Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Jul 7.
Published in final edited form as: Nat Immunol. 2013 Jun 2;14(7):732–740. doi: 10.1038/ni.2633

The signaling suppressor CIS controls proallergic T cell development and allergic airway inflammation

Xuexian O Yang 1,2, Huiyuan Zhang 1,8, Byung-Seok Kim 1,8, Xiaoyin Niu 1,3, Juan Peng 1,4, Yuhong Chen 5, Romica Kerketta 2, Young-Hee Lee 1, Seon Hee Chang 1, David B Corry 6, Demin Wang 5, Stephanie S Watowich 1, Chen Dong 1,7
PMCID: PMC4084713  NIHMSID: NIHMS578150  PMID: 23727894

Abstract

Transcription factors of the STAT (signal transducer and activator of transcription) family are critical in the cytokine-mediated functional differentiation of CD4+ helper T cells. Members of the SOCS (suppressor of cytokine signaling) family negatively regulate the activation of STAT proteins; however, their roles in the differentiation and function of helper T cells are not well understood. Here we found that the SOCS protein CIS, which was substantially induced by interleukin 4 (IL-4), negatively regulated the activation of STAT3, STAT5 and STAT6 in T cells. CIS-deficient mice spontaneously developed airway inflammation, and CIS deficiency in T cells led to greater susceptibility to experimental allergic asthma. CIS-deficient T cells showed enhanced differentiation into the TH2 and TH9 subsets of helper T cells. STAT5 and STAT6 regulated IL-9 expression by direct binding to its gene. Our data thus demonstrate a critical role for CIS in controlling proallergic generation of helper T cells.


CD4+ helper T cells are the central organizers of adaptive immunity and various immunological diseases. After recognizing antigens, naive precursors of CD4+ T cells undergo clonal expansion and functional differentiation into cytokine-secreting effector cells. The effector differentiation of helper T cells into the TH1, TH2 and TH17 and TH9 subsets is determined by the cytokine environment1,2. TH1 differentiation is promoted by interleukin 12 (IL-12), which signals through the intracellular signaling molecule STAT4. The interferon-γ (IFN-γ)–STAT1 pathway in turn sustains TH1 development, which leads to induction of expression of the transcription factor T-bet. During TH2 polarization, IL-4 serves an essential role by activating STAT6, and phosphorylated STAT6 in turn induces the expression of the transcription factor GATA-3 (ref. 3). In addition to IL-4, IL-2 regulates TH2 differentiation by STAT5-mediated induction of the αchain of the receptor for IL-4 (IL-4Rα), the main STAT6-activating component of the IL-4 and IL-13 receptors4–6. TH17 differentiation is mediated by the combination of signaling via IL-6 and transforming growth factor-β (TGF-β)7. IL-6, as well as IL-23 and IL-21, supports TH17 development via STAT3 (ref. 7), whereas IL-2–STAT5 signaling negatively regulates TH17 differentiation8. IL-9-expressing TH9 cells also require TGF-β, in addition to IL-4, for their generation9–11; the mechanisms of this remain unclear.

Thus, cytokine-mediated activation of STAT proteins has a pivotal role in the differentiation of helper T cells. Moreover, overactivation of STATs may lead to excessive immune responses and tissue damage. Thus, signaling from STAT proteins is controlled by several negative regulatory mechanisms12–14. Among those, proteins of the SOCS (suppressor of cytokine signaling) family, induced by cytokine stimulation, inhibit STAT signaling12–14. For example, genetic deletion of SOCS1 in mice results in greater responsiveness to IFN-γ and causes a fatal inflammatory disease15. The eight members of the SOCS family (CIS (‘cytokine-induced SH-2 protein’; also called CIS1, SOCS or CISH)16 and SOCS1–SOCS7) share a common structure, with a central Src-homology 2 ( SH2) domain, a carboxyl-terminal SOCS box and a divergent amino-terminal domain. The SOCS box interacts with ubiquitination enzymes, such as elongin B, elongin C, cullin-5 and RING-box 2, and an E2 ubiquitin transferase. The central SH2 domain determines the interaction with target proteins, such as kinases of the Jak family, which brings them close to the ubiquitinating scaffold associated with the SOCS box. SOCS-mediated ubiquitination of the target proteins leads to rapid degradation via the proteasome and inhibition of cytokine signaling.

As negative regulators of STAT proteins, some members of the SOCS family are involved in the differentiation of helper T cells. SOCS1 negatively regulates TH1 differentiation through inhibition of the IFN-γ–STAT1 and IL-12–STAT4 pathways17–20. SOCS3 is ‘preferentially’ expressed in TH2 cells21, and forced expression of SOCS3 in T cells promotes a TH2 phenotype by blocking STAT4 signaling22–24. However, conditional removal of SOCS3 in T cells seems to suppress both TH1 and TH2 responses, an unexpectedly broad effect that may indirectly result from greater secretion of the immunosuppressive cytokines TGF-β and IL-10 (ref. 25). In addition, SOCS3 blocks STAT3 signaling and inhibits TH17 polarization26,27. SOCS5 is ‘preferentially’ expressed in TH1 cells. Although expression of SOCS5 negatively regulates IL-4-dependent STAT6 activation and TH2 differentiation during TH1 differentiation28, the absence of SOCS5 from CD4+ T cells does not seem to alter normal TH1 or TH2 differentiation29. Regulatory T cells (Treg cells) have high expression of SOCS2, and it may be involved in their differentiation and/or function12–14. Except for SOCS1, SOCS3 and SOCS5, the function of the SOCS family in the effector differentiation of helper T cells has not been established.

CIS was first shown to inhibit signaling from the receptor for erythropoietin and the receptor for growth hormone16,30,31. In CD4+ T cells, CIS inhibits STAT5 signaling32,33, which suggests that it may be involved in the differentiation of helper T cells. In this study, we found that CIS, strongly induced by IL-4 in T cells, inhibited the phosphorylation of STAT3, STAT5 and STAT6. The absence of CIS in T cells led to more TH2 and TH9 differentiation and exacerbated airway allergic disease.

RESULTS

CIS expression in CD4+ T cells

T cell differentiation is initiated by signals from the T cell antigen receptor, costimulatory molecules and cytokine receptors. To characterize the role of CIS in T cell differentiation, we first assessed CIS expression during early activation of T cells. We sorted CD4+CD25− CD44loCD62Lhi naive T cells from C67BL/6 mice by flow cytometry and activated the cells for various times with plate-bound antibody to CD3 (anti-CD3) and anti-CD28, then analyzed the expression of mRNA encoding CIS (Cish; called ‘Cis’ here), IL-2 (Il2) and IL-2Rα (Il2ra; called ‘Cd25’ here) by quantitative RT-PCR. We detected upregulation of Cis mRNA expression at 0.5 h, which reached a peak at 2 h, followed by downregulation at 8 h and a second peak at 48 h (Fig. 1a). Il2 and Cd25 shared a similar pattern of expression; both had low expression in the first 8 h that peaked at 48 h (Fig. 1a). These results suggested that at the early phase, Cis expression was independent of endogenous IL-2 production and expression of the high-affinity IL-2 receptor CD25 (IL-2Rα).

Figure 1.

Figure 1

Expression and signaling function of CIS. (a) Quantitative real-time RT-PCR analysis of Cis, Il2 and Cd25 mRNA in naive CD4+ T cells activated for various times (horizontal axes) by plate-bound anti-CD3 and anti-CD28, normalized to expression of the reference gene Actb and presented relative to the lowest detectable expression, set as 1. (b) Quantitative real-time RT-PCR analysis of Cis mRNA in naive CD4+ T cells left inactivated (Naive) or activated for 3 h by plate-bound anti-CD3 and anti-CD28 in the presence of no additional reagents (No) or various cytokines or antibodies (horizontal axis; α-, anti-), normalized as in a and presented relative to the lowest detectable level, set as 1. NS, not significant; *P ≤ 0.005 ( Student’s t-test). (c) Quantitative real-time RT-PCR analysis of Cis mRNA in various helper T cell subsets and iTreg cells and nTreg cells, presented as in b. (d) Immunoblot analysis of total and phosphorylated (p-) STAT proteins in wild-type (WT) and Cis−/− CD4+ T cells activated for various times (above lanes) with plate-bound anti-CD3 and anti-CD28 in the presence of recombinant human IL-2. Data are from two (a,c) or three (b) independent experiments (mean and s.d.) or are from one experiment representative of two independent experiments (d).

