Skip to main content
PLOS ONE logoLink to PLOS ONE
. 2014 Jul 7;9(7):e101695. doi: 10.1371/journal.pone.0101695

Integrative Approach Detected Association between Genetic Variants of microRNA Binding Sites of TLRs Pathway Genes and OSCC Susceptibility in Chinese Han Population

Yun Wang 1,#, Chongkui Sun 1,#, Taiwen Li 1, Hao Xu 1,2, Yu Zhou 1, Hongxia Dan 1, Lu Jiang 1, Xin Zeng 1, Longjiang Li 1, Jing Li 1,*, Ga Liao 1,*, Qianming Chen 1
Editor: Sevtap Savas3
PMCID: PMC4085003  PMID: 24999832

Abstract

Oral squamous cell carcinoma (OSCC) is a leading malignancy worldwide; the overall 5-year survival rate is approximately 50%. A variety of proteins in Toll-like receptors (TLRs) pathway have been related with the risk of OSCC. However, the influence of genetic variations in TLRs pathway genes on OSCC susceptibility is unclear. Previous studies mainly focused on the coding region of genes, while the UTR region remains unstudied. In the current study, a bioinformatics approach was performed to select candidate single nucleotide polymorphisms (SNPs) on microRNA binding sites of TLRs pathway genes related with OSCC. After screening 90 OSCC related TLRs pathway genes, 16 SNPs were selected for genotyping. We found that rs5030486, the polymorphisms on 3′ UTR of TRAF6, was significantly associated with OSCC risk. AG genotype of TRAF6 was strongly associated with a decreased risk of OSCC (OR = 0.252; 95% CI = 0.106, 0.598; p = 0.001). In addition, AG genotype was also related with a reduced risk of OSCC progression both in univariable analysis (HR = 0.303, 95% CI = 0.092, 0.995) and multivariable analysis (HR = 0.272, 95% CI = 0.082, 0.903). Furthermore, after detecting the mRNA expression level of TRAF6 in 24 OSCC patients, we found that TRAF6 expression level was significantly different between patients carrying different genotypes at locus rs5030486 (p = 0.013), indicating that rs5030486 of TRAF6 might contribute to OSCC risk by altering TRAF6 expression level. In general, these data indicated that SNP rs5030486 could be a potential bio-marker for OSCC risk and our results might provide new insights into the association of polymorphisms within the non-coding area of genes with cancers.

Introduction

Oral squamous cell carcinoma (OSCC) is one of the top ten malignancies worldwide, with approximately 500, 000 new cases each year [1]. In addition to environmental factors including alcohol, tobacco, chronic inflammation and viral infection, genetic factors are also found to play an important role in the occurrence and progression of OSCC [2]. Although many genes and signal pathways have been associated with OSCC [3], the precise function of genetic variants in the development of OSCC remains unclear.

Chronic inflammation takes part in all the three mechanistic phases of carcinogenesis [4][6]. Several molecular pathways have been linked to the inflammatory response during malignant transformation, and the Toll-like receptors (TLRs) pathway is one of the most important of these pathways [7]. TLRs are a family of transmembrane proteins which play key roles in the innate immune system by recognizing pathogen associated molecular patterns (PAMPs), and then activating the adaptive immune system [8]. Previous studies have demonstrated the contribution of TLRs pathway to the general development of cancer [9][11], as well as increased risk in OSCC [12], [13].

MicroRNAs are a class of endogenous, non-coding small RNAs which contain 22∼25 nucleotides. They play important roles in post-transcriptional regulation of gene expression by binding complementary sites on the 3′ untranslated region (UTR) of target mRNAs. Their functional region is called the “seed region”, which contains 6∼8 nucleotides to degrade target mRNA or inhibit the translation [14], [15]. Binding affinity and specificity between microRNA and mRNA depend on base pairing. Therefore, single nucleotide polymorphisms (SNPs) in the 3′-UTR region of mRNA may modify the binding affinity of microRNA with mRNA [16]. Such a disruption would alter the gene expression and may influence cancer risk. Recent studies have confirmed the association between SNPs in microRNA binding site and cancer risk [17][19].

Previous studies in OSCC genetics mainly focused on the polymorphisms in the coding regions [20], [21]. However, the effect of non-coding SNPs in OSCC risk is unexplored. We hypothesize that polymorphisms in microRNA binding sites of genes in TLRs pathway genes might have influence on OSCC risk. In this study, SNPs on microRNA binding sites of Toll-like receptors (TLRs) pathway genes related to OSCC were selected using a bioinformatics approach. Afterwards, a hospital-based case-control study was then carried out to validate the association of candidate SNPs with OSCC susceptibility in Chinese Han Population.

