.

Cross-talk between Pyrimidine and Glycerolipid Biosynthesis

GPAT3 (glycerol-3-phosphate acyltransferase 3) is an ER-associated enzyme that plays an important role during adipogenesis by catalyzing the initial step for de novo TG synthesis (Fig. 6A) (34). Our microarray and QPCR data revealed that AGPAT9 (1-acylglycerol-3-phosphate O-acyltransferase 9, the gene encoding for GPAT3) is among the highest up-regulated genes by 5-AzaC in HepG2 cells (∼20-fold; Fig. 6B and supplemental File 1). Moreover, 5-AzaC strongly reduced apolipoprotein B-100 (apoB100) secretion (Fig. 6C), which may be a result of cellular lipid diversion to LDs or disturbance of phospholipid homeostasis (35). Diacylglycerol kinase mRNA was also strongly decreased by 19-fold (Fig. 6A and supplemental File 1). This prompted us to investigate in more detail the implication of the glycerolipid biosynthesis pathway in response to 5-AzaC. Quantification of the de novo glycerophospholipid biosynthesis confirmed a strong increase in TG and highlighted a significant decrease in cardiolipin synthesis (Fig. 6D). The addition of propranolol, a phosphatidic acid phosphohydrolase (PAP) inhibitor (Fig. 6A) (36), significantly tempered the effect of 5-AzaC on PCSK9, HMGCR, and AGPAT9 gene expression (Fig. 6B), secreted PCSK9 (Fig. 6C), and LD formation (Fig. 6E). Although it is a cytidine analog, 5-AzaC did not directly inhibit CTP-dependent enzymes of the de novo glycerolipid pathway (Fig. 6A) (37) because the enzymatic activity of CTP-phosphocholine cytidylyltransferase (26) in HepG2 cells and CDS (27) assayed in vitro was not reduced (data not shown). However, 5-AzaC is known to inhibit UMP synthase (UMPS; Fig. 6A), an enzyme involved in de novo pyrimidine biosynthesis (6). In fact, UTP and CTP levels were found to be significantly decreased by 52 and 29%, respectively, in 5-AzaC-treated HepG2 cells (Fig. 7A). Similar to 5-AzaC, incubation of HepG2 cells with pyrazofurin, a potent inhibitor of UMP synthase (38), strongly decreased UTP and CTP levels (Fig. 7A) and also provoked accumulation of LDs, which was reversed by the addition of UMP (Fig. 7B). Thus, we posited that 5-AzaC modifies lipid homeostasis and induces the formation of LDs through breakdown of endogenous CTP synthesis, which is crucial for glycerophospholipid biosynthesis (39). Indeed, co-incubation with either UMP or cytidine, but not DAC, completely prevented the effect of 5-AzaC on AGAPT9 and SREBP-2 target genes (Fig. 6B), apoB100 secretion (Fig. 6C), cardiolipin and TG synthesis (Fig. 6D), and LD formation (Fig. 6E).

FIGURE 6.

Cross-talk between de novo glycerolipid and pyrimidine synthesis. A, metabolic pathways of de novo pyrimidine and glycerolipid synthesis. Inhibition of UMP synthase (UMPS) and phosphatidic acid phosphohydrolase (PAP) by 5-AzaC and propranolol, respectively, is depicted. B–E, HepG2 cells were incubated with 10 μm 5-AzaC alone or supplemented with 30 μm propranolol or 0.1 mm UMP, cytidine (Cyt), or DAC (shown in E) for 24 h. B, PCSK9, HMGCR, LDLR, and AGPAT9 expression was analyzed by QPCR. Error bars, S.D. (n ≥ 3, analyzed in duplicate). *, p < 0.001; **, p < 0.05. C, secreted apoB100, PCSK9, and albumin (herein used as an internal control) levels were revealed by Western blotting. D, de novo glycerolipid synthesis was monitored by the addition of 3 μCi of [1,3-³H]glycerol without or with 10 μm 5-AzaC or 0.1 mm cytidine or both for 24 h. Incorporation of radiolabeled glycerol in triacylglycerol (TG) and cardiolipin (CL) was measured. E, presence of cytosolic lipid droplets (green staining) and phospholipidosis (insets; positive control for propranolol, red staining) was analyzed by confocal microscopy. Scale bar, 20 μm. For C–E, n ≥ 3, analyzed in duplicate. Data and error bars represent mean ± S.D. *, p < 0.05.

