Role of leukotriene A₄ hydrolase aminopeptidase in the pathogenesis of emphysema

Abstract

The leukotriene A₄ hydrolase (LTA₄H) is a bi-functional enzyme with an epoxy hydrolase and aminopeptidase activities. We hypothesize that the LTA₄H aminopeptidase activity alleviates neutrophilic inflammation, which contributes to cigarette smoke (CS)-induced emphysema by clearing Proline-Glycine-Proline (PGP), a tri-amino acid chemokine known to induce chemotaxis of neutrophils. To investigate the biological contributions made by the LTA₄H aminopeptidase activity in CS-induced emphysema, we exposed wild type mice to CS over five months while treating them with a vehicle or a pharmaceutical agent (4MDM) that selectively augments the LTA₄H aminopeptidase without affecting the bio-production of leukotriene B₄ (LTB₄). Emphysematous phenotypes were assessed by pre mortem lung physiology with a small animal ventilator and by postmortem histologic morphometry. CS exposure acidified the airspaces and induced localization of the LTA₄H protein into the nuclei of the epithelial cells. This resulted in accumulation of PGP in the airspaces by suppressing the LTA₄H aminopeptidase activity. When the LTA₄H aminopeptidase activity was selectively augmented by 4MDM, the levels of PGP in the BALF and infiltration of neutrophils into the lungs were significant reduced without affecting the levels of LTB₄. This protected murine lungs from CS-induced emphysematous alveolar remodeling. In conclusion, CS exposure promotes the development of CS-induced emphysema by suppressing the enzymatic activities of the LTA₄H aminopeptidase in lung tissues and accumulating PGP and neutrophils in the airspaces. However, restoring the LTA₄ aminopeptidase activity with a pharmaceutical agent protected murine lungs from developing CS-induced emphysema.

Introduction

Leukotriene A₄ hydrolase (LTA₄H) has been known as a bi-functional enzyme. While two enzymatic activities share an overlapping substrate site, their biological functions are distinctive.(1, 2) The LTA₄H epoxy hydrolase (EH) converts leukotriene A₄ (LTA₄) to leukotriene B₄ (LTB₄), which is a potent inducer of neutrophil, macrophage, and T lymphocyte chemotaxisin human diseases.(3–10) The LTA₄H aminopeptidase degrades the n-terminus of peptides. Several studies demonstrated that a chemotactic tri-amino acid peptide, Proline-Glycine-Proline (PGP), is produced due to breakdown of collagen by prolyl-endopeptidase, and PGP has been shown to induce chemotaxis of neutrophils by binding to CXCR2.(11–19) Recently LTA₄H aminopeptidase has been reported to breakdown and clear PGP, thus, mitigating the influx of neutrophils into murine lungs post influenza infection.(20)

Pulmonary emphysema is a major manifestation of COPD. It is characterized by alveolar destruction in patients due to infiltration of neutrophils, lymphocytes, and macrophages into cigarette smoke (CS)-exposed lungs.(3, 8, 14, 21–23) Although a number of mechanisms were proposed to explain the pathogenesis of emphysema, its molecular pathogenesis is not yet clearly understood. Neutrophil-rich inflammation in emphysematous lungs of smokers led us to hypothesize that the LTA₄H aminopeptidase activity and bio-production/clearance of PGP may play an important role during the development of CS–induced neutrophilic inflammation and emphysema.

Our laboratory has previously reported that the LTA₄H enzymatic activities make important contribution to the development of emphysematous tissue alterations.(3, 24, 25) LTA₄H activity was found to influence severity of emphysematous alveolar remodeling in murine lungs exposed to transgenically over-expressedinterleukin-13.(3, 24) LTA₄H EH activity was found to contribute to emphysematous alveolar remodeling and neutrophilic infiltration into lungs post exposure of intra-nasal elastase.(3, 24) While a number of studies have characterized the importance of the LTA₄H EH, no studies have investigated the biological contributions made by the LTA₄H aminopeptidase during the development of emphysema. Therefore, we first investigated the CS-induced alterationsin the localization and enzymatic activity of the LTA₄H protein. These studies demonstrated that CS significantly increased the amount of LTA₄Hprotein in murine lungs and led to specific patterns of LTA₄H protein localization in lung tissues. Chronic exposure to CS also caused acidification of the bronchoalveolar lavage fluid (BALF) in mice, which suppressed the enzymatic activity of the LTA₄H aminopeptidase in the BALF. All of these events promoted exaggerated bio-production of PGP and LTB₄. When the activity of the LTA₄H aminopeptidase was restored by selectively augmenting it without changing the EH activity, murine lungs were protected from CS-induced emphysematous damage due to reduction in the levels of PGP and neutrophilic infiltration into the lungs without changes in the levels of LTB₄. These studies demonstrate that the LTA₄H aminopeptidase pathway is an important contributor for the CS-induced neutrophilic inflammation, PGP clearance, and emphysematous alveolar remodeling independent of the LTA₄H epoxy hydrolase pathway.