Materials and Methods

1 Study population

186 case subjects, clinically and pathologically diagnosed as OSCC from 2009 to 2012, was recruited for this study. 186 cancer-free subjects that were matched with case subjects by gender and age were recruited as controls. All subjects were identified from West China Hospital of Stomatology, Sichuan University (Chengdu, China). Clinical information was collected from all case subjects. A follow-up study was performed in all the enrolled OSCC patients until July 2013. 1ml peripheral blood sample was drawn from all subjects and stored at −80°C for further detection. Written informed consent was obtained from each subject.

2 Ethics statement

This study has been approved by the Ethnic Committee of State Key Laboratory of Oral Diseases, and the Clinical Trials Registration number is WCHSIEC-D-2012-00001.

3 SNPs selection

Extensive literature review and bioinformatical approaches were used to select SNPs within miRNA binding sites. Initially, we identified 90 OSCC-related genes involved in TLRs pathway by scanning related reviews from two databases in the past five years (http://www.biocarta.com, http://cgap.nci.nih.gov/Pathways). SNPs within the miRNA binding sites of these 90 genes were searched in two different databases. 87 and 65 SNPs within the miRNA binding sites of these 90 genes were identified in PolymiRTS (http://compbio.uthsc.edu/miRSNP; last updated in Apr. 2012) and Patrocles. (http://www.patrocles.org; last updated in Nov. 2010), respectively. The searching results were then intersected and 58 SNPs were selected. After checking the minor allele frequency (MAF) of these SNPs (http://www.ncbi.nlm.nih.gov/snp/), which was based on the frequencies in Asia population, 23 out of 58 were excluded with the frequency of no more than 5%. Then, LDSelect program (http://droog.gs.washington.edu/ldSelect.html) was used to separate the rest SNPs in order to exclude the SNP in high linkage disequilibrium and 7 SNPs were removed. In the remaining 28 SNPs, 12 were eliminated as their primers did not fit PCR or iPLEX condition. Finally, 16 SNPs were selected for genotyping. The flow diagram of selection was shown in Figure 1. Information for all selected genes and SNPs is shown in Table S1, Table S2 and Table S3.

Figure 1. The overall schematic diagram of this study.

Figure 1

4 DNA extraction and SNP genotyping

DNA was extracted from frozen peripheral blood samples using QIAmp DNA extraction kit (Qiagen) according to the manufacturer's protocol. Genotyping of chosen SNPs was done by Sequenom MassARRAY & iPLEX assay [22]. The primers of each chosen SNP for PCR and iPLEX assays are listed in Table 1.

Table 1. The information about six predicted polymorphisms.

Gene SNP Chromosome Major/minor allele PCR primers iPLEX primers Putative microRNAs
TRAF6 rs5030486 11 A/G F 5′-ACGTTGGATGTACTGGCAAAATACTTTCC-3′ R 5′-ACGTTGGATGTCCAGCCATAACATTCTGTC-3′ CCAATTAAGTTCCAACCAGC hsa-miR-138-5p
MYD88 rs6853 3 G/A F 5′-ACGTTGGATGGCGTACAAAACATGTAGAAG-3′ R 5′-ACGTTGGATGCACCTGTCCCCCTTTAATAC-3′ CTCCGGGGCATTTTAAAGCCATCTC hsa-miR-143
MAPK14 rs8510 6 C/T F 5′-ACGTTGGATGGCATTTACAACCAAACATGGC-3′ R 5′-ACGTTGGATGCCTCATCTCCTTTATTGCAG-3′ CCCCGTTATTGCAGTTCAAATCCT hsa-miR-541*
MAP3K7 rs2131906 6 A/G F 5′-ACGTTGGATGTTTTCCTTTTCTCATGGTGG-3′ R 5′-ACGTTGGATGCTCATTCAAGTCACAGATGC-3′ ATGTTATGCAATGAAACAGTAAAA hsa-miR-297, hsa-miR-548e, hsa-miR-548f
TLR6 rs5743823 4 T/C 5′-ACGTTGGATGGGAAATTCAACTTAAGAAACC-3′F R 5′-ACGTTGGATGCCTCCAGACAGTTACTTACG-3′ GAGGCAGTTACTTACGACTGTACT hsa-miR-452
TLR4 rs7869402 9 C/T F 5′-ACGTTGGATGACCTTCACACGTAGTTCTCC-3′ R 5′-ACGTTGGATGTTTAGGGAGACACAGATGGC-3′ TCCCTCCCCTGTACC hsa-miR-539