Next we assessed expression of Cis mRNA in response to a variety of cytokines that are important in T cell differentiation. After 3 h activation with plate-bound anti-CD3 and anti-CD28, the addition of IL-6 and IL-10 weakly upregulated Cis mRNA expression, whereas IL-4 substantially upregulated Cis mRNA expression (Fig. 1b). Consistent with that, blockade of IL-4 or IL-6 with neutralizing antibodies attenuated Cis mRNA expression (Fig. 1b), and deficiency in the gene encoding IL-4Rα (Il4ra) abrogated IL-4-induced Cis mRNA expression (Supplementary Fig. 1a). However, in STAT6-deficient cells, IL-4-dependent expression of Cis mRNA was only slightly lower (Supplementary Fig. 1b), which suggested that other factors in addition to STAT6 were required for IL-4-induced Cis mRNA expression. Consistent with that, STAT6 bound to the Cis promoter (Supplementary Fig. 1c), suggestive of direct regulation. Unexpectedly, at this early phase (3 h) of T cell differentiation, the addition of IL-2, a cytokine known to activate STAT5 (refs. 16,33), did not induce Cis expression much (Fig. 1b). Furthermore, we explored the expression of Cis mRNA in various helper T cell subsets and found high expression in TH1 cells, TH2 cells, inducible Treg cells (iTreg cells) and natural Treg cells (nTreg cells) and moderate expression in TH9 cells (Fig. 1c). In TH17 cells, Cis mRNA expression was similar to that in naive cells (Fig. 1c). Together these data suggested possible involvement of CIS in the regulation of cytokine signals during helper T cell differentiation.

CIS antagonizes STAT activation

To further understand the role of CIS in the differentiation and function of T cells, we generated mice with conditional knockout of Cis. We introduced two loxP sites into the Cis locus that flanked a region spanning exon 2 to the coding region of exon 3 (Supplementary Fig. 2a). We generated a Cis-deficient allele by breeding mice with that loxP-flanked Cis allele (Cis+/fl) with mice that express Cre recombinase from the cytomegalovirus promoter (Supplementary Fig. 2b). We backcrossed Cis+/− or Cis+/fl mice with C57BL/6 mice for seven to eight generations and then interbred the offspring to generate Cis−/− or Cisfl/fl mice. In Cis−/− mice, Cis mRNA was not detectable in bone marrow or Treg cells, by RT-PCR (Supplementary Fig. 2c), and CIS protein was completely absent from CD4+ T cells, by immunoblot analysis (Supplementary Fig. 2d), which indicated that a null mutation was generated and that CIS was not required for normal mouse development. The lymphoid populations in the thymus, spleen and lymph nodes of Cis−/− mice seemed grossly normal although they had slightly more cells than their wild-type counterparts (Supplementary Fig. 3 and data not shown). Also, the development of CD4+CD25+Foxp3+ natural Treg cells in the thymus and spleen from Cis−/− mice seemed normal (Supplementary Fig. 3b,c).

When activated with plate-bound anti-CD3 and anti-CD28 in the presence or absence of exogenous IL-2, CIS-deficient CD4+ T cells had enhanced proliferation, but endogenous IL-2 secretion was not altered (Supplementary Fig. 4). Moreover, naturally occurring Cis−/− Treg cells had suppressive activity similar to or marginally less than that of their wild-type counterparts (Supplementary Fig. 5a). In addition, Cis deficiency did not alter the expression of Treg cell–specific genes, such as Foxp3, Tgfb1, Il10, Il35 and Ctla4, as assessed in natural Treg cells expressing the transcription factor Foxp3 linked to green fluorescent protein (GFP), sorted by flow cytometry (Supplementary Fig. 5b).

As CIS is reported to inhibit STAT activation, we assessed the phosphorylation of STAT proteins in T cells. We activated wild-type and Cis−/− CD4+ T cells for various times with plate-bound anti-CD3 and anti-CD28 in the presence of recombinant human IL-2, then assessed phosphorylated and total STAT proteins by immunoblot. Cis−/− CD4+ T cells showed an increase in phosphorylated STAT3, STAT5 and STAT6 when compared with WT cells at various times, whereas the abundance of phosphorylated STAT1 remained the same (Fig. 1d). Of note, wild-type cells had less phosphorylated STAT5 at 3 h (Fig. 1d), which inversely correlated with CIS expression at 2–4 h (Fig. 1a and Supplementary Fig. 2d). To further understand the original signals that activate STAT3, STAT5 and STAT6, we first assessed the effect of IL-2. In the absence of exogenous IL-2 (endogenous IL-2 was expressed only 8 h after activation; Fig. 1a), phosphorylated STAT3 and STAT6 retained their enhanced activation in Cis-deficient cells, whereas the increase in phosphorylated STAT5 was greatly delayed and diminished, and we found no difference between wild-type and CIS-deficient cells (Supplementary Fig. 6a), which suggested that phosphorylated STAT5 was triggered by IL-2. Next, after the addition of IL-4-neutralizing antibody, phosphorylated STAT6 signals were no longer detectable (Supplementary Fig. 6b), which suggested that the activation of STAT6 required IL-4 in both wild-type and Cis-deficient cells. However, neutralization of IL-6 and/or IL-21 did not affect the activation of STAT3 (Supplementary Fig. 6c). In summary, these results indicated involvement of CIS in control of the IL-2–STAT5, IL-4–STAT6 and STAT3 pathways in CD4+ T cells.

CIS deficiency causes spontaneous pulmonary disease

Aberrant activation of STAT proteins in Cis−/− CD4+ T cells suggested that CIS may be involved in regulating the differentiation and function of T cells. To confirm this, we first analyzed helper T cells from unmanipulated 6-month-old wild-type and Cis−/− mice by intracellular staining. Splenocytes and lung-associated lymph node cell populations from Cis−/− mice had significantly more IL-4- and IL-9-expressing T cells but not more IFN-γ- or IL-17-secreting cells than did those from wild-type mice (Fig. 2a,b and Supplementary Fig. 7a). The frequency of Foxp3+ cell was also similar in the two strains (Fig. 2a and Supplementary Fig. 7a). These data suggested that CIS may negatively regulate proallergic differentiation of T cells in vivo.

Figure 2.

Figure 2

CIS deficiency leads to spontaneous pulmonary diseases. (a,b) Intracellular staining of cytokine- and Foxp3-expressing splenocytes (a) and lung-associated lymph node cells (b) from 6-month-old wild-type and Cis−/− mice, presented on a CD4+ gate. Numbers in quadrants indicate percent cells in each throughout. N = 4–5 per group. *P ≤ 0.05 and **P ≤ 0.005 (Student’s t-test). (c,d) Hematoxylin-and-eosin staining of lung sections prepared from 10-month old (c) or 18-month old (d) wild-type and Cis−/− mice. Right (d), enlargement of outlined area at left; arrows indicate airway smooth-muscle hyperplasia in collapsed airway (top right); bottom right, lung parenchymal consolidation and mononuclear cell inflammatory infiltrate. (e,f) Staining of wild-type and Cis−/− lung sections with Masson’s trichrome (e) or Periodic acid–Schiff (f) showing enhanced collagen deposition (blue filaments, e) and metaplastic goblet cells (red epithelial cells, f) in Cis−/− mice. Scale bars, 1 mm (c, d (left)) or 200 μm (e,f). (c–f) WT, n = 3–4; Cis−/−, n = 4. Data are representative of two independent experiments (mean and s.d. in a–c).

We prepared lung, heart, liver, kidney and intestine tissue sections from 10-month-old wild-type and Cis−/− mice and stained the sections with hematoxylin and eosin. We observed no difference between genotypes for any tissues tested except that in contrast to wild-type lungs, Cis−/− lungs exhibited lung parenchymal consolidation, narrowed airways and alveoli, hyperplasia of airway smooth muscle cells and goblet cell metaplasia (incidence, 80%) (Fig. 2c). Those histological features were more pronounced in all lungs from 18-months-old Cis−/− mice and included more severe airway obstruction due to mucus impaction and scattered mononuclear cell infiltration (Fig. 2d). By staining with Masson’s trichrome and Periodic acid–Schiff, we found more collagen deposition in the peribronchovascular spaces (Fig. 2e) and more mucin staining (goblet-cell metaplasia) in the airway epithelium (Fig. 2f) in Cis−/− lungs than in wild-type lungs. Moreover, we observed significantly more eosinophil infiltrates Cis−/− lungs than in wild-type lungs (Supplementary Fig. 7b). Together these results indicated that CIS deficiency resulted in a spontaneous lung disorder that resembled allergic asthma; it was associated with a greater abundance of IL-4- and IL-9-secreting CD4+ T cells, which suggested that TH2 and TH9 cells may be involved in the disease process in these mice.