Materials and Methods

Formulation of 4MDM to improve water solubility and characterization of 4MDM bioavailability

The solubility of 4MDM was enhanced by formulation with 2-hydroxypropyl-β-cyclodextrin (CDX) and dextrose. The vehicle was prepared as an aqueous solution of CDX and dextrose without 4MDM. Maximum tolerated dose (MTD) was first determined with WT mice (n = 10) then the CDX-4MDM dose equal to 25% of the MTD was used in all subsequent in vivo studies. The solutions were administered as drinking water for mice in cages. The levels of 4MDM in BALF were quantified first by enriching 4MDM using C₁₈ Sep-Pak (Waters Corp) then measuring the levels by using High Performance Liquid Chromatography equipped with a UV detector (HPLC-UV). The HPLC setup consisted of the following: Shimadzu CBM controller, Shimadzu LC20AD pump, Shimadzu SPD20A UV detector, Shimadzu CTO20A column oven, Waters C₁₈ Symmetry HPLC column, and Shimadzu SIL20A auto injector. The Shimadzu EZ Start software was used to operate the instrument and for data analysis. The HPLC method parameters were as follows: binary conditions with a solvent rate of 1 mL/min for 15 minutes and simultaneous UV detection at λ = 237 nm. Each sample was injected twice. First, 100 µL of the unspiked samples was injected. Second, 90 µL of the samples spiked with 10 µL of known amounts of 4MDM were injected. Peaks corresponding to the 4MDM of each sample were identified by superimposing the 4MDM-spiked UV tracing onto the unspiked UV tracing of the samples. The levels of 4MDM were assessed by calculating the area under the curve of the BALF samples to known standard curves of 4MDM.

Cigarette Smoke-induced pulmonary emphysema

129sv wild type mice (WT) were purchased from National Cancer Institute. The LTA₄H knockout mice (LTA₄H KO) were provided by Dr. Beverly Koller (University of North Carolina).(26) Animal use was approved by the University of Virginia Institutional Animal Care and Use Committee. WT and LTA₄H knockout mice, 8 to 12 weeks of age, were exposed to cigarette smoke using a Teague TE-2 smoking apparatus. 3R4F research cigarettes were purchased from the University of Kentucky. Cigarettes were combusted at the rate of 3 cigarettes every 9 minutes, 5 hours a day, 5 days a week, over 5 months. Circulating air was trapped with an inline 22 µm filter attached to the air circulation system and total particulate matters were monitored in the air. Mice were studied 0, 1, 4, 20 weeks post exposure to cigarette smoke. Mice were exposed to either ambient air or cigarette smoke while being treated with either vehicle or a pharmaceutical agent (4MDM), which selectively augments the LTA₄H aminopeptidase activity without affecting the LTA₄H epoxy hydrolase activity.(25)

Pre-mortem pulmonary physiologic assessment

Total lung volume and lung compliance were assessed by the Flexivent (SCIREQ) as previously described.(3, 25, 27, 28) In brief, animals were deeply anesthetized with ketamine &xylazine mixture (60/5 mg per kg weight), the trachea was cannulated using p10 tubing, the sternum was opened, the diaphragm was cleared by opening the abdominal cavity, and animals were ventilated at a respiratory rate of 120 breaths per minute with PEEP 3 cm H₂O per a pre-written macro program. This technique ensured that the live animals’ voluntary effort could not influence the physiologic values detected by the Flexivent. Once the animals were acclimated to the Flexivent ventilator, the prescribed Flexivent algorithm was performed as previously described.(3, 25, 27,28), and the total lung volume and compliance were calculated using the software supplied with the ventilator. Animals were sacrificed following physiologic measurements, and tissues were harvested for post-mortem physiologic and morphometric assessment.

Post-mortem histological lung morphometry assessment

As previously described (3, 24, 25, 29), animals were anesthetized, the trachea was cannulated, and the lungs were removed en block and inflated at 25 cm H₂O pressure of 1% melted low-melting-point agarose gel (Promega) in PBS. The trachea was tied to keep the lungs inflated, and then fixed in 10 mL paraformaldehyde for 18 hours. The fixed lungs were stained with H&E. Alveolar size was determined by mean cordlength (L m) as previously described. (3, 24, 25, 29, 30) Sequential digital pictures (at least 10 per animal) of the entire lungs were captured by an Axiostar microscope (Carl Zeiss Microimaging), then processed by NIH Image 1.63 on a Macintosh computer with a macro downloaded from the NIH server user-macro directory (web link: http://rsb.info.nih.gov/nih-image/download/contrib/ChordLength.SurfaceArea).

Measurement of PGP in Broncholaveolar Lavage Fluid (BALF)

Quantitative analysis of PGP in the BALF by HPLC-MS proved to be highly unreliable presumably due to the matrix effects of the aromatic carbons generated from exposure to cigarette combustion. These aromatic carbons saturated the chromatography columns and made the columns unusable even after the first run of chromatography. Therefore, a two-step preparation of the BALF was performed as follows: First, the BALF was purified by normal flow HPLC. The retention time of a standard solution of PGP was determined in order to guide fractionation of PGP in the BALF samples. Second, the levels of PGP were quantified using a Thermo Electron TSQ Quantum Access MAX mass spectrometer system with a Protanananospray ion source interfaced to a custom-packed 8 cm×75 um (internal diameter) Phenomenex Jupiter 10 um C₁₈ reverse-phase capillary column. A 0.5 uL aliquot of each fractionated extract was injected, and the samples were eluted from the column using a reverse phase gradient from 0% to 100% acetonitrile at a flow rate of 0.5 µL/min over 0.5 hours. The nanospray ion source was operated at +3 kV. The MRM used was 270.2 – 172.9, 116.1.