5 Real-time quantitative PCR analysis

Total RNA was isolated from frozen peripheral blood of 24 OSCC patients using RiboPure-Blood Kit (Applied Biosystems) according to the manufacturer's instructions. First strand cDNA was generated by High Capacity cDNA Reverse Transcription kit (Applied Biosystems). Analysis of the cDNA was performed by Quantitative real-time PCR using SYBR Select Master Mix (Applied Biosystems) and ABI Prism 7900HT Sequence Detection System (Applied Biosystems). The primers for TRAF6 were 5′ GGATTCTACACTGGCAAACCCG 3′ (forward) and 5′ CCAAGGGAGGTGGCTGTCATA 3′ (reverse). Endogenous β-actin was used as an internal control and the mRNA expression level of TRAF6 was normalized by that of β-actin with the formula ratio of Ct TRAF6/Ct β-actin *100% [23].

To detect the miRNA expression level in blood samples, TaqMan MicroRNA Reverse Transcription Kit(Applied Biosystems) was used for transcription and TaqMan Universal Master Mix II(Applied Biosystems) was used for quantitative real-time PCR with the TaqMan MicroRNA primer sets (Applied Biosystems). The PCR was performed on the ABI Prism 7900HT Sequence Detection System (Applied Biosystems). U6, which is the most highly conserved and prevalent non-coding small nuclear RNA (snRNA) in vertebrate, was used as an internal control and the miRNA expression level of has-miR-138 was normalized by that of U6 with the formula ratio of CtmiR-138/CtU6 *100% [23]. The analysis of both mRNA and miRNA expression level in peripheral blood of OSCC patients were performed by a quantification PCR experiment.

6 Statistical analysis

All statistical analysis in this study was performed using SPSS 19.0. For each selected polymorphism, Hardy–Weinberg equilibrium was determined to compare the observed frequencies of each genotype to the expected ones in control subjects by χ2 test. Student's t test was used to explore the difference in continuous variables such as distribution of age, mRNA and miRNA expression for subjects. Pearson χ2 test or Fisher's exact test were used to analyze the relationship between patient characteristics and SNP genotypes when appropriate. The OSCC risk was expressed as odds ratios (ORs) and 95% confidence intervals (CIs). The Kaplan–Meier analysis and Cox proportional hazards regression were utilized to estimate the possible association between the genotypes and progression-free survival time, which was calculated from the surgery day until the date of reoccurrence or death. All p-value was reported 2-sided and p-value ≤0.05 was considered to be statistically significant.

Results

1 Characteristics of the study subjects

The clinicopathological characteristics of subjects recruited in this study were listed in Table 2. No significant difference was detected in the distribution of age (p = 0.175) and gender (p = 0.397) between patients and controls. According to the clinical information, the percentage of patients in clinical stageI&II(54.84%) were slightly higher than those in clinical stage III&IV (45.16%). Patients with higher histologic grade tumor were more than those with lower grade tumor (56.99% to 43.01%). The number of patients who did not have lymph node metastasis was two times more than those with metastasis (68.82% to 31.18%).

Table 2. Clinicopathological Characteristics of all the enrolled subjects.

Characteristics Subgroups Case subjects (%) (N = 186) Control subjects (%) (N = 186) p-value
Age Mean(±SD) 58.04(±12.810) 56.42(±9.882) 0.175
Gender Male 116(62.37) 108(58.06)
Female 70(37.63) 78(41.94) 0.397
Clinical stage I 41(22.04)
II 61(32.80)
III 42(22.58)
IV 42(22.58)
Histological grade 1 106(56.99)
2 67(36.02)
3 13(6.99)
Lymph node metastasis Negative 128(68.82)
Positive 58(31.18)

2 SNPs identification

Following the process described above, 16 SNPs from TLRs pathway genes were chosen for genotyping. Among them, 8 SNPs were identified with only one genotype in all cases, 2 SNPs showed statistical departure from Hardy–Weinberg equilibrium (p<0.05). These 10 SNPs were thus excluded from further analysis. Information of the remaining 6 SNPs was shown in Table 1.

3 Association between SNPs and OSCC susceptibility

The genotype and allele frequencies of 6 selected SNPs in all subjects were listed in Table 3. The genotype and allele frequencies of SNP rs5030486 were significantly different between case and control subject and might be associated with OSCC risk. Compared with the AA genotype, AG genotype was strongly associated with a decreased risk of OSCC (OR = 0.252; 95% CI = 0.106, 0.598; p = 0.001). The frequency of A allele is significantly higher than the G allele in the cancer subjects than the controls (OR = 0.266; 95% CI = 0.114, 0.623; p = 0.001). No significant association with the risk of OSCC was detected among the other 5 polymorphisms.