FIGURE 7.

Inhibition of pyrimidine synthesis by 5-AzaC and pyrazofurin. A, HepG2 cells were incubated with 10 μm pyrazofurin for 4 h or with 10 μm 5-AzaC for 24 h. Total UTP and CTP nucleotides were measured by LC/MS as described under “Experimental Procedures.” B, HepG2 cells were incubated with 10 μm pyrazofurin alone or supplemented with 0.1 mm UMP for 24 h. Cytosolic lipid droplets (green staining) were revealed with BODIPY 493/503. Scale bar, 20 μm. Data (n ≥ 3) and error bars represent mean ± S.D. *, p < 0.05.

5-AzaC Reduces Nuclear SREBP-2 and Expression of Its Target Genes in Mouse Liver

Next, we tested the ability of 5-AzaC to decrease the expression of SREBP-2-regulated genes in vivo. C57BL/6 or hypocholesterolemic Pcsk9^−/− mice were injected intraperitoneally with a low dose of 5-AzaC (2.5, 5, or 10 mg/kg/day; 10 mg/kg corresponds to one-third of the dose used in the clinic) (40). Similarly to HepG2 cells (Fig. 1, A and B), 5-AzaC strongly reduced in a dose-dependent manner Pcsk9 and Hmgcr expression and that of Hmgcr in the liver of C57BL/6 and Pcsk9^−/− mice, respectively (Fig. 8, A and B). In addition, circulating Pcsk9 was barely detectable in plasma of C57BL/6 mice injected with 10 mg/kg 5-AzaC (−95%; Fig. 8C). However, 5-AzaC did not significantly alter Ldlr gene expression, and even the strong reduction of Pcsk9 expression did not result in increased hepatic Ldlr protein levels for this short period of time (Fig. 8, A and D).

FIGURE 8.

5-AzaC decreases nuclear SREBP-2 levels and expression of its target genes in vivo. A, for each group, C57BL/6 (n = 4) male mice (∼20 g, 8–10 weeks) were injected intraperitoneally with saline (0.9% NaCl; 0) or with 2.5, 5, or 10 mg/kg 5-AzaC. 24 h later, hepatic relative mRNA levels of Pcsk9, Hmgcr, and Ldlr were analyzed by QPCR. B, C57BL/6 or Pcsk9^−/− mice were injected intraperitoneally with two doses of saline (n = 3) or of 10 mg/kg/day 5-AzaC (n = 3). Hepatic relative mRNA levels of Pcsk9, Hmgcr, and Ldlr were analyzed by QPCR. C and D, mice were injected intraperitoneally once with saline or 10 mg/kg 5-AzaC. C, plasma Pcsk9 was immunoprecipitated, and relative circulating levels were determined by Western blotting. Plasma from untreated Pcsk9^−/− mice was used as immunoprecipitation control. D, total liver Ldlr and β-actin protein levels were analyzed by Western blotting. E, for each group, four C57BL/6 males were injected intraperitoneally (IP; black bars) with one (1d), two (2d), or subcutaneously (SC; gray bars) with five (5d) doses of saline or 10 mg/kg/day 5-AzaC. For one- and two-dose conditions, samples were collected 48 h postinjection. Relative mRNA levels of Pcsk9, Hmgcr, and Ldlr were analyzed by QPCR. F–H, C57BL/6 male mice were injected with two doses of saline (n = 3) or of 10 mg/kg/day 5-AzaC (n = 3). 48 h later, plasma and livers were collected. F, plasma Pcsk9 was analyzed as described in C. Total liver Ldlr and β-actin (normalizer) (G) and nuclear SREBP-2 and Stat1 (normalizer) (H) protein levels were measured by Western blotting. Stat1 and Ldlr were used as subcellular markers for nuclear and membrane fractions, respectively. Error bars, S.D. (n ≥ 3, analyzed in duplicate). *, p < 0.05. A.U., arbitrary units.