T cell–intrinsic role of CIS

Because Cis−/− mice had spontaneous allergic responses, we induced allergic asthma in Cis−/−and Cisfl/fl (or wild-type littermate as indicated) control mice by a standard protocol34. Cis−/−mice had significantly more total cells, eosinophils and lymphocytes in lung infiltrates than did CIS-sufficient mice (Fig. 3a and Supplementary Fig. 8a). There were more IL-4+ or IL-5+ CD4+ cells in lung infiltrates from Cis−/− mice than in those from CIS-sufficient mice (Fig. 3b and Supplementary Fig. 8b). Moreover, after ex vivo restimulation with various doses of ovalbumin, lung-associated lymph node cells and splenocytes from Cis−/− mice produced significantly more IL-4, IL-5 and IL-13 than did similarly restimulated cells from CIS-sufficient mice (Fig. 3c and Supplementary Fig. 8c). Consistent with that, total lung tissue from Cis−/− mice expressed more Il4, Il5, Il13 and Il9 mRNA than did that from CIS-sufficient mice (Fig. 3d and Supplementary Fig. 8d). These results suggest that the enhanced TH2 and TH9 responses in CIS-deficient mice were independent of the polymorphisms in the genome of the 129 mouse strain that surrounds the Cis locus, because the Cisfl/fl mice had same Cis allele (that originated from the 129 strain) that the Cis−/− mice had.

Figure 3.

Figure 3

CIS negatively regulates allergic asthma responses. (a) Quantification of cells in bronchoalveolar lavage fluid and lung infiltrates from Cis−/− and Cisfl/fl mice in which allergic asthma was induced (n = 4–5 per group). Eos, eosinophil; Neu, neutrophil; Mac, macrophage; Lym, lymphocyte. (b) Expression of the TH2 cytokines IL-5 and IL-4 in lung-draining lymph nodes from the mice in a, assessed by flow cytometry on a CD4+ gate. (c) ELISA of TH2 cytokines in splenocytes (Spleen) or cells from the lung-draining lymph nodes (LLN) of mice as in a, stimulated for 3 d with various concentrations of ovalbumin (OVA). (d) Quantitative RT-PCR analysis of mRNA encoding TH2 and TH9 cytokines in lung tissues from mice in a, presented relative to the internal reference Actb. *P ≤ 0.05 and **P ≤ 0.005 (Student’s t-test). Data represent three independent experiments (mean and s.d.).

Next we assessed the T cell–intrinsic role of CIS in allergic lung responses. We induced asthma in Cisfl/fl CD4-Cre mice (the offspring of Cisfl/fl mice and mice that express Cre from the Cd4 promoter), Cisfl/flFoxp3-Cre mice (the offspring of Cisfl/fl mice and mice that express Cre from the Foxp3 promoter) and Cisfl/fl mice. The T cell–specific deletion of Cis in Cisfl/flCD4-Cre mice resulted in enhanced asthmatic responses, whereas the Treg cell–specific deletion of Cis in Cisfl/flFoxp3-Cre mice did not (Fig. 4 and Supplementary Fig. 9). Cisfl/flCD4-Cre mice had more total cells and eosinophils accumulation in the bronchoalveolar lavage fluid than did Cisfl/fl mice, whereas Cisfl/flFoxp3-Cre mice and Cisfl/fl mice had similar numbers of all populations analyzed (Fig. 4a). Lung infiltrates from Cisfl/flCD4-Cre mice contained more CD4+IL-4+ cells than did those of Cisfl/fl mice (Fig. 4b). In addition, in response to ex vivo restimulation with ovalbumin, lung-associated lymph node cells and splenocytes from Cisfl/flCD4-Cre mice secreted significantly higher concentrations of IL-4, IL-5 and IL-13 than did those from Cisfl/fl mice (Fig. 4c). Total lung tissue from Cisfl/flCD4-Cre mice also had more Il4, Il5, Il13 and Il9 mRNA than did that from Cisfl/fl mice (Fig. 4d). Notably, we observed greater enhancement of TH2 responses in Cisfl/flCD4-Cre mice than in Cis−/− mice (Fig. 3c,d). This might have partially resulted from the higher expression of IL-10 observed in TH2 cells, which would further sustain the TH2 polarization of cells, as reported in an allergic skin model35. To obtain further evidence of the T cell–intrinsic role of CIS in allergic T cell development, we reconstituted mice with a congenital deficiency in mature B cells and T cells (deficient in recombination-activating gene 1 (Rag1−/−)) with T cell–depleted bone marrow from wild-type (CD45.1+) mice and Cis−/− (CD45.2+) mice (1:1 mixture) and induced asthma in the resulting mice. We found that Cis−/− cell populations had a higher frequency of IL-4+ and IL-13+ cells in lung infiltrates and draining lymph nodes than did their wild-type counterparts (Supplementary Fig. 10a–c). In addition, flow cytometry–sorted Cis−/−(CD45.2+) CD4+ T cells had higher expression of Il4, Il5, Il13 and Il9 mRNA than did their wild-type (CD45.1+) counterparts (Supplementary Fig. 10d). Therefore, CIS inhibited the induction of allergic lung disease by inhibiting the production of TH2 and TH9 cytokines in a T cell–intrinsic but Treg cell–extrinsic manner.

Figure 4.

Figure 4

CD4+ T cell–specific Cis deficiency leads to enhanced allergic asthma disease. (a) Quantification of cells in bronchoalveolar lavage fluid from Cisfl/fl and Cisfl/flCD4-Cre mice (n = 4–5 per group) in which allergic asthma was induced. (b) Expression of TH2 cytokines in lung-draining lymph node cells from mice in a, assessed by flow cytometry on a CD4+ gate. Numbers adjacent to outlined areas (top) indicate percent IL-5+CD4+ cells. (c) ELISA of TH2 cytokines in cells from lung-draining lymph nodes or splenocytes from mice in a, stimulated for 3 d with various concentrations of ovalbumin. (d) Quantitative RT-PCR analysis of mRNA encoding TH2 and TH9 cytokines in lung tissues from mice in a (presented as in Fig. 3d). *P ≤ 0.05 and **P ≤ 0.005 (Student’s t-test). Data represent two independent experiments (mean and s.d.).

CIS inhibits TH2 differentiation

Our in vivo data together supported the proposal of a role for CIS in the negative regulation of proallergic TH2 and TH9 responses. We next assessed the role of CIS in helper T cell differentiation in vitro. We sorted naive CD4+ T cells from Cis−/− mice and their wild-type littermates by flow cytometry and skewed them toward TH1, TH2, TH17 or iTreg differentiation, then assessed the lineage-specific markers IFN-γ, IL-17, IL-4 and Foxp3, respectively, by intracellular staining. Under TH1 conditions, the frequency of IFN-γ+ cells among Cis−/− cells was similar to that among wild-type cells (Fig. 5a), consistent with the normal activation of STAT1 in Cis−/− cells (Fig. 1d). Under TH17 conditions, the frequency of IL-17+ cells was also similar for both strains, but there were fewer Foxp3+ cells among Cis−/− cells than among their wild-type counterparts (Fig. 5a). This may have been due to the enhanced STAT3 signaling. Under iTreg conditions, Cis−/− cell populations had a lower frequency of Foxp3+ cells than did their wild-type counterparts (Fig. 5a). This difference was diminished when IL-4 was blocked (Fig. 5a), which suggested that the enhanced TH2 program mediated by CIS antagonized the iTreg program.

Figure 5.

Figure 5

CIS function in helper T cell differentiation. (a) Intracellular staining of wild-type and Cis−/− CD4+ T cells polarized under TH1 or TH17 conditions or iTreg conditions without (Med) or with (α-IL-4) anti-IL-4. Numbers adjacent to outlined areas (right) indicate percent CD4+Foxp3+ cells. (b) Intracellular staining of Cisfl/fl and Cis−/− helper T cells polarized under neutral (TH0), anti-IFN-γ or TH2 conditions. (c) ELISA of TH2 cytokines in the cells in b. (d) Quantitative RT-PCR analysis of mRNA in CD4+ T cells from Cis−/− or wild-type mice activated for 4 d with plate-bound anti-CD3 and anti-CD28 in the presence of anti-IFN-γ (presented as in Fig. 3d); Nfatc1p1, transcript of the gene encoding the transcription factor NFATc, from the inducible P1 promoter. *P ≤ 0.05 and **P ≤ 0.005 (Student’s t-test). Data represent two (a,d) or three (b) independent experiments (mean and s.d. in d) or are from three independent experiments (c; mean and s.d.).

As predicted from the in vivo data, by intracellular staining or enhanced immunosorbent assay (ELISA), CIS deficiency led to enhanced TH2 differentiation and TH2 cytokine expression in naive T cells activated under neutral, anti-IFN-γ or TH2 conditions (Fig. 5b,c and Supplementary Fig. 11a), which correlated with the enhanced activation of STAT5 and STAT6 observed in Cis−/−cells (Fig. 1d). Furthermore, by quantitative RT-PCR, we found that when treated with anti-IFN-γ, Cis−/− cells expressed not only more mRNA encoding TH2 cytokines (Il4, Il5, Il13 and Il10) but also more mRNA encoding several TH2-associated cell-surface receptors (Il4ra, Il17rb and Icos) and transcription factors (Gata3 and Irf4; Fig. 5d). These results suggested that CIS inhibited the TH2 differentiation program but not the TH1 or TH17 differentiation program and may have also regulated the iTreg program indirectly by restricting the TH2 pathway.