In silico molecular modeling of LTA₄H, 4MDM, PGP, and LTA₄

The software Virtual Molecular Dynamics version 1.8.7 (VMD) was used to visualize and render the final figure.(31) The manual positioning of the ligands in the LTA₄H substrate-binding site was accomplished using the Molefracture Plugin version 1.3, which is available in the VMD package. The software GROMACS was used for energy minimization of the enzyme and ligands after solvation of the protein and ligands in a TIP3P water model.(32) The ligands were parameterized using the SwissParam server.(33) The minimization was carried out using the CHARMM27 force field, which is available in the GROMACS package.(34) The E296Q mutant of the LTA₄H co-crystallized with the tripeptide Arg-Ala-Arg (PDB: 3B7T) was used as a template to build the Pro-Gly-Pro substrate in the peptidase-binding pocket of the enzyme.(35) A crystal structure of a wild-type LTA₄H (PDB: 3FTV) was used for all subsequent modeling of the protein.(36) On the basis of mutation data, the C-terminus carboxylate was positioned to form a hydrogen bond with the side chain of Arg563.(37) Hydrolysis of the peptide occurs at the N-terminus. Therefore, the N-terminal amine and the carboxyl oxygen were positioned to chelate with the Zn⁺⁺ atom. The LTA₄, a precursor to LTB₄, was docked following mutation data. The substrate was arranged to set two hydrogen bonds between the Arg563 residue and the carboxylic acid moiety of LTA₄.(37)

Development of the LTA₄H ELISA

The concentration of the LTA₄H was determined by a custom-developed ELISA assay. Two LTA₄H antibodies were purchased from commercial vendors. The levels of LTA₄H in the BALF and lung homogenate soup were determined by using double-paired coating antibody (Novus EPR5713) and biotinylated detection antibody (R&D). Recombinant LTA₄H was purchased from Creative BioMart recombinant murine LTA₄H with His-tag as a standard. Fifty µL of samples were used in duplicates to quantify the amount of the LTA₄H. Samples were analyzed against the standard curve generated from known quantities of recombinant mouse LTA₄H enzyme. The ODs were measured with a Dynex Technology TRIAD ELISA reader controlled by Concert-Triad Serves software (version 2.0.0.12.) at a wavelength 450 nm for the measurement of LTA₄H.

FACS analysis of whole lung leukocyte infiltration

Whole lung single cell suspension was analyzed by FACS analysis with. Briefly mouse lungs were harvested then digested in lung digestion media with 1.0 mg/mL collagenase A (Roche Diagnostics) in RPMI (Quality Biological), and erythrocytes were lysed with ACK buffer (Quality Biological). Cells isolated from the lungs were stained with PerCP-labeled CD45 (BD), APC-Cy7-labeled CD11b (BD), PE-labeled Ly6G (BD), and FITC-Labeled LTA₄H (Bioss). Infiltrating leukocytes were gated from non-leukocytes by the expression of CD45. Next, all CD45^high cells were gated into Ly6G^high and CD11b^high cells (neutrophils) as previously described.(3) For the purpose of detecting cells containing the LTA₄H in their intra-cellular space, cells were permeabilized with flow cytometry permeabilization buffer (R&D) after stained with CD45 antibody. Cells expressing LTA₄H were separated into two groups, leukocytes (CD45^high) and non-leukocytes (CD45^low). Multi-color detection of the stained cells was performed on a FACScan flow cytometer (BD Biosciences). FlowJo (version 8.8.6.) was used to analyze the data.

Evaluation of apoptosis in alveolar epithelial cells

Tunel stain was performed with TACS 2Td-DAB in situ apoptosis detection kit per manufacturer’s protocol (Trevigen). Paraffin embedded lung blocks were at 8 µm thickness, then stained with reagents provided in the TACS 2Td-DAB kit. At least 5 animals in each group were studied. Ten adjacent pictures were taken from lungs of each animals at 40× magnification power, positively stained epithelial cells (brown) were counted, then averaged to conduct statistical analyses.

LTA₄H immunohistochemistry

Immunohistochemistry was performed according to the commercial vendor’s protocol (Vectostain Elite ABC kit) with Biogenex antigen retrieval citra plus, Biogenex power block, murine LTA₄H antibody and isotype control antibody (Novus), andDAB Vector peroxidase substrate kit.

Bronchoalveolar lavage fluid (BALF) collection and biochemical analysis

Animals were anesthetized as described above at specified time points, and BALF was collected and processed after pH was measured per previously published method.(3, 20, 24, 25) Concentration of the LTA₄H protein was determined by an ELISA assay developed in our laboratory. Concentrations of KC and MIP2 in BALF were determined by commercially available ELISA kits (R&D). Quantitative analysis of PGP in the BALF by HPLC-MS was achieved in two steps. First, BALF was purified by HPLC then PGP was quantified by a Thermo Electron TSQ Quantum Access MAX mass spectrometer system. Levels of LTB₄ were assessed by a commercially available LTB₄ EIA kit (R&D).(3, 24, 25)

Assessment of the LTA₄H Aminopeptidase activity

Recombinant human LTA₄H enzyme was produced, and the enzymatic properties of the LTA₄H aminopeptidase were assessed with a method previously published by our laboratory.(25) Twenty five µL BALF from each mouse was used to determine in vivo LTA₄H aminopeptidase activity.