To assess the impact of multiple doses of 5-AzaC (similar to clinical dosage regimen for MDS patients) (3) on SREBP-2 target genes, C57BL/6 mice were injected intraperitoneally or subcutaneously with one, two, or five doses of 10 mg/kg/day 5-AzaC (Fig. 8E). Our QPCR data showed that at least two consecutive doses of 5-AzaC are needed to robustly decrease Pcsk9 (−77%) and Hmgcr (−68%) mRNA levels (saline versus two or five doses (2d or 5d); Fig. 8E), indicating that 5-AzaC could have been eliminated 48 h after a single injection (one dose (1d); Fig. 8E). Accordingly, circulating Pcsk9 was strongly reduced after two injections of 10 mg/kg 5-AzaC (−75%; Fig. 8F), which resulted in an increase in total Ldlr protein levels (∼1.7-fold; Fig. 8G). Based on our observations that 5-AzaC decreased nuclear SREBP-2 levels in HepG2 cells (Fig. 5), we next proceeded to the subcellular fractionation of mouse liver cells. Western blot analyses of cell fractions indicated that, compared with saline, nuclear Srebp-2 protein levels were significantly reduced in livers of mice injected with two doses of 10 mg/kg 5-AzaC (−50%; Fig. 8H). These data provide further evidence that 5-AzaC severely interferes with the SREBP pathway and cholesterogenic and lipid gene expression both in vitro and in vivo.

DISCUSSION

5-AzaC and DAC can both inhibit DNA methylation but differ in terms of modulation of gene expression (5). Herein, our data demonstrated that 5-AzaC, independently of DNA methylation, specifically down-regulates expression of SREBP-regulated genes in addition to increasing the formation of LDs. Despite the fact that ∼95% of genes were unaffected by 5-AzaC, expression profiling analyses have revealed a highly significant enrichment for cholesterol and lipid metabolic processes among repressed transcripts (Fig. 4A and supplemental File 1). Using subcellular fractionation, we showed that 5-AzaC strongly decreased nuclear levels of the transcription factors SREBP-1 and SREBP-2 (Figs. 5D and 8H). In addition, whether added before or after mevastatin treatment (condition 1 or 2, respectively; Fig. 5C), 5-AzaC antagonized the SREBP-2-induced PCSK9 and HMGCR gene expression. Our results showed that 5-AzaC did not interfere with nuclear translocation or degradation of a truncated soluble form of SREBP-2 (Fig. 5B) but rather hampered activation of its transmembrane precursor. Indeed, 5-AzaC prevented SREBP-2 signaling in mouse liver (Fig. 8) and in HepG2, Huh-7 (Figs. 1 and 2), HEK293 (Fig. 5B), and CHO-K1 (Fig. 5F) cells but not in the 25-RA cell line (Fig. 5F), suggesting that 5-AzaC impedes the transport of SCAP/SREBP-2 complex by altering intrinsic ER cholesterol content. Interestingly, 5-AzaC strongly up-regulated LDLR expression and protein level through mRNA stabilization in liver cells only (Fig. 2, B–D). This implies that the nucleoside analog impacts at least one of the pathways regulating LDLR mRNA degradation in hepatoma cells (41).

Growing evidence shows that phospholipid and glycerolipid homeostasis is crucial for lipoprotein secretion, lipid storage, and sensitivity of SREBPs to ER cholesterol levels (35, 42, 43). Accordingly, we noticed that 5-AzaC promoted TG and LD formation and severely altered apoB100 secretion (Fig. 6, C–E). Our microarray data also revealed that MTTP (microsomal triglyceride transfer protein) and FABP1 (fatty-acid binding protein 1) were strongly down-regulated by 5-AzaC in HepG2 cells (>8-fold; supplemental File 1), without globally affecting expression of apolipoproteins, lipoprotein receptors, cholesterol transporters, and other major regulators of lipid metabolism (e.g. ACAT1, ABCG5/8, MYLIP, and CH25H). MTTP and FABP1 are required to lipidate apoB100 and therefore to properly form nascent very low density lipoprotein particles (44, 45). In case of interruption of very low density lipoprotein assembly or cholesterol and lipid overload within the ER, cells maintain homeostasis by promoting the formation of cytosolic LDs (46). Moreover, we noticed that AGPAT9 is among the highest up-regulated genes by 5-AzaC in HepG2 cells (supplemental File 1 and Fig. 6B). It has been shown that ectopic overexpression of AGPAT9 promotes lipogenesis by selectively increasing TG production without affecting phospholipid synthesis (34, 47). Thus, we surmise that the combined dysregulation of MTTP, FABP1, and AGPAT9 gene expression by 5-AzaC contributes to the accumulation of cytosolic LDs and reduced SREBP processing. However, SREBP-2 is still processed in 25-RA CHO cells that spontaneously accumulate LDs regardless of the presence of 5-AzaC (Fig. 5, F and G). Also, in 5-AzaC-treated HepG2 cells, the addition of propranolol prevented the formation of LDs (Fig. 6E) and partially rescued PCSK9, HMGCR, and AGAPT9 expression (Fig. 6B) but had no obvious effect on apoB100 secretion (Fig. 6C). Therefore, the existence of a direct link between the effect of 5-AzaC on apoB100, LD formation, and activation of SREBPs remains to be determined.