Table 3. Association between SNPs and the risk of OSCC.

Gene name Polymorphism Case (N = 186) Control (N = 186) OR (CI 95%) p-value
N % N %
TRAF6 rs5030486 AA 179 96.24 161 86.56 1 ref
AG 7 3.76 25 13.44 0.252(0.106,0.598) 0.001
A 365 98.12 347 93.28 1 ref
G 7 1.88 25 6.72 0.266(0.114,0.623) 0.001
MYD88 rs6853 AA 170 91.40 174 93.55 1 ref
AG 16 8.60 12 6.45 1.365(0.627,2.970) 0.432
A 356 95.70 360 96.77 1 ref
G 16 4.30 12 3.23 1.348(0.629,2.891) 0.441
MAPK14 rs8510 CC 52 27.96 41 22.04 1 ref
CT 77 41.40 99 53.23 0.613(0.370,1.017) 0.058
TT 57 30.65 46 24.73) 0.977(0.556,1.718) 0.936
CT+TT 134 72.05 145 77.96 0.729(0.455,1.168) 0.188
C 181 48.77 181 48.77 1 ref
T 191 51.23 191 51.23 1.000(0.750,1.333) 1.000
MAP3K7 rs2131906 AA 174 93.55 178 95.70 1 ref
AG 12 6.45 8 4.30 1.534(0.612,3.845) 0.358
A 360 96.77 364 97.85 1 ref
G 12 3.23 8 2.15 1.517(0.613,3.754) 0.365
TLR6 rs5743823 TT 184 98.92 185 99.46 1 ref
TC 2 1.08 1 0.54 2.011(0.181,22.369) 1.000
T 370 99.46 371 99.73 1 ref
C 2 0.54 1 0.27 2.005(0.181,22.212) 1.000
TLR4 rs7869402 CC 156 83.87 157 84.41 1 ref
CT 27 14.52 29 15.59 0.937(0.530,1.655) 0.823
TT 3 1.61 0 0.00 NA 0.248
CT+TT 30 16.13 29 15.59 1.041(0.597,1.816) 0.887
C 339 91.13 343 92.2 1 ref
T 33 8.87 29 7.80 1.151(0.684,1.938) 0.596

OR, odds ratio; CI, confidence interval.

The bold numbers mean the p-value is less than 0.05.

4 Association between SNPs and OSCC progression

Until July, 2013, 70 OSCC patients among all the enrolled case subjects completed the follow-up study and 46 of them suffered from OSCC progression. After comparing the clinicopathological features of the entire cohort and the survival analysis sub-cohort, no significant difference was found in the clinicopathological of these two cohorts. Thus, the sub-cohort could be the representative of the entire cohort (Table S4). The median time for follow-up and progression-free survival was 23±13.607 months and 10±12.065 months, respectively. The relationship between OSCC progression and the 6 selected polymorphisms were summarized in Table 4. Patients carrying AG genotype of rs5030486 had longer progression-free survival time, and their risk of cancer progression was 0.303 times comparing with those carrying wild type genotype AA (HR = 0.303, 95% CI = 0.092, 0.995) (Figure 2). Moreover, after a multivariable analysis adjust for age, gender, clinical stage, histologic grade and lymph node metastasis of OSCC patients, polymorphism rs5030486 was found to be related with progression-free survival independent of other variables (HR = 0.272, 95% CI = 0.082, 0.903). No significant association with OSCC progression was observed in the remaining 5 polymorphisms.

Table 4. Progression-free survival analysis of the selected six SNPs in OSCC patients.

Polymorphisms Genotypes N (all, N = 64) N (reoccurrence, N = 46) *HR (95% CI) **HR (95% CI)
N % N %
TRAF6 rs5030486 AA 57 89.1 40 70.2 1 ref 1 ref
AG 7 10.9 6 85.7 0.303(0.092,0.995) 0.272(0.082,0.903)
MYD88 rs6853 AA 58 90.6 44 75.9 1 ref 1 ref
AG 6 9.4 2 33.3 0.265(0.063,1.109) 0.328(0.097,1.109)
MAPK14 rs8510 TT 16 25.0 11 68.8 1 ref 1 ref
CT 32 50.0 23 71.9 1.060(0.514,2.186) 1.221(0.578,2.577)
CC 16 25.0 12 75.0 0.759(0.324,1.777) 0.811(0.318,2.068)
MAP3K7 rs2131906 AA 63 98.4 46 73.0 1 ref 1 ref
AG 1 1.6 0 0.0 0.048(0.000,1470.229) 0.794(0.175,3.599)
TLR6 rs5743823 TT 63 98.4 45 71.4 1 ref 1 ref
CT 1 1.6 1 100.0 1.442(1.197,10.570) 1.520(0.194,11.932)
TLR4 rs7869402 TT 1 1.6 1 100.0 1 ref 1 ref
CT 8 12.5 8 100.0 5.892(0.645,53.845) 11.792(0.949,146.530)
CC 55 85.9 37 67.3 2.579(0.320,21.077) 2.802(0.251,31.225)

HR  =  hazard ratio; CI  = confidence interval.