Evaluation of metalloproteinase-8 and -9 (MMP8, MMP9)

Total RNA from lung tissue was isolated by Trizol.(3, 24, 25, 29, 30) Sybergreen real-time rt-PCR was performed then standardized with ²-actin to semi-quantify the genes transcribing for MMP8 and MMP9. Primers used for PCR are listed in the Table 1.

Table 1.

Primer sets for real time PCR.

Gene	AT1	Left Primer	Right Primer
β-actin	60 °C	AGCCATGTACGTAGCCATCC	CTCTCAGCTGTGGTGGTGAA
MMP8	60 °C	CCCACCTGAGATTTGATGCT	CTGAAGACCGTTGGGTAGGA
MMP9	60 °C	CAATCCTTGCAATGTGGATG	AGTAAGGAAGGGGCCCTGTA

¹AT = annealing temperature

Statistics

All data were expressed as mean ± SEM and assessed for significance by t test or one-way ANOVA with Bonferroni subgroup comparison as appropriate. All statistics were performed using Prism software (GraphPad). In all analyses, p-value < 0.05 was considered significant.

Results

CS induced emphysematous tissue alteration in murine lungs

129sv WT mice developed progressively severe emphysematous tissue alteration with CS-exposure, and this was demonstrated by all three primary endpoints, pre mortem lung physiology (TLC &C_st) and post mortem histology (L m) (Figure 1).

Figure 1.

Assessment of the emphysema phenotype in 129sv wild type mice post exposure to cigarette smoke by Teague TE-2 smoking apparatus over 5 months. Panel A: Pre mortem total lung volume measured by Sireq Flexivent. Panel B: Pre mortem quasi-static lung compliance measured by Sireq Flexivent. Panel C: Post mortem alveolar L m. Panel D: Representative H&E histology of the lungs at low power (2.5× magnification). Time = duration of exposure to cigarette smoke. Cigarette dose = 3 cigarettes per 9 minutes, 5 hours a day, 5 days a week. * represents analysis by ANOVA. N = 9–13 animals per groups in panels A and B. N = 5 animals per group in panel C.

Effects of CS on LTA₄H protein

Levels of the LTA₄H protein in the BALF and whole lung soup increased and peaked post 4 week CS-exposure. Then levels of the LTA₄H protein in the BALF of the CS-exposed mice decreased to the levels comparable to the age-matched, AA-exposed mice by 20 weeks (Figure 2A). However, levels of the LTA₄H protein in the whole lung protein soup of the CS-exposed mice were still significantly elevated as compared to the AA-exposed mice by 20 weeks (Figure 2B). Significantly more LTA₄H was found in intra-cellular staining of CD45⁺ and CD45^-cells from the CS-exposed lungs as compared to AA-exposed lungs (Figure 2C). The LTA₄H protein was located in the cytosol of the airway epithelial cells in AA-exposed mice, but the LTA₄H protein was localized into the nuclei of the airway epithelial cells in CS-exposed mice (Figure 2D). Levels of LTB₄and PGP were significantly increased in the BALF of CS-exposed mice as compared to AA-exposed mice (Figure 3A and 3B). A significantly increased number of CD45^highCD11b^highLy6G^high cells infiltrated the CS-exposed lungs as compared to AA-exposed lungs (Figure 3C). BALF was found to be significantly more acidic in mice exposed to CS for 20 weeks (pH 6.7) as compared to mice exposed to AA for 20 weeks (pH 7.2) (Figure 3D). Enzymatic activity of the LTA₄H aminopeptidase was found to be significantly suppressed in vitro at pH 6.7 as compared to pH 7.2 (Figure 3E).

Figure 2.

Assessment of the LTA₄H protein expression in 129sv wild type mice post exposure to cigarette smoke over 5 months. Panel A: The levels of LTA₄H protein in the whole lung BALF assessed by ELISA. Panel B: The levels of LTA₄H protein in the whole lung protein soup assessed by ELISA. Panel C: Flow cytometry of the whole lung single cell suspension. Air = mice exposed to ambient air for 20 weeks. SM = mice exposed to cigarette smoke for 20 weeks. Panel D: Immunohistochemistry with antibody specific to murine LTA₄H protein in lung tissues from mice exposed to cigarette smoke for 20 weeks (63× oil magnification). Positive signals appear brown and counterstained with blue. Arrowheads show nuclei with positive counterstain (blue) indicating absence of LTA₄H protein. Arrows show nuclei with positive stain (grown) indicating presence of LTA₄H protein. Gray bars in Panels A & B = ambient-air exposed mice with ages 26 – 28 weeks. * represents analysis by ANOVA, ** by Bonferroni subgroup comparison, and *** by nonparametric t-Test. N = 5 per group.

Figure 3.