CIS deficiency enhances TH9 differentiation

In addition to IL-4, IL-5 and IL-13, IL-9 is also associated with allergic asthma36–38. TGF-β, together with IL-4, greatly enhances IL-9 expression, which results in TH9 polarization9–11. Because we found higher expression of Il9 mRNA mice with germline or T cell–specific Cis deficiency than in their Cis-sufficient counterparts (Figs. 3d and 4d), we sought to determine whether CIS also inhibits TH9 differentiation. We first assessed Il9 mRNA expression in wild-type and Cis−/− T cells differentiated from flow cytometry–sorted naive cells and activated for 4 d in the presence of anti-IFN-γ. We found that in the absence of CIS, Il9 mRNA expression was much higher (Fig. 6a). Next we polarized naive CD4+ T cells from wild-type (Fig. 6b) (or Cisfl/fl, Supplementary Fig. 11b) mice and Cis−/− mice to differentiate into TH9 cells and found that Cis−/−cell populations had many more IL-9 expressing cells. IL-9 production was also much greater in Cis−/− cells than in wild-type cells in the presence of anti-IFN-γ and TH9 conditions (Fig. 6c). Third, to determine the cytokine-STAT signals that drive TH9 differentiation, we activated naive CD4+ cells from wild-type and Cis−/− mice in the presence of anti-IFN-γ. We found more IL-4+IL-9+ cells and IL-5+ cells among Cis−/− cells in these conditions (Fig. 6d). The addition of neutralizing antibody to IL-4 or IL-2 diminished the enhanced TH9 and TH2 responses of Cis−/− T cells (Fig. 6d), which suggested signaling via both IL-4 and IL-2 is important in TH9 differentiation in addition to TH2 differentiation.

Figure 6.

Figure 6

Enhanced TH9 differentiation in the absence of CIS. (a) Quantitative RT-PCR analysis of Il9 mRNA in wild-type and Cis−/− cells treated with anti-IFN-γ (presented as in Fig. 3d). (b) Intracellular staining of IL-4 and IL-9 in wild-type and Cis−/− TH9 cells. (c) ELISA of IL-9 in wild-type and Cis−/− cells under anti-IFN-γ or TH9 conditions *, student t test, P ≤ 0.05. (d) Intracellular staining of IL-4 and IL-9 (top) or IL-5 and IFN-γ (bottom) in naive Cis−/− or wild-type CD4+ T cells activated in the presence of anti-IFN-γ with a control antibody (Ctrl) or anti-IL-4 or anti-IL-2. Data are from two independent experiments (a,c; mean and s.d.) or represent three independent experiments (b,d).

STAT5 and STAT6 regulate TH9 differentiation

Signaling via IL-4 and IL-2 is known to activate STAT6 and STAT5, respectively. Our results indicated that CIS deficiency led to enhanced phosphorylation of STAT5 and STAT6 that was dependent on signaling via IL-4 and IL-2, respectively, as well as enhanced TH9 and TH2 responses in vitro and in vivo. Although both STAT5 and STAT6 are well known to regulate TH2 differentiation, their roles in TH9 development are unclear. We next examined the effect of STAT5 and STAT6 on TH9 differentiation. To assess the role of STAT5, we studied the offspring of mice with one loxP-flanked Stat5a allele (Stat5afl/+ or Stat5afl/−) crossed with Mx-Cre Ai3 mice (which express yellow fluorescent protein (YFP) after the induction of Cre expressed from the Mx1 promoter through the use of IFN-α). We obtained naive YFP+CD4+ T cells from those offspring and differentiated the cells toward the TH9 lineage. We found that STAT5-deficient (Stat5afl/−Mx-Cre) cell populations included considerably fewer IL-9+ cells than did their STAT5-sufficient (Stat5afl/−Mx-Cre) counterparts (Fig. 7a). Conversely, forced expression of a constitutively active form of STAT5 (STAT5A1*6)39 greatly enhanced TH9 differentiation in the presence of anti-IFN-γ or under TH9 differentiation conditions after 1 d of activation in the presence of anti-IFN-γ and infection with virus encoding STAT5A1*6 or control virus (Fig. 7b).

Figure 7.

Figure 7

CIS controls TH9 differentiation by modulating the activity of STAT5 and STAT6. (a) Intracellular staining of IL-9 in TH9 cells polarized from naive YFP+CD4+ T cells from Stat5afl/−Mx-Cre or Stat5afl/−Mx-Cre mice. Numbers above outlined areas indicate percent IL-9+CD4+ cells. (b) Intracellular staining of IL-9 in wild-type CD4+ T cells polarized with anti-IFN-γ alone or anti-IFN- γ plus TH9 conditions (left margin) with (right) or without (left) forced expression of constitutively active STAT5, assessed in a GFP+ gate. (c) Intracellular staining of IL-9 and IL-4 in BALB/c and Stat6−/− TH9 cells. (d,e) ChIP assay of the binding of STAT5 (d) or STAT6 (e) to various gene regions (horizontal axes) in wild-type or Cis−/− naive CD4+ T cells activated for 1 h in the presence of IL-2 (d) or incubated for 3 h in the absence of IL-2 (e), precipitated with anti-STAT5, anti-STAT6 or control antibody (Ctrl Ab), followed by quantitative PCR analysis of DNA enrichment, relative to input; Cd4 and Apoe serve as negative controls. Pr, promoter; Enh, enhancer, HS, DNase I hypersensitive site; CNS, conserved non-coding sequence. (f,g) Luciferase activity in EL4 cells transduced to express a luciferase reporter driven by the Il9 promoter plus empty vector (EV) or vector encoding constitutively active STAT5 (STAT5A1*6; f) or STAT6 (STAT6VT; g) and treated with various combinations of PMA and/or IL- 4 (horizontal axis); renilla luciferase activity was used to normalize transfection efficiency and set as 1. *P ≤ 0.05 and **P ≤ 0.005 (Student’s t-test). Data represent two independent experiments (a–c) or are from two (d,e,g) or three (f) independent experiments (mean and s.d.).

To assess the role of STAT6, we differentiated naive CD4+ T cells from Stat6−/− and BALB/c mice into TH9 cells and found considerably fewer IL-9-expressing cells among Stat6−/−cells than among wild-type cells, consistent with a published report40. Stat6−/− cell populations also had a lower frequency of IL-4+ cells than did their wild-type counterparts, as predicted, although both Stat6−/− and wild-type cell populations included very few IL-4+ cells (Fig. 7c). In summary, our observations demonstrated that CIS negatively regulated IL-4–STAT6 and IL-2–STAT5 pathways that were both important in TH9 differentiation.

Our results thus far showed that CIS inhibited TH2 and TH9 differentiation by antagonizing the activation of STAT5 and STAT6. STAT5 has been shown to bind to the Il4 locus-control region41, whereas STAT6 binds to the Il4 and Gata3 loci42. By comparison of mouse and human genomic DNA sequences with the ECR browser (of evolutionary conserved regions)43 and rVISTA program44, we found potentially overlapping STAT5- and STAT6-binding sites (TGCCAGGAAATACCATTCCTCAGA and AGGAAATA, respectively) in the Il9 promoter. We sought to determine whether CIS controls the TH2 and TH9 programs by targeting the DNA-binding activity of STAT5 and STAT6. To address this question, we did chromatin immunoprecipitation (ChIP) with anti-STAT5, anti-STAT6 or a control antibody. We activated naive CD4+ T cells from wild-type and Cis−/− mice with plate-bound anti-CD3 and anti-CD28 in the presence (for STAT5 analysis) or absence (for STAT6 analysis) of IL-2. Through the use of anti-STAT5, we observed that the absence of CIS resulted in significantly more binding of STAT5 at the Il4 locus HS2 (DNase I hypersensitive site 2) and Il9 promoter (Fig. 7d). Furthermore, as shown by the use of anti-STAT6, CIS deficiency led to significantly enhanced binding of STAT6 to the Gata3 promoter and conserved noncoding sequence CNS1, the Il4 locus enhancer and the Il9 promoter (Fig. 7e). Furthermore, in a luciferase reporter assay, STAT5 and STAT6 trans-activated the transcription of a luciferase reporter driven by the Il9 promoter in the presence of the phorbol ester PMA (in the presence of IL-4 for STAT6) (Fig. 7f,g). These results therefore suggested that CIS attenuated TH2 and TH9 differentiation through inhibition of the phosphorylation of STAT5 and STAT6 and, in turn, their binding to genes encoding TH2 and TH9 signature cytokines.