The bold numbers mean the p-value is less than 0.05.

* A univariable analysis.

** A multivariable analysis adjusted for age, gender, clinical stage, histologic grade and lymph node metastasis.

Figure 2. Kaplan–Meier curves of progression-free survival time of OSCC patients carrying AA and AG genotypes of rs5030486 on TRAF6.

Figure 2

5 Correlation analysis between SNP rs5030486 and expression level of TRAF6 mRNA

The relationship of SNP rs5030486 and the mRNA expression level of TRAF6 in peripheral blood mononuclear cell (PBMC) were analyzed in 24 OSCC patients. As shown in Figure 3, the normalized Ct values for patients carrying rs5030486 AG genotype (mean±SD: 120.28±2.36) were significant lower than those carrying AA genotype (mean±SD: 123.68±3.87) (p = 0.013), indicating cases with AG genotype had higher level of TRAF6 expression than those with AA genotype. The expression level of the other 5 genes was not examined as their SNPs did not show any significant association with OSCC risk in this study.

Figure 3. The expression level of TRAF6 mRNA and hsa-miR-138 in PBMCs from 24 OSCC patients with known rs5030486 genotype.

Figure 3

β-actin and U6 were used as the internal reference to normalize the Ct value of TRAF6 mRNA and hsa-miR-138, respectively. Normalized Ct value represented the relative expression level. Lower normalized Ct value meant higher TRAF6 or hsa-miR-138 expression. (A) Normalized Ct value of TRAF6 mRNA was significant lower in AG genotype than that in AA genotype (p = 0.013), thus the expression level of TRAF6 was higher in patients carrying rs5030486 AG genotype than those carrying AA genotype. (B) No statistical difference in normalized Ct value of hsa-miR-138 was detected between patients carrying rs5030486 AG genotype and AA genotype (p = 0.225).

Using both TargetScan (http://www.targetscan.org; version 6.2) and PolymiRTS (http://compbio.uthsc.edu/miRSNP; last updated in Apr. 2012), we found that hsa-miR-138 was a putative microRNA which could bind to rs5030486 of TRAF6. Our hypothesis was that the mRNA-miRNA binding affinity would be different when miR-138 bound to different rs5030486 genotypes, and the difference of affinity might change the expression of TRAF6. In order to validate this hypothesis, we tried to exclude the possibility that patients with different rs5030486 genotypes might have different miR-138 levels, which might contribute to the change of TRAF6 expression. The expression level of miR-138 was examined in PBMCs from 24 OSCC patients by real-time quantitative PCR. As shown in Figure 3, no statistical difference in normalized Ct values of miR-138 was found between patients with rs5030486 AG (mean±SD: 183.49±17.37) and AA genotypes (mean±SD: 195.95±23.77) (p = 0.225).

Discussion

A number of studies have reported the contribution of TLRs genes to the development and progression of OSCC [24], [25]. However, the effect of SNPs in microRNA binding sites of TRLs pathway genes on OSCC predisposition is still unknown. In this study, we selected 16 SNPs by methodically screening the miR-SNPs in OSCC related TLRs pathway genes, and then performed a hospital-based case-control study to explore the association between these SNPs and OSCC risk. We found that rs5030486,the polymorphisms on 3′ UTR of TRAF6, had significant association with OSCC risk.

TRAF6 (Tumor necrosis factor receptor-associated factors 6) is an adaptor protein capable of interacting with a variety of cell surface receptors. [26]. As an important adaptor protein, TRAF6 is involved in various signaling pathways and cell behaviors [27], [28]. Recent studies have shown that TRAF6 plays an important role in cancer pathogenicity [29], [30]. Based on previous studies about the function of TRAF6 in other cancers, we hypothesized that TRAF6 might also contribute to the initiation and development of OSCC. In this study, our data demonstrated a potential association between rs5030486 of TRAF6 and OSCC risk in Chinese Han Population. To our knowledge, this study is the first to explore the relationship between a TRAF6 polymorphism and OSCC risk.