Assessment of 129sv wild type mice post exposure to cigarette smoke by Teague TE-2 smoking apparatus for 5 months. Panel A: Levels of LTB₄ in BALF. Panel B: Levels of PGP in BALF. Panel C: Levels of CD45⁺CD11b⁺Ly6G⁺ cells in whole lung single cell suspension. Antibodies are with PerCP-labeled CD45, ACP-labeled CD11b, and PE-labeled Ly5G. Panel D: pH of BALF over 20-week cigarette smoke exposure. Panel E: In vitro aminopeptidase activity assay using human recombinant LTA₄H at pHs 6.7 and 7.2. * represents analysis by nonparametric t-Test. ** represents analysis by ANOVA.*** represents two-way ANOVA with AP activity and time as two factors. N = 5 per group. Air = ambient air exposure. SM = cigarette smoke exposure.

Developing a reagent to selectively augment the LTA₄Haminopeptidase without affecting LTA₄H EH activity

Previously we published the design and biological effects of 4MDM with which the LTA₄H aminopeptidase can be selectively augmented without affecting the EH activity.(25) However, its application was limited due to low water solubility. Therefore, we developed a water-soluble formulation of 4MDM by encapsulating it with 2-hydroxypropyl-β-cyclodextrin (CDX). The hydrophobic cavity of the CDX structure encapsulates the water-insoluble 4MDM while the hydrophilic exterior of the CDX affords a complex with improved water solubility (Figure 4A). A 4:1 molar ratio of CDX to 4MDM (CDX-4MDM) remained homogenous aqueous solution over a 72-hour (Table 2). After CDX-4MDM was administered to mice as drinking water mixed with dextrose (1 g dextrose per mL water), 4MDM was found in the BALF within 24 hours (Figure 4B). No mortality or gross abnormalities were observed after oral administration of CDX-4MDM for 5months (n=33).

Figure 4.

Panel A: Diagram of CDX encapsulating 4MDM. 4MDM is in the inner pocket of CDX and highlighted with an oval circle. Panel B: Levels of 4MDM in BALF 24, 48, and 72 hours after CDX-4MDM was started to be administered as drinking water in mice. * represents column statistics comparing the levels of 4MDM to the hypothetical value of untreated mice, in this case, 0 ng/mL. N = 5 animals per group.

Table 2.

Stability of a water-soluble formulation of 4MDM.¹

Time (hours)	CDX:4MDM ratio	4MDM concentration (mM)
0	4:1	5.20 (100%)
48	4:1	4.82 (92.7%)
72	4:1	4.45 (85.6%)

¹Levels of 4MDM in CDX-4MDM formulation kept at room temperature up to 72 hours.

Effects ofCDX-4MDM in CS-exposed mice

Molecular mechanism of selective augmentation of the LTA₄H aminopeptidase by 4MDM can be rationalized with a molecular model. In silico model of PGP and 4MDM in the substrate pocket of LTA₄H is presented with LTA₄in purple and 4MDM in orange (Figure 5A). The binding model for the 4MDM suggests that 4MDM augments the LTA₄H aminopeptidase by interacting with Phe314, and subsequently perturbing the chelation of Glu318 to the zinc atom and enhancing turnover of the peptide hydrolysis reaction.(38) The long aliphatic tail of LTA₄is predicted to extend into this pocket and preclude simultaneous binding of 4MDM. Therefore, 4MDM is not expected to alter LTA₄H EH activity, i.e. processing of LTA₄to LTB₄. In vivo effects of the CDX-4MDM were assessed by quantifying the levels of PGP and LTB₄. In CS-exposed mice treated with vehicle or CDX-4MDM, levels of LTB₄ were not significantly different (Figure 5B). However, levels of PGP were significantly reduced in the mice treated with CDX-4MDM as compared to mice treated with vehicle post 20 week CS-exposure (Figure 5C). A significantly fewer number of CD45^highCD11b^highLy6G^high cells were found in the CS-exposed mice treated with CDX-4MDM as compared to CS-exposed mice treated with vehicle (Figure 5D). The selectivity of 4MDM at the LTA₄H enzyme target was confirmed by demonstrating that treatment with CDX-4MDM had no effects in mice with a null mutation at the LTA₄H loci (Figure 5E). After 20 week CS-exposure, assessment by pre mortem TLC and C_st and post mortem L m demonstrated that selective augmentation of the LTA₄H aminopeptidase activity protected lungs from CS-induced emphysematous alveolar tissue alteration (Figure 6).

Figure 5.

Effects of CDX-4MDM treatment on the levels of LTB₄, PGP, and neutrophils in mice exposed to cigarette smoke for 20 weeks. Panel A: In silico modeling of the LTA₄H binding pocket occupied by 4MDM and PGP overlaid with the predicted binding model of the LTA₄. 4MDM = orange. PGP = yellow. LTA₄ = purple. Panel B: Levels of LTB₄ in BALF with oral CDX-4MDM or vehicle treatment post exposure to cigarette smoke for 20 weeks. Panel C: Levels of PGP in BALF with oral CDX-4MDM or vehicle treatment post exposure to cigarette smoke for 20 weeks. Panel D: Levels of CD45⁺CD11b⁺Ly6G⁺ cells in whole lung single cell suspension with oral CDX-4MDM or vehicle treatment post exposure to cigarette smoke for 20 weeks. Panel E: Levels of CD45⁺CD11b⁺Ly6G⁺ cells in whole lung single cell suspension of 129sv WT mice (black bars) and 129sv mice with null mutation at the LTA₄H loci (gray bars) with oral CDX-4MDM or vehicle treatment post exposure to cigarette smoke for 7 days. * represents analysis by ANOVA, ** by Bonferroni subgroup comparison, and *** by nonparametric t-Test. N = 5 – 6 per group.