DISCUSSION

Effector T cell differentiation is directed by the environmental cytokine milieu. STAT proteins are broadly engaged in cytokine signaling transduction and critically regulate the differentiation of helper T cells into the TH1, TH2 and TH17 subsets. However, the involvement of STAT proteins in the TH9 subset of helper T cells is unclear. Because TH9 differentiation requires IL-4, STAT6 is probably involved. STAT activity is negatively regulated by members of the SOCS family. SOCS1, SOCS3 and SOCS5 have been shown to regulate the differentiation of helper T cells through inhibition of STAT activation12–14. In this paper, we have reported an essential role for the SOCS family member CIS in the control of the proallergic differentiation of TH2 and TH9 cells and allergic diseases.

SOCS expression is induced by cytokine signals, activated STAT mainly through proteins. We tested a panel of cytokines that are important in the differentiation of helper T cells in the presence of signaling via the T cell antigen receptor and the coreceptor CD28. We found at the early phase of progenitor activation of helper T cells, IL-6 and IL-10 weakly induced CIS expression, whereas IL-4 strongly induced CIS expression. Consistent with that, in response to IL-4, IL-4Rα-deficient CD4+ T cells failed to upregulate Cis mRNA expression. However, STAT6-deficient CD4+ T cells had lower expression of Cis mRNA, approximately 50% that of wild-type cells. These data indicated in addition to STAT6, unknown factors mediate IL-4-induced CIS expression. Cis has been shown to be induced by STAT5 in liver cells31, erythroid progenitor cells30 and human T lymphocytes33. Our results suggest that Cis may be regulated by distinct cytokines in a cell type–specific manner. As CIS negatively regulates allergic responses, IL-4-induced Cis expression may serve as a negative feedback mechanism.

As IL-4 is the major inducer of CIS at the early phase of the differentiation of helper T cells, CIS may be involved in the IL-4-directed differentiation of helper T cells, such as TH2 and TH9 cells. Indeed, CIS deficiency led to spontaneously augmented TH2 and TH9 differentiation but not to the generation of TH1 of TH17 cells. As for inducible Treg cells, when differentiated with TGF-β and IL-2, CIS-deficient cell populations included fewer cells that were Foxp3+, whereas after the addition of anti-IL-4 we did not observe this difference. Thus, in Treg cell differentiation, CIS seemed to act indirectly by enhancing the TH2 response. Although Treg cells had high expression of CIS, genetic deletion of CIS in Treg cells did not lead to enhanced allergic diseases, which indicated an dispensable role for CIS in Foxp3+ Treg cells. It is also possible that other SOCS proteins, such as SOCS2, have redundant function in these cells.

Members of the SOCS family attenuate cytokine signaling by inhibiting the phosphorylation of STAT proteins. CIS has been shown to associate with the IL-2 receptor β-chain and to inhibit IL-2-dependent signaling by disruption of the Jak-STAT5 pathway32,33. In this study, we found that CIS deficiency enhanced the phosphorylation of STAT3, STAT5 and STAT6 but not that of STAT1. The STAT5 signals were initiated by IL-2, as in the absence of exogenous IL-2, phosphorylation of STAT5 was delayed and there were no differences between wild-type and CIS-deficient cells in the phosphorylation of STAT5. With or without exogenous IL-2, the phosphorylation of STAT3 and STAT6 was not altered, which suggested that other cytokines were responsible for the activation of STAT3 and STAT6. When IL-4 was blocked with a neutralizing antibody, phosphorylated STAT6 signals disappeared, which indicated that a trace amount of IL-4 in the medium or from autocrine secretion was sufficient to induce STAT6 activation. However, blockade of IL-6 or/and IL-21 did not change the activation of STAT3 in wild-type or CIS-deficient cells. At this time, the cytokine that activates STAT3 is unclear. Together, the enhanced signaling via STAT5 and STAT6 may have accounted for the enhanced TH2 response of CIS-deficient cells. Consistent with the lack of an effect of CIS deficiency on TH1 differentiation, the activation of STAT1 was intact in CIS-deficient cells. CIS deficiency did not alter TH17 differentiation, and this may have been due to the enhanced signaling via STAT5, a negative regulator of TH17 differentiation8, counterbalanced by enhanced activation of STAT3.

TH9 polarization is driven by IL-4 and TGF-β, which can activate the transcription factors PU.1 and IRF4 to establish the TH9 program45,46. In our study, CIS deficiency led to higher expression of Il9 mRNA and Irf4 mRNA but not of mRNA encoding PU.1 (Sfpi1), which suggested a more important role for IRF4 in TH9 differentiation when CIS is absent. However, the STAT proteins that mediate TH9 differentiation had not been identified before, to our knowledge. We found that in the presence of IFN-γ, blockade of IL-4 or IL-2 resulted in a much lower frequency of CIS-deficient IL-9+ cells, whereas we observed no wild-type IL-9+ cells, which suggested involvement of IL-2–STAT5 and/or IL-4–STAT6 signaling in TH9 differentiation. To confirm that, we assessed the effect of STAT5 and STAT6 on TH9 polarization. Conditional removal of STAT5A resulted in less TH9 polarization, whereas forced expression of a constitutive activation form of STAT5A (STAT5A1*6) resulted in more TH9 polarization. In addition to STAT5 deficiency, STAT6 deficiency profoundly impaired TH9 skewing, consistent with a published report on STAT6-dependent regulation of TH9 differentiation40. Moreover, we also demonstrated that in addition to binding to genes of the TH2 signature (Gata3 and Il4), STAT5 and STAT6 bound to the Il9 promoter and transactivated its transcription. These data indicated essential roles for STAT5 and STAT6 in the generation of TH9 cells.

In vivo, CIS-deficient mice were more susceptible to experimental allergic asthma, associated with enhanced TH2 and TH9 responses, in which enhanced eosinophil influx may manifest the acute allergic responses. In the asthma model, we also observed moderately more airway remodeling in CIS-deficient mice (data not shown). With aging, CIS-deficient mice spontaneously developed allergic pulmonary disease with alveolar epithelial cell and airway muscle cell hyperplasia and increased eosinophils in lungs. This may have been due to chronically enhanced expression of the TH2 cytokine IL-13 (refs. 47–49) and the TH9 cytokine, IL-9 (refs. 36–38,49). As both TH2 differentiation and TH9 differentiation require IL-4, the higher IL-4 expression in CIS-deficient mice may further augment TH2 and TH9 responses. Moreover, IL-9 also promotes IL-13 expression in airway epithelial cells50, which further amplifies the effect of IL-13. Notably, we did not observe the spontaneous airway remodeling in older Cisfl/flCD4-Cre mice (1 year of age; data not shown), which suggested that enhanced TH2 and TH9 responses are not the only pathogenic factors and that defective CIS signaling in other cells, cells of the innate immune system and/or airway structural cells, for example, may have a role. Notably, innate sources of IL-9 and IL-13 have been shown to be important regulators of lung inflammation, especially in acute allergic responses51,52. The role of CIS in cell types other than TH2 and TH9 needs further investigation.

In summary, we found that CIS, induced by IL-4 (and also IL-2 at the late phase), attenuated IL-2–STAT5 and IL-4–STAT6 signaling during TH2 and TH9 differentiation by diminishing the binding of STAT5 and STAT6 to TH2 and TH9 signature genes. Therefore, our data suggest negative feedback by CIS-STAT5-STAT6 pathway in TH2 and TH9 differentiation. Our results may help elucidate the pathogenesis of human allergic diseases.