As a ribose analog, 5-AzaC can also be incorporated into different RNA species and affect their functions (6). Nonetheless, our results indicate that the specific effects we observed on SREBP-2 targets, except for LDLR stabilization, do not involve mRNA degradation (Fig. 2C) or inhibition of protein synthesis (Fig. 5, E and F). In addition, 5-AzaC did not directly inhibit CTP-phosphocholine cytidylyltransferase or CDS activity. Hence, we reasoned that it might interrupt SREBP signaling through the direct inhibition of UMP synthase (6), which is crucial for the synthesis of CTP required for TG and glycerophospholipid biosynthesis pathways (Fig. 6A) (37, 39). Indeed, co-incubation with either UMP or cytidine entirely reversed the effects of 5-AzaC (Fig. 6, B–D). Our data strongly suggest that, by reducing the de novo synthesis of CTP needed for CDP-diacylglycerol formation by CDS, 5-AzaC selectively reroutes the conversion of PA toward TG synthesis, which provokes an accumulation of intracellular LDs and a reduction of cardiolipin synthesis (Fig. 6). Interestingly, our microarray data also revealed that diacylglycerol kinase (Fig. 6A and supplemental File 1) mRNA is strongly reduced by 5-AzaC, suggesting that CTP depletion selectively targets the synthesis of glycerolipids. Although very little is known about AGPAT9 and DGK (diacylglycerol kinase) gene regulation, it is conceivable that by indirectly reducing CDS enzymatic activity, 5-AzaC may disturb key intermediate metabolites downstream of PA or may act via diacylglycerol, which was shown to regulate a number of intracellular signaling networks (Fig. 6A) (37).

One of the major hallmarks of cancer cells is their capacity to reprogram metabolic pathways to stimulate the biosynthesis of proteins, cholesterol, and lipids (48). Rapid cell proliferation requires increased uptake of lipids and de novo lipogenesis to continuously provide mevalonate pathway metabolites, cholesterol, and fatty acids needed for cell membrane synthesis, cell signaling, post-translational modifications of proteins, and energy supply (12, 49). Increased SREBP signaling in bone marrow and peripheral blood cells of patients with MDS has been associated with poor survival prognosis (50). In addition, it was demonstrated that the activation of the SREBP pathway protects cancer cells from lipotoxicity (51) and promotes growth of activated CD8⁺ T lymphocytes (52), which expand in MDS patients (53). Through the mevalonate pathway, SREBPs also provide key intermediates required for the isoprenylation of small GTPases, such as farnesylation of Ras and geranylgeranylation of Rho, both involved in cancer progression and metastatic dissemination (54). Accordingly, recent studies revealed that statin therapy, which inhibits HMG-CoA reductase and blocks mevalonate and sterol synthesis, significantly improved overall survival in patients with MDS and acute myeloid leukemia (55, 56).

Although clinical benefits of 5-AzaC are associated with re-expression of hypermethylated tumor suppressor genes in MDS patients, its therapeutic mechanism remains largely undefined (2, 7, 40). Therefore, we propose that, in addition to DNA hypomethylation, inhibition of CTP synthesis and SREBP signaling could contribute to the beneficial cytostatic effect of 5-AzaC in MDS patients. This work has revealed a previously unrecognized cross-talk between pyrimidine and glycerolipid synthesis and cholesterol-regulated activation of SREBPs and highlights new potential molecular targets with the aim of preventing hematological disorders.