Figure 6.

Effects of CDX-4MDM treatment on pulmonary emphysema in WT mice exposed to cigarette smoke or ambient air for 20 weeks. Panel A: Pre mortem total lung volume measured by Sireq Flexivent. Total lung volume was measured after inflating the lungs with 30 cm H₂O pressure. Panel B: Pre mortem quasi-static lung compliance measured by Sireq Flexivent. Panel C: Post mortemL m. Panel D: Representative H&E histology of the lungs (10× magnification). + in the box and whisker plot represents mean while horizontal bar represents median. * represents analysis by ANOVA, and ** by Bonferroni subgroup comparison. N = 9–13 animals per groups in panels A and B. N = 5 animals per group in panels C.

Effects of 4MDM on the enzymatic activity of LTA₄H aminopeptidase in acidic environment

Effects of 4MDM on the enzymatic characteristics of the LTA₄H aminopeptidase at pH 6.7 were determined by using in vitro aminopeptidase activity assay with a previously published method.(25) The aminopeptidase activity was augmented with positive dose response to 4MDM (Figure 7A). The k_cat (enzymatic turn-over number) of the LTA₄H aminopeptidase increased from 17.2s⁻¹in vehicle to 89.8s⁻¹ in the presence of 8.0 µM 4MDMat pH 6.7 (Table 3). Treatment with 8.0 µM 4MDM at pH 6.7 increased the aminopeptidase activity by more than three folds as compared to treatment with vehicleat pH 7.2 (27.5/sec to 89.8/sec) (Table 3). Then the in vivo activity of the LTA₄H aminopeptidase was measured in the BALF. The specificity of this assay on measuring the LTA₄H aminopeptidase in the BALF was determine by demonstrating minimally detectable LTA₄H aminopeptidase activity in mice with null mutation at the LTA₄H loci as compared to mice with wild type LTA₄H loci (Figure 7B). The LTA₄H aminopeptidase activity was then found to be substantially augmented in the BALF from CS-exposed WT mice treated with oral CDX-4MDM as compared to CS-exposed WT mice treated with vehicle for 5 months (Figure 7C). These studies demonstrated that the loss of LTA₄H aminopeptidase activity caused by reduction in pH was rescued by treatment with CDX-4MDM which augmented the LTA₄H aminopeptidase activity with minimal off-targeting effects. Recovery of enzymatic activity indicates that at low pH, the LTA₄H protein is functionally suppressed but structurally intact.

Figure 7.

LTA₄H aminopeptidase activity assay. Panel A. In vitro LTA₄H aminopeptidase activity assay with human recombinant LTA₄H in the presence of increasing doses of 4MDM at culture medium pH 6.7. AP activity is assessed by UV light absorption at λ = 405. Panel B. LTA₄H aminopeptidase activity assay with BAL fluid collected from mice with wild type (WT) or null mutation (LTA₄H KO) at the LTA₄H loci. N = 5 per group. Panel C. LTA₄H aminopeptidase activity assay with BALF fluid collected from mice treated with vehicle or 4MDM after exposure to cigarette smoke for 20 weeks. N = 6 per group. All data points are mean ± SEM. * represents two-way ANOVA with AP activity as the first factor and 4MDM dose (Panel A) or time (Panels B & C) as the second factor.

Table 3.

Effect of 4MDM on LTA₄H aminopeptidase activity.

	pH 7.2	pH 6.7	pH 6.7	pH 6.7
4MDM	0.0 µM	0.0 µM	0.8 µM	8.0 µM
kcat1	27.5 ± 1.12	17.2 ± 2.24	59.3 ± 6.10	89.8 ± 6.26
KM2	7.66 ± 0.74	16.30 ± 3.99	14.51 ± 2.69	10.83 ± 1.53

¹k_cat = enzymatic turnover (s⁻¹)

²K_M² = concentration at one-half maximum velocity (mM)

In silico molecular modeling of LTA₄H, 4MDM, PGP, and LTA₄

In contrast to PGP, hydrolysis of LTA₄ is at the C-12 position and is stereo-selective to give exclusively the R epimer. Asp375 is an essential residue for this process, and presumably directs the addition of a water molecule to the C-12 carbon of the LTA₄ molecule.(37) Therefore, the LTA₄ in the LTA₄H substrate-binding pocket was assembled by positioning the Re face of the C-12 atom opposite the Asp375 residue. The 4MDM ligand was docked with the unsubstituted phenyl ring of 4MDM positioned to form pi-pi stacking interactions with the phenyl ring of Phe314 and the 4-methoxyphenyl substituent was positioned to interact with the hydrophobic side chain of Val367 through van der Waal interactions. The proposed binding mode is in accordance with the docking studies of Lai and co-workers on related analogs.(39)

Effects of CDX-4MDM on alveolar epithelial apoptosis

Mice after 20 week CS-exposure had a significantly higher number of alveolar epithelial cells staining positive in TUNEL assay as compared to AA-exposure (Figure 8). However, selective augmentation of the LTA₄H aminopeptidase significantly reduced apoptosis in CS-exposed mice as compared to CS-exposed, vehicle-treated mice.