ONLINE METHODS

Mice

For the generation of CIS-deficient mice and mice with loxP-flanked Cis alleles, a targeting vector was constructed by the introduction of two loxP sites into the Cis locus with a neomycin--resistance cassette (neor; positive selection marker) and sequence encoding diphtheria toxin A (negative selection marker; Supplementary Fig. 2). Targeted 129S6/SvEvTac derived TC-1 embryonic stem cell clones were selected and injected into C57BL/6 (B6) blastocysts to generate chimeras. Chimeras wih high percentage of 129 cells were bred with B6 mice for germline transmission. Targeted mice were crossed with FLPeR mice (which have a knock-in allele with widespread expression of the FLPe variant of the Saccharomyces cerevisiae FLP1 recombinase; Jackson Laboratory) to generate mice bearing a loxP-flanked conditional Cis allele (Cisfl/+). The Cisfl/+ mice were then bred with mice that express Cre recombinase from the cytomegalovirus promoter (Jackson Laboratory), and the excision of exon 2 and the coding region of exon 3 resulted in the generation of Cis+/− mice. Cisfl/+ and Cis+/− mice were backcrossed with B6 mice for seven to eight generations and were then interbred to generate Cisfl/fl and Cis−/− mice. Cis−/− mice on the B6 background were studied with age- and sex-matched Cisfl/fl mice on the same background or wild-type littermates as controls. In some experiments, Cisfl/+ mice were bred with CD4-Cre mice53 or Foxp3-Cre mice54 to generated mice with T cell–or Treg cell–specific deletion of Cis, respectively. The genotyping primers were as follows: F, 5′-TGAGTAACCTGCCCTTTGGT; R1, 5′-TGGGGTTCTCAGGGAGACCTC; and R2, 5′-CCTAGAGGCGTTGACCTCAG. The primers F and R1 amplify a 260–base pair band (wild-type) or a 452–base pair band (loxP-flanked), whereas the primers F and R2 produce a 408–base pair band (Cis deletion). Stat5afl/+Mx-Cre Ai3 and Stat5afl/−Mx-Cre Ai3 mice have been described55,56,57,58. Stat6−/− mice (on the BALB/c background), BALB/c mice, Il4ra−/− mice (on the B6 background) and Rag1−/− mice (on the B6 background) were from the Jackson laboratory. Animals were housed in a specific pathogen–free facility, and animal experiments were done with protocols approved by Institutional Animal Care and Use Committee of the MD Anderson Cancer Center and the University of New Mexico Health Sciences Center.

Immunoblot analysis

Total CD4+ T cells sorted by magnetic-activated cell sorting were activated for various times by plate-bound anti-CD3 (2C11; BioXCell) and anti-CD28 (37.51; BioXCell) in the presence or absence of IL-2 or anti-IL-4 (11B11; BioXCell) or anti-IL-6 (MP520F3; R&D Systems) or/and anti-IL-21 (AF594; R&D Systems). Whole-cell lysates were subjected to immunoblot analysis. The antibodies were as follows: anti-STAT1 (9172; Cell Signaling Technology), anti–phosphorylated STAT1 (9171; Cell Signaling Technology), anti-STAT3 (sc-482; Santa Cruz Biotechnology, Santa Cruz, CA), anti–phosphorylated STAT3 (91345; Cell Signaling Technology), anti-STAT5 (sc-835; Santa Cruz), anti–phosphorylated STAT5 (93515; Cell Signaling Technology), anti-STAT6 (sc-981; Santa Cruz), anti–phosphorylated STAT6 (sc-981-G; Santa Cruz) and anti-CIS (N19; sc-1529; Santa Cruz).

T cell differentiation

Naive CD4+CD25−CD62LhiCD44lo T cells were sorted by flow cytometry and activated with 1 μg/ml plate-bound anti-CD3 and 1 μg/ml soluble anti-CD28 in the presence of polarizing cytokines or/and blocking antibodies. For TH1 polarization, 5 μg/ml anti-IL-4 (11B11; BioXCell) and 5 ng/ml IL-12 (Peprotech) were used. For TH2 polarization, 5 μg/ml anti-IFN-γ (XMG1.2; BioXCell) and 5 ng/ml IL-4 (Peprotech) were used. For TH9 polarization, 2 ng/ml TGF-β (Peprotech) and 20 ng/ml IL-4 were used. For TH17 polarization, 20 ng/ml IL-6 (Peprotech) and 2.5 ng/ml TGF-β were used. For iTreg differentiation, 5 ng/ml TGF-β and 50 unit/ml recombinant human IL-2 with or without anti-IL-4 were used.

Asthma induction

Allergic asthma was induced and analyzed as described34.

Retroviral transduction

Flow cytometry–sorted naive CD4+CD25−CD62LhiCD44lo T cells from B6 mice were activated with anti-CD3 and anti-CD28 in the presence of anti-IFN-γ. Then, 24 h later, cells were transduced with pMX-ires-GFP vector or retrovirus encoding STAT5A1*6 (ref. 39) and were maintained in medium containing anti-IFN-γ with or without switching to the TH9-polarization condition after infection on day 2.

Quantitative real-time RT-PCR

Gene expression was examined with a Bio-Rad iCycler Optical System with an iQ SYBR green real-time PCR kit (Bio-Rad Laboratories). Data were normalized to an Actb reference gene. The primers for CIS were as follows: forward, 5′-GGACATGGTCCTTTGCGTACAG, and reverse, 5′-GGAGAACGTCTTGGCTATGCAC. Cd25 (ref. 59), Il9, Il4, Il5, and Il13 (ref. 60), Il10 (ref. 61), Gata3, Irf4, Il17rb, Il2 (ref. 62), Junb (ref. 63), Nfatc1p1 (ref. 64), Actb, Tbx21 (ref. 65) were amplified as described before.

ChIP

For ChIP analysis of STAT proteins, cytoplasmic STAT proteins were removed by cell fractionation by the following procedure: 3 × 106 to 5 × 106 CD4+ T cells were suspended in 500 μl of cold buffer containing 10 mM HEPES, pH7.9, 1.5 mM MgCl2, 10 mM KCl and 0.5% NP-40, plus proteinase inhibitors, 0.5 mM PMSF, 2 μg/ml aprotenin, 10 μg/ml leupeptin and 1 mM Na3VO4. After incubation for 15–30 min on ice, the cells were spun for 5 min at 10,000 r.p.m. at 4 °C. The pellet (nuclear fraction) was then subjected to ChIP assay as described66. The antibodies used were polyclonal anti-STAT5 (sc-835; Santa Cruz), polyclonal anti-STAT6 (sc-981; Santa Cruz) or control immunoglobulin G (sc-2763; Santa Cruz). The resulting DNA was analyzed by real-time PCR. The primers for STAT5-binding sites were as follows: Il9 promoter, forward, 5′-ACTGATACCCAGTGCCCAC, and reverse, 5′-ACACAGACCTGGGCTTTCA; Cis promoter, forward, 5′-CACGTCAGTTCAGGGTCCCT, and reverse, 5′-CGTCTAGTGCTTTGGACCGA; and Il4 HS2 primers as described41. The primers for STAT6-binding sites were as follows: Il9 and Cis promoter primers, same as the primers for the STAT5-binding sites; Il4 enhancer and Gata3 promoter and CNS1 primers as described42. Negative control primers were as follows: Cd4, forward, 5′-TTGTGGCTGTTGCTTTTGAG, and reverse, 5′-CCAGGCTGCTACAAGAGACC; Apoe, forward, 5′-GCCTAGCCGAGGGAGAGCCG, and reverse, 5′-TGTGACTTGGGAGCTCTGCAGC.

Luciferase reporter assay

Vector encoding STAT5A1*6 (ref. 39) or STAT6VT67 or empty vector was transfected into EL4 T cells with luciferase constructs containing the Il9 promoter (cloning primers: forward, 5′-GATCCTCAAGGCCAATGCT, and reverse, 5′-ACATGTTGACGGGAGTCTGG) with or without PMA (phorbol 12-myristate 13-acetate; Sigma) and IL-4. Firefly and renilla luciferase activity were measured by dual-luciferase reporter system (Promega) and renilla luciferase was used to normalize transfection efficiency and luciferase activity.

Generation of mixed–bone marrow chimeras

Irradiated Rag1−/− mice were reconstituted with T cell–depleted bone marrow from wild-type (CD45.1+) mice nd Cis−/− (CD45.2+) mice on the B6 background (1:1 mixture) as described66. For induction of asthma, the chimeric mice were used 6 weeks later.

Statistical analysis

The statistical significance of differences between groups as calculated with the unpaired Student’s t test. P values of 0.05 or less were considered significant.

Supplementary Material

Supplemental figures

Acknowledgments

We thank S. Rivera and J. Parker-Thornburg at MD Anderson Genetic Engineered Mouse Facility for help in generating gene-targeted animals; A.Y. Rudensky (Memorial Sloan-Kettering Cancer Center) for Foxp3-GFP and Foxp3-Cre mice; C.B. Wilson (University of Washington) for CD4-Cre mice; M. Kaplan (Indiana University School of Medicine) for the STAT6VT-expressing construct; and members of the Dong laboratory for help and discussion. Supported by the US NAtional Institutes of Health (C.D., S.S.W., D.W. and D.B.C.), the Leukemia and Lymphoma Society (C.D. and D.W.), MD Anderson Cancer Center (C.D.), Biology of Inflammation Center at Baylor College of Medicine (D.B.C.), the American Heart Association, the American Cancer Society-Institutional Research Grant (X.O.Y.), the Shanghai Board of Health Foundation, Shanghai Jiao Tong University (X.N.) and the Ministry of Education of China (J.P.).

Footnotes

Note: Supplementary information is available in the online version of the paper.