Although TRAF6 has been demonstrated to play a key role in a variety of cellular processes [31], [32], information about the expression and function of TRAF6 in vivo is still unknown. Up to date, few studies have investigated the prognostic role of TRAF6 in human cancers. Paik et al demonstrated that the miR-146a, which targeted TRAF6 directly, could predict the prognosis of NK/T-cell lymphoma [33]. In another study, the TRAF6 was correlated with the progression-free survival of NSCLC patients, concordant with the expression of BRCA1/AEG-1 [34]. To the best of our knowledge, the potential prognostic value of TRAF6 in OSCC has never been clarified before. In this study, we found that AG genotype of SNP rs5030486, located in 3′UTR of TRAF6, was correlated with a longer progression–free time of OSCC. In addition, the results of multivariate analysis showed that SNP rs5030486 could be used as an independent prognostic factor for progression–free survival. This is the first study exploring the association between TRAF6 and progression of OSCC.

Disruption of mRNA-miRNA interactions could cause abnormal changes in mRNA expression, potentially leading to cancer development and progression. As rs5030486 was predicted to be located in a miRNA binding site, we expected this SNP would cause a change in TRAF6 expression. After analyzing the mRNA level of TRAF6 from PBMC in 24 OSCC patients, we found a significant difference in TRAF6 expression between patients carrying AG and AA genotypes. Meanwhile, expression level of hsa-miR-138, which was predicted to bind to rs5030486, showed no difference between patients carrying AG and AA genotypes. Therefore, it is implied that the change of TRAF6 expression was caused by the base transformation from A to G at SNP rs5030486 other than variation of miR-138 expression.

TRAF6 is an essential adaptor protein which is recruited by MyD88 in the TRL4/IL-1R pathway. So far, 11 TLR members have been identified, and TRL4 is the best-characterized member of this family. TLR4 can trigger the cascade reaction to activate two important transcription factors, NF-κB and AP-1, after recognizing the lipopolysaccharides (LPS) by recruiting adaptors such as MyD88, IRAK, TRAF6 and MAP3K7 [35]. NF-κB and AP-1 play key roles in cancer development by regulating the proliferation, differentiation, apoptosis and metastasis of cancer cells [36]. These two transcription factors were also found to contribute to the development and progression of OSCC [37], [38]. Given the critical function of TRAF6 in activating the NF-κB and AP-1 pathways, it is not surprising that genetic variations in TRAF6 gene could affect the risk and progression of OSCC. As this genetic variation resides in the miRNA-binding site, it may regulate the pathways by influencing the transcription and translation of the TRL4/IL-1R pathway gene.

In this study, we provided evidence for the potential association of SNP rs5030486 within the 3′ UTR of TRAF6 with OSCC susceptibility and progression in Chinese Han population. Moreover, the existence of this SNP could lead to the change of TRAF6 expression level in PBMCs of OSCC patients. Based on these results, we demonstrated for the first time that SNP rs5030486 could influence the risk of OSCC. This study also demonstrated the feasibility of the bioinformatics approach we used to identify candidate disease-related miR-SNPs. However, there are some limitations of this study. In order to elucidate the exact mechanism by which SNP rs5030486 affects TRAF6 expression, further functional experiments are still required to detect the protein level of TRAF6 in OSCC patient carrying different rs5030486 genotypes. In addition, further studies are needed to understand the effect that SNP rs5030486 has on the binding affinity between putative miRNA and TRAF6. Furthermore, replicating case-control studies on a larger scale and longer-time follow-up study are also required to verify the possible association between SNP rs5030486 of TRAF6 and OSCC risk and progression. In conclusion, we have revealed new insights into the association of polymorphisms within the non-coding area of genes with OSCC. The finding in the study might also provide a potential biomarker for the diagnostic and prognostic of OSCC in future.

Supporting Information

Table S1

90 candidate genes in the SNPs selection flow.

(DOCX)

Table S2

58 candidate SNPs in the SNPs selection flow.

(DOCX)

Table S3

16 potential functional SNPs in the SNPs selection flow.

(DOCX)

Table S4

Demographic characteristics in the entire cohort and survival analysis sub-cohort.