Figure 8.

Effects of CDX-4MDM treatment on apoptosis in WT mice exposed to cigarette smoke or ambient air for 20 weeks. Counting of TUNEL positive cells and calculating Apoptosis Index (percentage of cells positively stained in TUNEL assay). Ten random pictures of each animal were examined. N = 5 per group. Air = ambient air exposure. SM = cigarette smoke exposure. Veh = CDX containing vehicle. Tx = CDX-4MDM. * represents analysis by ANOVA, and ** by Bonferroni subgroup comparison.

Effects of CDX-4MDMon KC, MIP2, MMP8 and MMP9

PGP is known to bind to CXCR2and induces chemotaxis of neutrophils.(13, 19, 20, 40) Levels of KC in the BALF post CS-exposure were not significantly different between the mice treated with CDX-4MDM and vehicle (Figure 9A). However, levels of MIP2 in the BALF post CS-exposure were significant reduced in mice treated with CDX-4MDM as compared to mice treated with vehicle (Figure 9B). MMP8 and MMP9 have been found to be associated with PGP bio-production and subsequent infiltration of neutrophils into the diseased tissues.(12, 15, 18–20) Real time rt-PCR of the whole lung RNA demonstrated that the levels of genes transcribing for MMP8 and MMP9 were significantly increased post 20 week CS-exposure as compared to 20 week AA-exposure (Figure 9C & 9D). Levels of gene transcribing for MMP8 were not significantly altered post CS-exposure when compared between mice treated with vehicle or CDX-4MDM. However, selective augmentation of the LTA₄H aminopeptidase significantly reduced the levels of gene transcribing for MMP9 post 20 week CS-exposure as compared to vehicle treatment.

Figure 9.

Effects of CDX-4MDM treatment on WT mice exposed to cigarette smoke or ambient air for 20 weeks. Panel A: Levels of KC in the BALF from WT mice exposure to cigarette smoke for 20 weeks. Panel B: Levels of MIP2 in the BALF from WT mice exposure to cigarette smoke for 20 weeks. Panel C: Levels of RNA transcribing for MMP8 in whole lung RNA isolate normalized by β-actin. Panel D: Levels of RNA transcribing for MMP9 in whole lung RNA isolate normalized by β-actin. * represents analysis by ANOVA and ** by Bonferroni subgroup comparison. N = 5–7 animals per groups. Air = ambient air exposure. SM = cigarette smoke exposure. Veh = CDX containing vehicle. Tx = CDX-4MDM.

Discussion

An exaggerated activity of the LTA₄H enzyme frequently coexists with and is believed to contribute to the pathogenesis of a variety of diseases associated with neutrophils including sepsis, cystic fibrosis, non-steroid dependent asthma and COPD.(5, 41–45) Several studies have highlighted the importance of the exaggerated LTA₄HEH activity and its bio-product, LTB₄, which contribute to neutrophilic inflammation and tissue remodeling.(46–50) We have previously demonstrated that LTB₄ biosynthesis plays an important role in the emphysematous form of COPD induced by transgenic IL-13 and intra-nasally administered elastase.(24, 25) However, new evidence has emerged to suggest that the second enzymatic activity of the LTA₄H, namely the aminopeptidase, may play an important role involving its ability to break down and clear PGP, a product of collagen breakdown with chemotactic properties.

Our current studies provide further evidence to suggest that the LTA₄H aminopeptidase makes an important contribution to CS-induced neutrophilic inflammation and emphysema in lungs. First, we demonstrated that CS exposure alters the levels and distribution of the LTA₄H protein, which promote bio-production of LTB₄ and hinder clearance of PGP. After5-months ofCS-exposure, LTA₄H protein accumulated in the nuclei of the airway epithelial cells with minimal accumulation in the airspaces. Examination of the pH in the BALF after5-month CS-exposure demonstrated that CS-exposure acidified the BALF significantly (pH 6.7), and atpH6.7 the LTA₄H aminopeptidase activity was significantly suppressed than pH of the AA-exposed BALF (pH 7.2). We hypothesized that breakdown and clearance of PGP occurs primarily in the airspaces and that the bio-production of LTB₄occurs primarily in nuclei where all necessary molecular components are present. Localization of the LTA₄H protein into nuclei and associated induction of LTB₄ bio-production have been described by others in the past.(51) Combination of these changes after CS-exposure was thought to create a cellular microenvironment in which persistently elevated levels of LTB₄ and PGP would occur.

Traditional transgenic strategies using knock-ins or knock-outs are limited due to the irinabilities to selectively modify the individual functions of the LTA₄Hbi-functional activities. All available pharmaceutical agents are limited because these agents are non-selective inhibitors of the LTA₄H EH and aminopeptidase. We overcame this limitation by developing4MDM which selectively augments the LTA₄Haminopeptidase without affecting the LTA₄H EH activity. This tool provided us with a new ability to probe the bi-functionality of the LTA₄H enzyme. We developed a water-soluble formulation for chronic administration suitable for a murine model of emphysema induced by chronic CS-exposure. We then demonstrated that selective augmentation of the LTA₄H aminopeptidase protects lungs from CS-induced emphysematous alveolar remodeling by enhancing the clearance of PGP and reducing neutrophilic inflammation independent of LTB₄ bio-production.