AUTHOR CONTRIBUTIONS

C.D. and X.O.Y. conceived of the project, designed the experiments and wrote the manuscript; X.O.Y., H.Z. and B.-S.K. did most of the experiments; and X.N., J.P., Y.C., R.K,. Y.-H.L., S.H.C., D.B.C., D.W. and S.S.W. participated in specific experiments.

COMPETING FINANCIAL INTERESTS

The authors declare no competing financial interests.

Reprints and permissions information is available online at http://www.nature.com/reprints/index.html.

References

  • 1.Dong C. Diversification of T-helper-cell lineages: finding the family root of IL-17-producing cells. Nat Rev Immunol. 2006;6:329–333. doi: 10.1038/nri1807. [DOI] [PubMed] [Google Scholar]
  • 2.Glimcher LH, Murphy KM. Lineage commitment in the immune system: the T helper lymphocyte grows up. Genes Dev. 2000;14:1693–1711. [PubMed] [Google Scholar]
  • 3.Dong C, Flavell RA. Control of T helper cell differentiation–in search of master genes. Sci STKE. 2000;2000:PE1. doi: 10.1126/stke.2000.49.pe1. [DOI] [PubMed] [Google Scholar]
  • 4.Cote-Sierra J, et al. Interleukin 2 plays a central role in Th2 differentiation. Proc Natl Acad Sci USA. 2004;101:3880–3885. doi: 10.1073/pnas.0400339101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Yamane H, Zhu J, Paul WE. Independent roles for IL-2 and GATA-3 in stimulating naive CD4+ T cells to generate a Th2-inducing cytokine environment. J Exp Med. 2005;202:793–804. doi: 10.1084/jem.20051304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Liao W, et al. Priming for T helper type 2 differentiation by interleukin 2-mediated induction of interleukin 4 receptor α-chain expression. Nat Immunol. 2008;9:1288–1296. doi: 10.1038/ni.1656. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Dong C. Differentiation and function of pro-inflammatory Th17 cells. Microbes Infect. 2009;11:584–588. doi: 10.1016/j.micinf.2009.04.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Laurence A, et al. Interleukin-2 signaling via STAT5 constrains T helper 17 cell generation. Immunity. 2007;26:371–381. doi: 10.1016/j.immuni.2007.02.009. [DOI] [PubMed] [Google Scholar]
  • 9.Schmitt E, et al. IL-9 production of naive CD4+ T cells depends on IL-2, is synergistically enhanced by a combination of TGF-β and IL-4, and is inhibited by IFN-β. J Immunol. 1994;153:3989–3996. [PubMed] [Google Scholar]
  • 10.Dardalhon V, et al. IL-4 inhibits TGF-β-induced Foxp3+ T cells and, together with TGF-β, generates IL-9+IL-10+Foxp3− effector T cells. Nat Immunol. 2008;9:1347–1355. doi: 10.1038/ni.1677. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Veldhoen M, et al. Transforming growth factor-‘reprograms’ the differentiation of T helper 2 cells and promotes an interleukin 9-producing subset. Nat Immunol. 2008;9:1341–1346. doi: 10.1038/ni.1659. [DOI] [PubMed] [Google Scholar]
  • 12.O’Shea JJ, Gadina M, Schreiber RD. Cytokine signaling in 2002: new surprises in the Jak/Stat pathway. Cell. 2002;109 (Suppl):S121–S131. doi: 10.1016/s0092-8674(02)00701-8. [DOI] [PubMed] [Google Scholar]
  • 13.Yoshimura A, Naka T, Kubo M. SOCS proteins, cytokine signalling and immune regulation. Nat Rev Immunol. 2007;7:454–465. doi: 10.1038/nri2093. [DOI] [PubMed] [Google Scholar]
  • 14.Palmer DC, Restifo NP. Suppressors of cytokine signaling (SOCS) in T cell differentiation, maturation, and function. Trends Immunol. 2009;30:592–602. doi: 10.1016/j.it.2009.09.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Zhang JG, et al. The SOCS box of suppressor of cytokine signaling-1 is important for inhibition of cytokine action in vivo. Proc Natl Acad Sci USA. 2001;98:13261–13265. doi: 10.1073/pnas.231486498. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Yoshimura A, et al. A novel cytokine-inducible gene CIS encodes an SH2-containing protein that binds to tyrosine-phosphorylated interleukin 3 and erythropoietin receptors. EMBO J. 1995;14:2816–2826. doi: 10.1002/j.1460-2075.1995.tb07281.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Sakamoto H, et al. A Janus kinase inhibitor, JAB, is an interferon-γ-inducible gene and confers resistance to interferons. Blood. 1998;92:1668–1676. [PubMed] [Google Scholar]
  • 18.Alexander WS, et al. SOCS1 is a critical inhibitor of interferon γ signaling and prevents the potentially fatal neonatal actions of this cytokine. Cell. 1999;98:597–608. doi: 10.1016/s0092-8674(00)80047-1. [DOI] [PubMed] [Google Scholar]
  • 19.Eyles JL, Metcalf D, Grusby MJ, Hilton DJ, Starr R. Negative regulation of interleukin-12 signaling by suppressor of cytokine signaling-1. J Biol Chem. 2002;277:43735–43740. doi: 10.1074/jbc.M208586200. [DOI] [PubMed] [Google Scholar]
  • 20.Diehl S, et al. Inhibition of Th1 differentiation by IL-6 is mediated by SOCS1. Immunity. 2000;13:805–815. doi: 10.1016/s1074-7613(00)00078-9. [DOI] [PubMed] [Google Scholar]
  • 21.Egwuagu CE, et al. Suppressors of cytokine signaling proteins are differentially expressed in Th1 and Th2 cells: implications for Th cell lineage commitment and maintenance. J Immunol. 2002;168:3181–3187. doi: 10.4049/jimmunol.168.7.3181. [DOI] [PubMed] [Google Scholar]
  • 22.Kubo M, Inoue H. Suppressor of cytokine signaling 3 (SOCS3) in Th2 cells evokes Th2 cytokines, IgE, and eosinophilia. Curr Allergy Asthma Rep. 2006;6:32–39. doi: 10.1007/s11882-006-0007-6. [DOI] [PubMed] [Google Scholar]
  • 23.Seki Y, et al. SOCS-3 regulates onset and maintenance of TH2-mediated allergic responses. Nat Med. 2003;9:1047–1054. doi: 10.1038/nm896. [DOI] [PubMed] [Google Scholar]
  • 24.Kubo M, Ozaki A, Tanaka S, Okamoto M, Fukushima A. Role of suppressor of cytokine signaling in ocular allergy. Curr Opin Allergy Clin Immunol. 2006;6:361–366. doi: 10.1097/01.all.0000244797.48981.6d. [DOI] [PubMed] [Google Scholar]
  • 25.Kinjyo I, et al. Loss of SOCS3 in T helper cells resulted in reduced immune responses and hyperproduction of interleukin 10 and transforming growth factor-β1. J Exp Med. 2006;203:1021–1031. doi: 10.1084/jem.20052333. cite in text. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Chen Z, et al. Selective regulatory function of Socs3 in the formation of IL-17-secreting T cells. Proc Natl Acad Sci USA. 2006;103:8137–8142. doi: 10.1073/pnas.0600666103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Ogura H, et al. Interleukin-17 promotes autoimmunity by triggering a positive-feedback loop via interleukin-6 induction. Immunity. 2008;29:628–636. doi: 10.1016/j.immuni.2008.07.018. [DOI] [PubMed] [Google Scholar]
  • 28.Seki Y, et al. Expression of the suppressor of cytokine signaling-5 (SOCS5) negatively regulates IL-4-dependent STAT6 activation and Th2 differentiation. Proc Natl Acad Sci USA. 2002;99:13003–13008. doi: 10.1073/pnas.202477099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Brender C, et al. SOCS5 is expressed in primary B and T lymphoid cells but is dispensable for lymphocyte production and function. Mol Cell Biol. 2004;24:6094–6103. doi: 10.1128/MCB.24.13.6094-6103.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Iwatsuki K, et al. STAT5 Activation correlates with erythropoietin receptor-mediated erythroid differentiation of an erythroleukemia cell line. J Biol Chem. 1997;272:8149–8152. doi: 10.1074/jbc.272.13.8149. [DOI] [PubMed] [Google Scholar]
  • 31.Ram PA, Waxman DJ. SOCS/CIS protein inhibition of growth hormone-stimulated STAT5 signaling by multiple mechanisms. J Biol Chem. 1999;274:35553–35561. doi: 10.1074/jbc.274.50.35553. [DOI] [PubMed] [Google Scholar]
  • 32.Matsumoto A, et al. CIS, a cytokine inducible SH2 protein, is a target of the JAK-STAT5 pathway and modulates STAT5 activation. Blood. 1997;89:3148–3154. [PubMed] [Google Scholar]
  • 33.Aman MJ, et al. CIS associates with the interleukin-2 receptor β chain and inhibits interleukin-2-dependent signaling. J Biol Chem. 1999;274:30266–30272. doi: 10.1074/jbc.274.42.30266. [DOI] [PubMed] [Google Scholar]