(DOCX)

Funding Statement

This work was supported by grants from the National Natural Science Foundation of China (No. 81321002, 81072218, 81270040, 81102060, 81200791, 81001208, 81302371, 81321002), Doctoral Program of the Ministry of Education of China (No. 20110181110055, 20100181120057) and the International Science and Technology Cooperation Program of China (No. 2012DFA31370). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Johnson NW, Warnakulasuriya S, Gupta PC, Dimba E, Chindia M, et al. (2011) Global oral health inequalities in incidence and outcomes for oral cancer: causes and solutions. Adv Dent Res 23: 237–246. [DOI] [PubMed] [Google Scholar]
  • 2. Choi S, Myers JN (2008) Molecular pathogenesis of oral squamous cell carcinoma: implications for therapy. J Dent Res 87: 14–32. [DOI] [PubMed] [Google Scholar]
  • 3. Stadler ME, Patel MR, Couch ME, Hayes DN (2008) Molecular biology of head and neck cancer: risks and pathways. Hematol Oncol Clin North Am 22: 1099–1124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Moss SF, Blaser MJ (2005) Mechanisms of disease: Inflammation and the origins of cancer. Nature clinical practice. Oncology 2: 90–97. [DOI] [PubMed] [Google Scholar]
  • 5. Karin M, Lawrence T, Nizet V (2006) Innate immunity gone awry: linking microbial infections to chronic inflammation and cancer. Cell 124: 823–835. [DOI] [PubMed] [Google Scholar]
  • 6. Pisani P, Parkin DM (1996) Screening for gastric cancer. Cancer Treat Res 86: 113–119. [DOI] [PubMed] [Google Scholar]
  • 7. Medzhitov R, Horng T (2009) Transcriptional control of the inflammatory response. Nat Rev Immunol 9: 692–703. [DOI] [PubMed] [Google Scholar]
  • 8. Kawai T, Akira S (2010) The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nat Immunol 11: 373–384. [DOI] [PubMed] [Google Scholar]
  • 9. Kim S, Karin M (2011) Role of TLR2-dependent inflammation in metastatic progression. Ann N Y Acad Sci 1217: 191–206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Pinto A, Morello S, Sorrentino R (2011) Lung cancer and Toll-like receptors. Cancer Immunol Immunother 60: 1211–1220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Chen R, Alvero AB, Silasi DA, Steffensen KD, Mor G (2008) Cancers take their Toll—the function and regulation of Toll-like receptors in cancer cells. Oncogene 27: 225–233. [DOI] [PubMed] [Google Scholar]
  • 12. Kotrashetti V, Nayak R, Bhat K, Hosmani J, Somannavar P (2013) Immunohistochemical expression of TLR4 and TLR9 in various grades of oral epithelial dysplasia and squamous cell carcinoma, and their roles in tumor progression: a pilot study. Biotechnic & histochemistry 88: 311–322. [DOI] [PubMed] [Google Scholar]
  • 13. Paleja B, Anand A, Chaukar D, D′Cruz A, Chiplunkar S (2013) Decreased functional response to Toll like receptor ligands in patients with oral cancer. Hum Immunol 74: 927–936. [DOI] [PubMed] [Google Scholar]
  • 14. Yang M, Li Y, Padgett RW (2005) MicroRNAs: Small regulators with a big impact. Cytokine Growth Factor Rev 16: 387–393. [DOI] [PubMed] [Google Scholar]
  • 15. Kim VN (2005) Small RNAs: classification, biogenesis, and function. Mol Cells 19: 1–15. [PubMed] [Google Scholar]
  • 16. Ryan BM, Robles AI, Harris CC (2010) Genetic variation in microRNA networks: the implications for cancer research. Nat Rev Cancer 10: 389–402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Wynendaele J, Bohnke A, Leucci E, Nielsen SJ, Lambertz I, et al. (2010) An illegitimate microRNA target site within the 3′ UTR of MDM4 affects ovarian cancer progression and chemosensitivity. Cancer Res 70: 9641–9649. [DOI] [PubMed] [Google Scholar]
  • 18. Zhang L, Liu Y, Song F, Zheng H, Hu L, et al. (2011) Functional SNP in the microRNA-367 binding site in the 3′UTR of the calcium channel ryanodine receptor gene 3 (RYR3) affects breast cancer risk and calcification. Proc Natl Acad Sci U S A 108: 13653–13658. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Campayo M, Navarro A, Vinolas N, Tejero R, Muñoz C, et al. (2011) A dual role for KRT81: a miR-SNP associated with recurrence in non-small-cell lung cancer and a novel marker of squamous cell lung carcinoma. PLoS One 6: 2509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Bamshad MJ, Ng SB, Bigham AW, Tabor HK, Emond MJ, et al. (2011) Exome sequencing as a tool for Mendelian disease gene discovery. Nat Rev Genet 12: 745–755. [DOI] [PubMed] [Google Scholar]