Our results demonstrated several notable observations related to the bi-functional activities of the LTA₄Hand pathogenesis of emphysema. First, CS-exposure in pulmonary system induces complex bio-molecular alterations with in the bi-functional enzymatic activities of the LTA₄H protein. We demonstrated that CS-exposure causes distinctive localization of the LTA₄H protein in lung tissues and acidification of the airspaces which alter the LTA₄H aminopeptidase activity. These are, in our opinion, important bio-molecular events that have been previously underappreciated. Even though a number of animal studies showed promising pharmaceutical benefits by using LTA₄H inhibitors which indiscriminately block both enzymatic activities, no agents have been successfully translated to the bedside as FDA-approved therapeutics.(52–55) Our studies may provide additional biological in sights as to how these non-selective modifiers of the LTA₄H enzymatic activities may inadvertently cause unwanted and potentially harmful biological effects. This could occur by unknowingly canceling the “good” LTA₄H aminopeptidase while blocking the “bad” LTA₄H EH with non-selective LTA₄H modifiers. Localization of the LTA₄H protein into the nuclei also raises a possibility that the LTA₄H may potentially behave as a regulator of transcriptional factors such as MAPK or NF-κβ. This is an intriguing hypothesis which merits further investigation in the future.

Second, our molecular modeling and the properties of 4MDM suggest that the aminopeptidase activity of the LTA₄His a druggable target. The challenge with targeting a multi-functional enzyme is modifying one activity of the enzyme without affecting the other activity. Selective augmentation of the aminopeptidase activity is possible because of the large substrate-binding pocket of the LTA₄Henzyme (Figure 5A). A number of available mutation data suggest that 4MDM would occupy the space between Val367 and Phe314 and form pi-pi stacking interaction with phenyl ring of Phe314 and van der Waal interactions with the hydrophobic side chain of Val367. In this model, 4MDM and PGP can simultaneously bind to the LTA₄H substrate site. Mutation data suggests that the aliphatic tail of LTA₄ must extend deep into the pocket, which would prevent simultaneous binding with 4MDM. (37) It appears that this model offers a plausible explanation as to why 4MDM does not cause measurable changes in the LTA₄EH activity in vivo. Further studies involving co-crystallization of 4MDM with the LTA₄H is necessary to make a conclusive determination for its mechanism selective for aminopeptidase.

Third, the animals treated with CDX-4MDM showed reduction in the levels of MIP2 while the levels of KC were unchanged. This was an unanticipated epiphenomenon. Reactive oxygen species have been found to activate macrophages, and this interaction was found to induce neutrophil chemotaxis via production of MIP2.(56) We speculate that the selective augmentation of the LTA₄H aminopeptidase may alter interaction between alveolar macrophages and reactive oxygen species and reduce the levels of MIP2. This is a speculation that merits more studies in the future.

Fourth, CS-exposure up-regulated the genes transcribing for MMP8 and MMP9, which are described to contribute to the bio-production of PGP.(12, 15, 17, 57) Treatment with 4MDM selectively down-regulated the genes transcribing for MMP9 while it did not for MMP8. Previously others have reported that the MMP9 is potentially involved in a “feed-forward” mechanism, which perpetuates the in vitro bio-production of PGP due to CS-exposure.(12, 16) These findings suggest that the selective augmentation of the LTA₄H aminopeptidase could potentially halt this “feed-forward” cycle as a part of its therapeutic effects.

While CDX-4MDM provided an opportunity to probe the biology of the LTA₄H bi-functional activities, there are limitations in our study worthy mentioning. First, our current study appears to be potentially divergent from what we have observed in the LTA₄H KO animals.(3) In our previous study, we reported that the null mutation at the LTA₄H loci led to significant protection against emphysema induced by intra-nasal elastase administration. The elastase-induced model of emphysemaisone-hit model induced by a single-dose administration of porcine elastase. The CS-induced model of emphysema is repeated-insult model (daily smoking) induced over five months, and chronicity and repeating nature of the insults by CS likely induced pulmonary responses divergent from the elastase-induced model of emphysema. Second, all of our analyses were observational related to the development of emphysema and neutrophils. Secondary in vivo confirmation of our results would require depletion of neutrophils. Inherent limitations in available methods hindered this attempt. Mice with null mutation at the CXCR2 loci would alter non-neutrophil dependent biological mechanisms such as angiogenesis, which make important contributions to the pathogenesis of emphysema.(58–60) Neutrophil depletion with anti-Ly6G antibody was attempted in our laboratory for as long as one-month duration.(3) However, administration of this antibody longer than 1 months caused serum sickness in animals and was determined to be unsuitable for a chronic model like that of 20-week CS-exposure.

In summary, our studies highlighted cellular mechanisms associated with the perturbations in the bi-functional enzymatic activities of LTA₄H, which is responsible for emphysematous alveolar remodeling induced by CS-exposure. Our studies provided mechanistic insights that the development of the emphysematous destruction in lungs may be ameliorated by interventions that selectively regulate the LTA₄H aminopeptidase. This report features the unexplored bi-functional activities of the LTA₄H pathway as noteworthy sites for future investigations designed to evaluate disease susceptibility, disease progression, and therapeutic utility in emphysema.