  • 34.Yang XO, et al. Regulation of inflammatory responses by IL-17F. J Exp Med. 2008;205:1063–1075. doi: 10.1084/jem.20071978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Laouini D, et al. IL-10 is critical for Th2 responses in a murine model of allergic dermatitis. J Clin Invest. 2003;112:1058–1066. doi: 10.1172/JCI18246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Temann UA, Geba GP, Rankin JA, Flavell RA. Expression of interleukin 9 in the lungs of transgenic mice causes airway inflammation, mast cell hyperplasia, and bronchial hyperresponsiveness. J Exp Med. 1998;188:1307–1320. doi: 10.1084/jem.188.7.1307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.McLane MP, et al. Interleukin-9 promotes allergen-induced eosinophilic inflammation and airway hyperresponsiveness in transgenic mice. Am J Respir Cell Mol Biol. 1998;19:713–720. doi: 10.1165/ajrcmb.19.5.3457. [DOI] [PubMed] [Google Scholar]
  • 38.Ying S, Meng Q, Kay AB, Robinson DS. Elevated expression of interleukin-9 mRNA in the bronchial mucosa of atopic asthmatics and allergen-induced cutaneous late-phase reaction: relationships to eosinophils, mast cells and T lymphocytes. Clin Exp Allergy. 2002;32:866–871. doi: 10.1046/j.1365-2222.2002.01376.x. [DOI] [PubMed] [Google Scholar]
  • 39.Onishi M, et al. Identification and characterization of a constitutively active STAT5 mutant that promotes cell proliferation. Mol Cell Biol. 1998;18:3871–3879. doi: 10.1128/mcb.18.7.3871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Goswami R, et al. STAT6-dependent regulation of Th9 development. J Immunol. 2012;188:968–975. doi: 10.4049/jimmunol.1102840. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Zhu J, Cote-Sierra J, Guo L, Paul WE. Stat5 activation plays a critical role in Th2 differentiation. Immunity. 2003;19:739–748. doi: 10.1016/s1074-7613(03)00292-9. [DOI] [PubMed] [Google Scholar]
  • 42.Scheinman EJ, Avni O. Transcriptional regulation of GATA3 in T helper cells by the integrated activities of transcription factors downstream of the interleukin-4 receptor and T cell receptor. J Biol Chem. 2009;284:3037–3048. doi: 10.1074/jbc.M807302200. [DOI] [PubMed] [Google Scholar]
  • 43.Ovcharenko I, Nobrega MA, Loots GG, Stubbs L. ECR Browser: a tool for visualizing and accessing data from comparisons of multiple vertebrate genomes. Nucleic Acids Res. 2004;32:W280–286. doi: 10.1093/nar/gkh355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Loots GG, Ovcharenko I. rVISTA 2.0: evolutionary analysis of transcription factor binding sites. Nucleic Acids Res. 2004;32:W217–221. doi: 10.1093/nar/gkh383. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Chang HC, et al. The transcription factor PU. 1 is required for the development of IL-9-producing T cells and allergic inflammation. Nat Immunol. 2010;11:527–534. doi: 10.1038/ni.1867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Staudt V, et al. Interferon-regulatory factor 4 is essential for the developmental program of T helper 9 cells. Immunity. 2010;33:192–202. doi: 10.1016/j.immuni.2010.07.014. [DOI] [PubMed] [Google Scholar]
  • 47.Kasaian MT, Miller DK. IL-13 as a therapeutic target for respiratory disease. Biochem Pharmacol. 2008;76:147–155. doi: 10.1016/j.bcp.2008.04.002. [DOI] [PubMed] [Google Scholar]
  • 48.Wynn TA. IL-13 effector functions. Annu Rev Immunol. 2003;21:425–456. doi: 10.1146/annurev.immunol.21.120601.141142. [DOI] [PubMed] [Google Scholar]
  • 49.Doherty T, Broide D. Cytokines and growth factors in airway remodeling in asthma. Curr Opin Immunol. 2007;19:676–680. doi: 10.1016/j.coi.2007.07.017. [DOI] [PubMed] [Google Scholar]
  • 50.Temann UA, Laouar Y, Eynon EE, Homer R, Flavell RA. IL9 leads to airway inflammation by inducing IL13 expression in airway epithelial cells. Int Immunol. 2007;19:1–10. doi: 10.1093/intimm/dxl117. [DOI] [PubMed] [Google Scholar]
  • 51.Wilhelm C, et al. An IL-9 fate reporter demonstrates the induction of an innate IL-9 response in lung inflammation. Nat Immunol. 2011;12:1071–1077. doi: 10.1038/ni.2133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Spits H, Di Santo JP. The expanding family of innate lymphoid cells: regulators and effectors of immunity and tissue remodeling. Nat Immunol. 2011;12:21–27. doi: 10.1038/ni.1962. [DOI] [PubMed] [Google Scholar]
  • 53.Lee PP, et al. A critical role for Dnmt1 and DNA methylation in T cell development, function, and survival. Immunity. 2001;15:763–774. doi: 10.1016/s1074-7613(01)00227-8. [DOI] [PubMed] [Google Scholar]
  • 54.Rubtsov YP, et al. Regulatory T cell-derived interleukin-10 limits inflammation at environmental interfaces. Immunity. 2008;28:546–558. doi: 10.1016/j.immuni.2008.02.017. [DOI] [PubMed] [Google Scholar]
  • 55.Dai X, et al. Stat5 is essential for early B cell development but not for B cell maturation and function. J Immunol. 2007;179:1068–1079. doi: 10.4049/jimmunol.179.2.1068. [DOI] [PubMed] [Google Scholar]
  • 56.Fu G, et al. Phospholipase Cγ1 is essential for T cell development, activation, and tolerance. J Exp Med. 2010;207:309–318. doi: 10.1084/jem.20090880. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Kuhn R, Schwenk F, Aguet M, Rajewsky K. Inducible gene targeting in mice. Science. 1995;269:1427–9. doi: 10.1126/science.7660125. [DOI] [PubMed] [Google Scholar]
  • 58.Madisen L, et al. A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nat Neurosci. 2010;13:133–140. doi: 10.1038/nn.2467. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Hwang ES, White IA, Ho IC. An IL-4-independent and CD25-mediated function of c-maf in promoting the production of Th2 cytokines. Proc Natl Acad Sci USA. 2002;99:13026–13030. doi: 10.1073/pnas.202474499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Angkasekwinai P, Chang SH, Thapa M, Watarai H, Dong C. Regulation of IL-9 expression by IL-25 signaling. Nat Immunol. 2010;11:250–256. doi: 10.1038/ni.1846. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Lang R, Rutschman RL, Greaves DR, Murray PJ. Autocrine deactivation of macrophages in transgenic mice constitutively overexpressing IL-10 under control of the human CD68 promoter. J Immunol. 2002;168:3402–3411. doi: 10.4049/jimmunol.168.7.3402. [DOI] [PubMed] [Google Scholar]
  • 62.Yang XO, et al. Requirement for the basic helix-loop-helix transcription factor Dec2 in initial TH2 lineage commitment. Nat Immunol. 2009;10:1260–1266. doi: 10.1038/ni.1821. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Voice J, et al. c-Maf and JunB mediation of Th2 differentiation induced by the type 2 G protein-coupled receptor (VPAC2) for vasoactive intestinal peptide. J Immunol. 2004;172:7289–7296. doi: 10.4049/jimmunol.172.12.7289. [DOI] [PubMed] [Google Scholar]
  • 64.Evans KE, Fox SW. Interleukin-10 inhibits osteoclastogenesis by reducing NFATc1 expression and preventing its translocation to the nucleus. BMC Cell Biol. 2007;8:4. doi: 10.1186/1471-2121-8-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Yang XO, et al. STAT3 regulates cytokine-mediated generation of inflammatory helper T cells. J Biol Chem. 2007;282:9358–9363. doi: 10.1074/jbc.C600321200. [DOI] [PubMed] [Google Scholar]
  • 66.Yang XO, et al. T helper 17 lineage differentiation is programmed by orphan nuclear receptors RORα and RORγ. Immunity. 2008;28:29–39. doi: 10.1016/j.immuni.2007.11.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Bruns HA, Schindler U, Kaplan MH. Expression of a constitutively active Stat6 in vivo alters lymphocyte homeostasis with distinct effects in T and B cells. J Immunol. 2003;170:3478–3487. doi: 10.4049/jimmunol.170.7.3478. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental figures

RESOURCES