  • 21. Kiezun A, Garimella K, Do R, Stitziel NO, Neale BM, et al. (2012) Exome sequencing and the genetic basis of complex traits. Nat Genet 44: 623–630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Engle LJ, Simpson CL, Landers JE (2006) Using high-throughput SNP technologies to study cancer. Oncogene 25: 1594–1601. [DOI] [PubMed] [Google Scholar]
  • 23. Wu YY, Cao HH, Kang N, Gong P, Ou GM (2013) Expression of cellular fibronectin mRNA in adult periodontitis and peri-implantitis: a real-time polymerase chain reaction study. Int J Oral Sci 5: 212–216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Kauppila JH, Mattila AE, Karttunen TJ, Salo T (2013) Toll-like receptor 5 (TLR5) expression is a novel predictive marker for recurrence and survival in squamous cell carcinoma of the tongue. Br J Cancer 108: 638–643. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Sun Z, Luo Q, Ye D, Chen W, Chen F (2012) Role of toll-like receptor 4 on the immune escape of human oral squamous cell carcinoma and resistance of cisplatin-induced apoptosis. Mol Cancer 11: 33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Bradley JR, Pober JS (2001) Tumor necrosis factor receptor-associated factors (TRAFs). Oncogene 20: 6482–6491. [DOI] [PubMed] [Google Scholar]
  • 27. King CG, Kobayashi T, Cejas PJ, Kim T, Yoon K, et al. (2006) TRAF6 is a T cell-intrinsic negative regulator required for the maintenance of immune homeostasis. Nat Med 12: 1088–1092. [DOI] [PubMed] [Google Scholar]
  • 28. Lamothe B, Webster WK, Gopinathan A, Besse A, Campos AD, Darnay BG (2007) TRAF6 ubiquitin ligase is essential for RANKL signaling and osteoclast differentiation. Biochem Biophys Res Commun 359: 1044–1049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Zhong L, Cao F, You Q (2013) Effect of TRAF6 on the biological behavior of human lung adenocarcinoma cell. Tumour biology 34: 231–239. [DOI] [PubMed] [Google Scholar]
  • 30. Yao F, Han Q, Zhong C, Zhao H (2013) TRAF6 promoted the tumorigenicity of esophageal squamous cell carcinoma. Tumour biology 34: 3201–3207. [DOI] [PubMed] [Google Scholar]
  • 31. Bradley JR, Pober JS (2001) Tumor necrosis factor receptor-associated factors (TRAFs). Oncogene 20: 6482–6491. [DOI] [PubMed] [Google Scholar]
  • 32. Kawai T, Akira S (2006) TLR signaling. Cell Death Differ 13: 816–825. [DOI] [PubMed] [Google Scholar]
  • 33. Paik JH, Jang JY, Jeon YK, Kim WY, Kim TM, et al. (2011) MicroRNA-146a downregulates NF-kappaB activity via targeting TRAF6 and functions as a tumor suppressor having strong prognostic implications in NK/T cell lymphoma. Clinical cancer research 17: 4761–4771. [DOI] [PubMed] [Google Scholar]
  • 34. Santarpia M, Magri I, Sanchez-Ronco M, Costa C, Molina-Vila MA, et al. (2011) mRNA expression levels and genetic status of genes involved in the EGFR and NF-kappaB pathways in metastatic non-small-cell lung cancer patients. J Transl Med 9: 163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Kawai T, Akira S (2005) Toll-like receptor downstream signaling. Arthritis Res Ther 7: 12–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Sethi G, Shanmugam MK, Ramachandran L, Kumar AP, Tergaonkar V (2012) Multifaceted link between cancer and inflammation. Biosci Rep 32: 1–15. [DOI] [PubMed] [Google Scholar]
  • 37. Mishra A, Bharti AC, Saluja D, Das BC (2010) Transactivation and expression patterns of Jun and Fos/AP-1 super-family proteins in human oral cancer. Int J Cancer 126: 819–829. [DOI] [PubMed] [Google Scholar]
  • 38. Freudlsperger C, Bian Y, Contag WS, Burnett J, Coupar J, et al. (2013) TGF-beta and NF-kappaB signal pathway cross-talk is mediated through TAK1 and SMAD7 in a subset of head and neck cancers. Oncogene 32: 1549–1559. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1

90 candidate genes in the SNPs selection flow.

(DOCX)

Table S2

58 candidate SNPs in the SNPs selection flow.

(DOCX)

Table S3

16 potential functional SNPs in the SNPs selection flow.

(DOCX)

Table S4

Demographic characteristics in the entire cohort and survival analysis sub-cohort.

(DOCX)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES